Search Results

Search found 3872 results on 155 pages for 'argument deduction'.

Page 145/155 | < Previous Page | 141 142 143 144 145 146 147 148 149 150 151 152  | Next Page >

  • Dependency Injection and Unit of Work pattern

    - by sunwukung
    I have a dilemma. I've used DI (read: factory) to provide core components for a homebrew ORM. The container provides database connections, DAO's,Mappers and their resultant Domain Objects on request. Here's a basic outline of the Mappers and Domain Object classes class Mapper{ public function __constructor($DAO){ $this->DAO = $DAO; } public function load($id){ if(isset(Monitor::members[$id]){ return Monitor::members[$id]; $values = $this->DAO->selectStmt($id); //field mapping process omitted for brevity $Object = new Object($values); return $Object; } } class User(){ public function setName($string){ $this->name = $string; //mark modified by means fair or foul } } The ORM also contains a class (Monitor) based on the Unit of Work pattern i.e. class Monitor(){ private static array modified; private static array dirty; public function markClean($class); public function markModified($class); } The ORM class itself simply co-ordinates resources extracted from the DI container. So, to instantiate a new User object: $Container = new DI_Container; $ORM = new ORM($Container); $User = $ORM->load('user',1); //at this point the container instantiates a mapper class //and passes a database connection to it via the constructor //the mapper then takes the second argument and loads the user with that id $User->setName('Rumpelstiltskin');//at this point, User must mark itself as "modified" My question is this. At the point when a user sets values on a Domain Object class, I need to mark the class as "dirty" in the Monitor class. I have one of three options as I can see it 1: Pass an instance of the Monitor class to the Domain Object. I noticed this gets marked as recursive in FirePHP - i.e. $this-Monitor-markModified($this) 2: Instantiate the Monitor directly in the Domain Object - does this break DI? 3: Make the Monitor methods static, and call them from inside the Domain Object - this breaks DI too doesn't it? What would be your recommended course of action (other than use an existing ORM, I'm doing this for fun...)

    Read the article

  • Binding functions of derived class with luabind

    - by Anamon
    I am currently developing a plugin-based system in C++ which provides a Lua scripting interface, for which I chose to use luabind. I'm using Lua 5 and luabind 0.9, both statically linked and compiled with MSVC++ 8. I am now having trouble binding functions with luabind when they are defined in a derived class, but not its parent class. More specifically, I have an abstract base class called 'IPlugin' from which all plugin classes inherit. When the plugin manager initialises, it registers that class and its functions like this: luabind::open(L); luabind::module(L) [ luabind::class_("IPlugin") .def("start", (void(IPlugin::*)())&IPlugin::start) ]; As it is only known at runtime what effective plugin classes are available, I had to solve loading plugins in a kind of roundabout way. The plugin manager exposes a factory function to Lua, which takes the name of a plugin class and a desired object name. The factory then creates the object, registers the plugin's class as inheriting from the 'IPlugin' base class, and immediately calls a function on the created object that registers itself as a global with the Lua state, like this: void PluginExample::registerLuaObject(lua_State *L, string a_name) { luabind::globals(L)[a_name] = (PluginExample*)this; } I initially did this because I had problems with Lua determining the most derived class of the object, as if I register it from the StreamManager it is only known as a subtype of 'IPlugin' and not the specific subtype. I'm not sure anymore if this is even necessary though, but it works and the created object is subsequently accessible from Lua under 'a_name'. The problem I have, though, is that functions defined in the derived class, which were not declared at all in the parent class, cannot be used. Virtual functions defined in the base class, such as 'start' above, work fine, and calling them from Lua on the new object runs the respective redefined code from the 'PluginExample' class. But if I add a new function to 'PluginExample', here for example a function taking no arguments and returning void, and register it like this: luabind::module(L) [ luabind::class_("PluginExample") .def(luabind::constructor()) .def("func", &PluginExample::func) ]; calling 'func' on the new object yields the following Lua runtime error: No matching overload found, candidates: void func(PluginExample&) I am correctly using the ':' syntax so the 'self' argument is not needed and it seems suddenly Lua cannot determine the derived type of the object anymore. I am sure I am doing something wrong, probably having to do with the two-step binding required by my system architecture, but I can't figure out where. I'd much appreciate some help =)

    Read the article

  • Qt - problem appending to QList of QList

    - by bullettime
    I'm trying to append items to a QList at runtime, but I'm running on a error message. Basically what I'm trying to do is to make a QList of QLists and add a few customClass objects to each of the inner lists. Here's my code: widget.h: class Widget : public QWidget { Q_OBJECT public: Widget(QWidget *parent = 0); ~Widget(); public slots: static QList<QList<customClass> > testlist(){ QList<QList<customClass> > mylist; for(int w=0 ; w<5 ; w++){ mylist.append(QList<customClass>()); } for(int z=0 ; z<mylist.size() ; z++){ for(int x=0 ; x<10 ; x++){ customClass co = customClass(); mylist.at(z).append(co); } } return mylist; } }; customclass.h: class customClass { public: customClass(){ this->varInt = 1; this->varQString = "hello world"; } int varInt; QString varQString; }; main.cpp: int main(int argc, char *argv[]) { QApplication a(argc, argv); Widget w; QList<QList<customClass> > list; list = w.testlist(); w.show(); return a.exec(); } But when I try to run the application, it gives off this error: error: passing `const QList<customClass>' as `this' argument of `void List<T>::append(const T&) [with T = customClass]' discards qualifiers I also tried inserting the objects using foreach: foreach(QList<customClass> list, mylist){ for(int x=0 ; x<10 ; x++){ list.append(customClass()); } } The error was gone, but the customClass objects weren't appended, I could verify that by using a debugging loop in main that showed the inner QLists sizes as zero. What am I doing wrong?

    Read the article

  • Opinion on "loop invariants", and are these frequently used in the industry?

    - by Michael Aaron Safyan
    I was thinking back to my freshman year at college (five years ago) when I took an exam to place-out of intro-level computer science. There was a question about loop invariants, and I was wondering if loop invariants are really necessary in this case or if the question was simply a bad example... the question was to write an iterative definition for a factorial function, and then to prove that the function was correct. The code that I provided for the factorial function was as follows: public static int factorial(int x) { if ( x < 0 ){ throw new IllegalArgumentException("Parameter must be = 0"); }else if ( x == 0 ){ return 1; }else{ int result = 1; for ( int i = 1; i <= x; i++ ){ result*=i; } return result; } } My own proof of correctness was a proof by cases, and in each I asserted that it was correct by definition (x! is undefined for negative values, 0! is 1, and x! is 1*2*3...*x for a positive value of x). The professor wanted me to prove the loop using a loop invariant; however, my argument was that it was correct "by definition", because the definition of "x!" for a positive integer x is "the product of the integers from 1... x", and the for-loop in the else clause is simply a literal translation of this definition. Is a loop invariant really needed as a proof of correctness in this case? How complicated must a loop be before a loop invariant (and proper initialization and termination conditions) become necessary for a proof of correctness? Additionally, I was wondering... how often are such formal proofs used in the industry? I have found that about half of my courses are very theoretical and proof-heavy and about half are very implementation and coding-heavy, without any formal or theoretical material. How much do these overlap in practice? If you do use proofs in the industry, when do you apply them (always, only if it's complicated, rarely, never)?

    Read the article

  • Add new row to asp .net grid view using button

    - by SARAVAN
    Hi, I am working in ASP .net 2.0. I am a learner. I have a grid view which has a button in it. Please find the asp mark up below <form id="form1" runat="server"> <div> <asp:GridView ID="myGridView" runat="server"> <Columns> <asp:TemplateField> <ItemTemplate> <asp:Button CommandName="AddARowBelow" Text="Add A Row Below" runat="server" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> </div> </form> Please find the code behind below. using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.UI; using System.Data; using System.Web.UI.WebControls; namespace GridViewDemo { public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { DataTable dt = new DataTable("myTable"); dt.Columns.Add("col1"); dt.Columns.Add("col2"); dt.Columns.Add("col3"); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); myGridView.DataSource = dt; myGridView.DataBind(); } protected void myGridView_RowCommand(object sender, GridViewCommandEventArgs e) { } } } I was thinking that when I click the command button, it would fire the mygridview_rowcommand() but instead it threw an error as follows: Invalid postback or callback argument. Event validation is enabled using in configuration or <%@ Page EnableEventValidation="true" % in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Can any one let me know on where I am going wrong?

    Read the article

  • XCode sqlite3 - SELECT always return SQLITE_DONE

    - by user573633
    Hi developers.... a noob here asking for help after a day of head-banging.... I am working on an app with sqlite3 database with one database and two tables. I have now come to a step where I want to select from the table with an argument. The code is here: -(NSMutableArray*) getGroupsPeopleWhoseGroupName:(NSString*)gn;{ NSMutableArray *groupedPeopleArray = [[NSMutableArray alloc] init]; const char *sql = "SELECT * FROM Contacts WHERE groupName='?'"; @try { NSArray * paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory,NSUserDomainMask, YES); NSString *docsDir = [paths objectAtIndex:0]; NSString *theDBPath = [docsDir stringByAppendingPathComponent:@"ContactBook.sqlite"]; if (!(sqlite3_open([theDBPath UTF8String], &database) == SQLITE_OK)) { NSLog(@"An error opening database."); } sqlite3_stmt *st; NSLog(@"debug004 - sqlite3_stmt success."); if (sqlite3_prepare_v2(database, sql, -1, &st, NULL) != SQLITE_OK) { NSLog(@"Error, failed to prepare statement."); } //DB is ready for accessing, now start getting all the info. while (sqlite3_step(st) == SQLITE_ROW) { MyContacts * aContact = [[MyContacts alloc] init]; //get contactID from DB. aContact.contactID = sqlite3_column_int(st, 0); if (sqlite3_column_text(st, 1) != NULL) { aContact.firstName = [NSString stringWithUTF8String:(char *) sqlite3_column_text(st, 1)]; } else { aContact.firstName = @""; } // here retrieve other columns data .... //store these info retrieved into the newly created array. [groupedPeopleArray addObject:aContact]; [aContact release]; } if(sqlite3_finalize(st) != SQLITE_OK) { NSLog(@"Failed to finalize data statement."); } if (sqlite3_close(database) != SQLITE_OK) { NSLog(@"Failed to close database."); } } @catch (NSException *e) { NSLog(@"An exception occurred: %@", [e reason]); return nil; } return groupedPeopleArray;} MyContacts is the class where I put up all the record variables. My problem is sqlite3_step(st) always return SQLITE_DONE, so that it i can never get myContacts. (i verified this by checking the return value). What am I doing wrong here? Many thanks in advance!

    Read the article

  • pthread and recursively calling execvp in C

    - by eduke
    To begin I'm sorry for my english :) I looking for a way to create a thread each time my program finds a directory, in order to call the program itself but with a new argv[2] argument (which is the current dir). I did it successfully with fork() but with pthread I've some difficulties. I don't know if I can do something like that : #include <unistd.h> #include <stdlib.h> #include <stdio.h> #include <string.h> #include <sys/types.h> #include <sys/stat.h> #include <sys/wait.h> #include <dirent.h> int main(int argc, char **argv) { pthread_t threadID[10] = {0}; DIR * dir; struct dirent * entry; struct stat status; pthread_attr_t attr; pthread_attr_init(&attr); int i = 0; char *res; char *tmp; char *file; if(argc != 3) { printf("Usage : %s <file> <dir>\n", argv[0]); exit(EXIT_FAILURE); } if(stat(argv[2],&status) == 0) { dir = opendir(argv[2]); file = argv[1]; } else exit(EXIT_FAILURE); while ((entry = readdir(dir))) { if (strcmp(entry->d_name, ".") && strcmp(entry->d_name, "..")) { tmp = malloc(strlen(argv[2]) + strlen(entry->d_name) + 2); strcpy(tmp, argv[2]); strcat(tmp, "/"); strcat(tmp, entry->d_name); stat(tmp, &status); if (S_ISDIR(status.st_mode)) { argv[2] = tmp; pthread_create( &threadID[i], &attr, execvp(argv[0], argv), NULL); printf("New thread created : %d", i); i++; } else if (!strcmp(entry->d_name, file)) { printf(" %s was found - Thread number = %d\n",tmp, i); break; } free(tmp); } } pthread_join( threadID[i] , &res ); exit(EXIT_SUCCESS); } Actually it doesn't works : pthread_create( &threadID[i], &attr, execvp(argv[0], argv), NULL); I have no runtime error, but when the file to find is in another directory, the thread is not created and so execvp(argv[0], argv) is not called... Thank you for you help, Simon

    Read the article

  • Code-Golf: Friendly Number Abbreviator

    - by David Murdoch
    Based on this question: Is there a way to round numbers into a friendly format? THE CHALLENGE - UPDATED! (removed hundreds abbreviation from spec) The shortest code by character count that will abbreviate an integer (no decimals). Code should include the full program. Relevant range is from 0 - 9,223,372,036,854,775,807 (the upper limit for signed 64 bit integer). The number of decimal places for abbreviation will be positive. You will not need to calculate the following: 920535 abbreviated -1 place (which would be something like 0.920535M). Numbers in the tens and hundreds place (0-999) should never be abbreviated (the abbreviation for the number 57 to 1+ decimal places is 5.7dk - it is unneccessary and not friendly). Remember to round half away from zero (23.5 gets rounded to 24). Banker's rounding is verboten. Here are the relevant number abbreviations: h = hundred (102) k = thousand (103) M = million (106) G = billion (109) T = trillion (1012) P = quadrillion (1015) E = quintillion (1018) SAMPLE INPUTS/OUTPUTS (inputs can be passed as separate arguments): First argument will be the integer to abbreviate. The second is the number of decimal places. 12 1 => 12 // tens and hundreds places are never rounded 1500 2 => 1.5k 1500 0 => 2k // look, ma! I round UP at .5 0 2 => 0 1234 0 => 1k 34567 2 => 34.57k 918395 1 => 918.4k 2134124 2 => 2.13M 47475782130 2 => 47.48G 9223372036854775807 3 => 9.223E // ect... . . . Original answer from related question (javascript, does not follow spec): function abbrNum(number, decPlaces) { // 2 decimal places => 100, 3 => 1000, etc decPlaces = Math.pow(10,decPlaces); // Enumerate number abbreviations var abbrev = [ "k", "m", "b", "t" ]; // Go through the array backwards, so we do the largest first for (var i=abbrev.length-1; i>=0; i--) { // Convert array index to "1000", "1000000", etc var size = Math.pow(10,(i+1)*3); // If the number is bigger or equal do the abbreviation if(size <= number) { // Here, we multiply by decPlaces, round, and then divide by decPlaces. // This gives us nice rounding to a particular decimal place. number = Math.round(number*decPlaces/size)/decPlaces; // Add the letter for the abbreviation number += abbrev[i]; // We are done... stop break; } } return number; }

    Read the article

  • Why do some questions get closed for no reason? [closed]

    - by IVlad
    Recently there was a question asking about generating all subsets of a set using a stack and a queue, which was closed (and now deleted it seems) as not a real question for no good reason, since it didn't fit into any of these conditions: It's difficult to tell what is being asked here. No, it was clear what was being asked. This question is ambiguous, vague, incomplete, or rhetorical and cannot be reasonably answered in its current form. Not ambiguous, not vague, not incomplete, definitely not rhetorical and could easily be answered if one knew the solution. Now, the exact same thing has happened with this question: http://stackoverflow.com/questions/2791982/a-shortest-path-problem-with-superheroes-and-intergalactic-journeys/2793746#2793746 I am interested in hearing a logical argument for why that question is either ambiguous, vague, incomplete, rhetorical or cannot reasonably be answered in its current form. It seems that (the same bunch of) people like to close questions that they think are homework questions, especially when they think people want to be served the solution on a platter, which is also not the case: Any suggestions or ideas of how this problem might be solved would be most welcomed. Most of the time the people asking these questions are very reasonable and appreciate even the most vague idea, yet their question is closed. Let's go further and assume that it IS a homework problem. So what? When I registered here I didn't see any rule that said not to post homework problems, nor do I see such a rule now. What is wrong with posting homework problems that makes people hunt them down with a passion to close them without even reading the entire question body? This site is full of questions asked by people who get paid to know the things they are asking, yet their questions are considered fine. How is solving someone's homework problem worse? In some places (like where I live), computer science is a mandatory high school subject, and not everyone is interested in it. How is helping at least those people worse than doing someone's JOB? Not answering homework questions is fine and it's everyone's choice, but I consider closing them to be an act of power abuse, selfishness, and an insult to the fellow community members who are also interested in a solution or want feedback on their proposed solution. So my questions are: - Why do questions like the above get closed for reasons that do not apply? Why do you close them? Why don't you? - Why doesn't a vote to reopen a question reopen it automatically? Needing 5 votes for a reopen takes too long, and it's not fair because one reopen vote basically cancels out a close vote, making it 4 close votes (or 5 to 1, which is the same as only 4 people wanting to close the question), which isn't enough to close the question. I think a question should only be closed when CloseVotes - ReopenVotes >= 5. I'm hoping this will stay up, but I realize it probably won't. In either case, I think this is worth saying and discussing, since it IS community-related.

    Read the article

  • C# Select clause returns system exception instead of relevant object

    - by Kashif
    I am trying to use the select clause to pick out an object which matches a specified name field from a database query as follows: objectQuery = from obj in objectList where obj.Equals(objectName) select obj; In the results view of my query, I get: base {System.SystemException} = {"Boolean Equals(System.Object)"} Where I should be expecting something like a Car, Make, or Model Would someone please explain what I am doing wrong here? The method in question can be seen here: // this function searches the database's table for a single object that matches the 'Name' property with 'objectName' public static T Read<T>(string objectName) where T : IEquatable<T> { using (ISession session = NHibernateHelper.OpenSession()) { IQueryable<T> objectList = session.Query<T>(); // pull (query) all the objects from the table in the database int count = objectList.Count(); // return the number of objects in the table // alternative: int count = makeList.Count<T>(); IQueryable<T> objectQuery = null; // create a reference for our queryable list of objects T foundObject = default(T); // create an object reference for our found object if (count > 0) { // give me all objects that have a name that matches 'objectName' and store them in 'objectQuery' objectQuery = from obj in objectList where obj.Equals(objectName) select obj; // make sure that 'objectQuery' has only one object in it try { foundObject = (T)objectQuery.Single(); } catch { return default(T); } // output some information to the console (output screen) Console.WriteLine("Read Make: " + foundObject.ToString()); } // pass the reference of the found object on to whoever asked for it return foundObject; } } Note that I am using the interface "IQuatable<T>" in my method descriptor. An example of the classes I am trying to pull from the database is: public class Make: IEquatable<Make> { public virtual int Id { get; set; } public virtual string Name { get; set; } public virtual IList<Model> Models { get; set; } public Make() { // this public no-argument constructor is required for NHibernate } public Make(string makeName) { this.Name = makeName; } public override string ToString() { return Name; } // Implementation of IEquatable<T> interface public virtual bool Equals(Make make) { if (this.Id == make.Id) { return true; } else { return false; } } // Implementation of IEquatable<T> interface public virtual bool Equals(String name) { if (this.Name.Equals(name)) { return true; } else { return false; } } } And the interface is described simply as: public interface IEquatable<T> { bool Equals(T obj); }

    Read the article

  • What does these FindBug messages show?

    - by Hans Klock
    Not every description from from http://findbugs.sourceforge.net/bugDescriptions.html is clear to me. Sure, I can study the implementation but if somebody is more experienced then me, some explanation and examples would be great. Do you have some examples for UI_INHERITANCE_UNSAFE_GETRESOURCE when this is getting a problem? In BX_UNBOXED_AND_COERCED_FOR_TERNARY_OPERATOR I don't see the problem either. If one type is "bigger" then the other, for example int and float, then the result is float. If its Integer and Float its the wrapper Float too. That's what I expect. Does the GC_UNRELATED_TYPES really help to find errors? Isn't it the job of the compiler to check, if--taking the given example--Foo can't go into a Collection<String>. Does HE_SIGNATURE_DECLARES_HASHING_OF_UNHASHABLE_CLASS mean something like bla(Foo f){hashtable.put(f);}, where ´Foo´ is not hashable? Does FingBugs "see" the subclasses too? NP_GUARANTEED_DEREF_ON_EXCEPTION_PATH is stronger "wrong" then NP_ALWAYS_NULL_EXCEPTION? Why two error cases and with NP_NULL_ON_SOME_PATH_EXCEPTION even one more? Sounds very similar to me. What is an example of SIO_SUPERFLUOUS_INSTANCEOF? Something like foo(String s){if (s intenceof String) .... This does a null check too, but this is not the test here... NN_NAKED_NOTIFY. I my opinion the description is not clear. A change of the state is not necessary. If I use new Object() to wait and notify on I don't change the object state. Or is state the lock-state? I don't get it. SP_SPIN_ON_FIELD. Can this really happen that a compiler will move this outside from a loop? This doesn't make sense to me because from outside a Thread can always change the values. And if the variable is volatile the JVM can't cache the value. So what's the meaning? That is the difference between STCAL_STATIC_CALENDAR_INSTANCE and STCAL_INVOKE_ON_STATIC_CALENDAR_INSTANCE or STCAL_INVOKE_ON_STATIC_DATE_FORMAT_INSTANCE/STCAL_STATIC_SIMPLE_DATE_FORMAT_INSTANCE? Why is XXXX.class in WL_USING_GETCLASS_RATHER_THAN_CLASS_LITERAL better then getClass()? A getClass() in a superclass called from the subclass will always return the Class object from the subclass which is good I think. What exactly does EQ_UNUSUAL do? It should check that the argument is of the same type of the class itself but it does't? Did you ever had problems with breaks? Is there real value with SF_SWITCH_FALLTHROUGH? Sounds to strong for me. No idea what TQ_EXPLICIT_UNKNOWN_SOURCE_VALUE_REACHES_ALWAYS_SINK and TQ_EXPLICIT_UNKNOWN_SOURCE_VALUE_REACHES_NEVER_SINK could be.

    Read the article

  • Same data being returned by linq for 2 different executions of a stored procedure?

    - by Paul
    Hello I have a stored procedure that I am calling through Entity Framework. The stored procedure has 2 date parameters. I supply different argument in the 2 times I call the stored procedure. I have verified using SQL Profiler that the stored procedure is being called correctly and returning the correct results. When I call my method the second time with different arguments, even though the stored procedure is bringing back the correct results, the table created contains the same data as the first time I called it. dtStart = 01/08/2009 dtEnd = 31/08/2009 public List<dataRecord> GetData(DateTime dtStart, DateTime dtEnd) { var tbl = from t in db.SP(dtStart, dtEnd) select t; return tbl.ToList(); } GetData((new DateTime(2009, 8, 1), new DateTime(2009, 8, 31)) // tbl.field1 value = 45450 - CORRECT GetData(new DateTime(2009, 7, 1), new DateTime(2009, 7, 31)) // tbl.field1 value = 45450 - WRONG 27456 expected Is this a case of Entity Framework being clever and caching? I can't see why it would cache this though as it has executed the stored procedure twice. Do I have to do something to close tbl? using Visual Studio 2008 + Entity Framework. I also get the message "query cannot be enumerated more than once" a few times every now and then, am not sure if that is relevant? FULL CODE LISTING namespace ProfileDataService { public partial class DataService { public static List<MeterTotalConsumpRecord> GetTotalAllTimesConsumption(DateTime dtStart, DateTime dtEnd, EUtilityGroup ug, int nMeterSelectionType, int nCustomerID, int nUserID, string strSelection, bool bClosedLocations, bool bDisposedLocations) { dbChildDataContext db = DBManager.ChildDataConext(nCustomerID); var tbl = from t in db.GetTotalConsumptionByMeter(dtStart, dtEnd, (int) ug, nMeterSelectionType, nCustomerID, nUserID, strSelection, bClosedLocations, bDisposedLocations, 1) select t; return tbl.ToList(); } } } /// CALLER List<MeterTotalConsumpRecord> _P1Totals; List<MeterTotalConsumpRecord> _P2Totals; public void LoadData(int nUserID, int nCustomerID, ELocationSelectionMethod locationSelectionMethod, string strLocations, bool bIncludeClosedLocations, bool bIncludeDisposedLocations, DateTime dtStart, DateTime dtEnd, ReportsBusinessLogic.Lists.EPeriodType durMainPeriodType, ReportsBusinessLogic.Lists.EPeriodType durCompareToPeriodType, ReportsBusinessLogic.Lists.EIncreaseReportType rptType, bool bIncludeDecreases) { ///Code for setting properties using parameters.. _P2Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_P2StartDate, _P2EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); _P1Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_StartDate, _EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); PopulateLines() //This fills up a list of objects with information for my report ready for the totals to be added PopulateTotals(_P1Totals, 1); PopulateTotals(_P2Totals, 2); } void PopulateTotals(List<MeterTotalConsumpRecord> objTotals, int nPeriod) { MeterTotalConsumpRecord objMeterConsumption = null; foreach (IncreaseReportDataRecord objLine in _Lines) { objMeterConsumption = objTotals.Find(delegate(MeterTotalConsumpRecord t) { return t.MeterID == objLine.MeterID; }); if (objMeterConsumption != null) { if (nPeriod == 1) { objLine.P1Consumption = (double)objMeterConsumption.Consumption; } else { objLine.P2Consumption = (double)objMeterConsumption.Consumption; } objMeterConsumption = null; } } } }

    Read the article

  • Idiomatic use of auto_ptr to transfer ownership to a container

    - by heycam
    I'm refreshing my C++ knowledge after not having used it in anger for a number of years. In writing some code to implement some data structure for practice, I wanted to make sure that my code was exception safe. So I've tried to use std::auto_ptrs in what I think is an appropriate way. Simplifying somewhat, this is what I have: class Tree { public: ~Tree() { /* delete all Node*s in the tree */ } void insert(const string& to_insert); ... private: struct Node { ... vector<Node*> m_children; }; Node* m_root; }; template<T> void push_back(vector<T*>& v, auto_ptr<T> x) { v.push_back(x.get()); x.release(); } void Tree::insert(const string& to_insert) { Node* n = ...; // find where to insert the new node ... push_back(n->m_children, auto_ptr<Node>(new Node(to_insert)); ... } So I'm wrapping the function that would put the pointer into the container, vector::push_back, and relying on the by-value auto_ptr argument to ensure that the Node* is deleted if the vector resize fails. Is this an idiomatic use of auto_ptr to save a bit of boilerplate in my Tree::insert? Any improvements you can suggest? Otherwise I'd have to have something like: Node* n = ...; // find where to insert the new node auto_ptr<Node> new_node(new Node(to_insert)); n->m_children.push_back(new_node.get()); new_node.release(); which kind of clutters up what would have been a single line of code if I wasn't worrying about exception safety and a memory leak. (Actually I was wondering if I could post my whole code sample (about 300 lines) and ask people to critique it for idiomatic C++ usage in general, but I'm not sure whether that kind of question is appropriate on stackoverflow.)

    Read the article

  • Virtual member call in a constructor when assigning value to property

    - by comecme
    I have an Abstract class and a Derived class. The abstract class defines an abstract property named Message. In the derived class, the property is implemented by overriding the abstract property. The constructor of the derived class takes a string argument and assigns it to its Message property. In Resharper, this assignment leads to a warning "Virtual member call in constructor". The AbstractClass has this definition: public abstract class AbstractClass { public abstract string Message { get; set; } protected AbstractClass() { } public abstract void PrintMessage(); } And the DerivedClass is as follows: using System; public class DerivedClass : AbstractClass { private string _message; public override string Message { get { return _message; } set { _message = value; } } public DerivedClass(string message) { Message = message; // Warning: Virtual member call in a constructor } public DerivedClass() : this("Default DerivedClass message") {} public override void PrintMessage() { Console.WriteLine("DerivedClass PrintMessage(): " + Message); } } I did find some other questions about this warning, but in those situations there is an actual call to a method. For instance, in this question, the answer by Matt Howels contains some sample code. I'll repeat it here for easy reference. class Parent { public Parent() { DoSomething(); } protected virtual void DoSomething() {}; } class Child : Parent { private string foo; public Child() { foo = "HELLO"; } protected override void DoSomething() { Console.WriteLine(foo.ToLower()); } } Matt doesn't describe on what error the warning would appear, but I'm assuming it will be on the call to DoSomething in the Parent constructor. In this example, I understand what is meant by a virtual member being called. The member call occurs in the base class, in which only a virtual method exists. In my situation however, I don't see why assigning a value to Message would be calling a virtual member. Both the call to and the implementation of the Message property are defined in the derived class. Although I can get rid of the error by making my Derived Class sealed, I would like to understand why this situation is resulting in the warning.

    Read the article

  • Using fft2 with reshaping for an RGB filter

    - by Mahmoud Aladdin
    I want to apply a filter on an image, for example, blurring filter [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]. Also, I'd like to use the approach that convolution in Spatial domain is equivalent to multiplication in Frequency domain. So, my algorithm will be like. Load Image. Create Filter. convert both Filter & Image to Frequency domains. multiply both. reconvert the output to Spatial Domain and that should be the required output. The following is the basic code I use, the image is loaded and displayed as cv.cvmat object. Image is a class of my creation, it has a member image which is an object of scipy.matrix and toFrequencyDomain(size = None) uses spf.fftshift(spf.fft2(self.image, size)) where spf is scipy.fftpack and dotMultiply(img) uses scipy.multiply(self.image, image) f = Image.fromMatrix([[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]) lena = Image.fromFile("Test/images/lena.jpg") print lena.image.shape lenaf = lena.toFrequencyDomain(lena.image.shape) ff = f.toFrequencyDomain(lena.image.shape) lenafm = lenaf.dotMultiplyImage(ff) lenaff = lenafm.toTimeDomain() lena.display() lenaff.display() So, the previous code works pretty well, if I told OpenCV to load the image via GRAY_SCALE. However, if I let the image to be loaded in color ... lena.image.shape will be (512, 512, 3) .. so, it gives me an error when using scipy.fttpack.ftt2 saying "When given, Shape and Axes should be of same length". What I tried next was converted my filter to 3-D .. as [[[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]], [[1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0], [1/9.0, 1/9.0, 1/9.0]]] And, not knowing what the axes argument do, I added it with random numbers as (-2, -1, -1), (-1, -1, -2), .. etc. until it gave me the correct filter output shape for the dotMultiply to work. But, of course it wasn't the correct value. Things were totally worse. My final trial, was using fft2 function on each of the components 2-D matrices, and then re-making the 3-D one, using the following code. # Spiltting the 3-D matrix to three 2-D matrices. for i, row in enumerate(self.image): r.append(list()) g.append(list()) b.append(list()) for pixel in row: r[i].append(pixel[0]) g[i].append(pixel[1]) b[i].append(pixel[2]) rfft = spf.fftshift(spf.fft2(r, size)) gfft = spf.fftshift(spf.fft2(g, size)) bfft = spf.fftshift(spf.fft2(b, size)) newImage.image = sp.asarray([[[rfft[i][j], gfft[i][j], bfft[i][j]] for j in xrange(len(rfft[i]))] for i in xrange(len(rfft))] ) return newImage Any help on what I made wrong, or how can I achieve that for both GreyScale and Coloured pictures.

    Read the article

  • Solr Facet Search spring-data-solr

    - by sv1
    I am new to Solr and we are using Spring-data for Solr I have a question may be its too simple but I am unable to comprehend. Basically I need to search on any field but I have a "zip" field as one of the facet fields. I have a Solr repository . (Am not sure if the annotations on the Repository are correct.) public interface MyRepository extends SolrCrudRepository<MyPOJO, String> { @Query(value = "*:*") @Facet(fields={"zip"}) public FacetPage<MyPOJO> findByQueryandAnno(String searchTerm,Pageable page); } In my Service class I am trying to call this methods by Injecting MyRepository like below public class MyService { @Inject MyRepository solrRepo; @Inject SolrTemplate solrTemplate; public FacetPage<MyPOJO> tryFacets(String searchString){ //Here is where I am struggling SimpleFacetQuery query = new SimpleQuery(new SimpleStringCriteria(searchString)); query.setFacetOptions(new FacetOptions("zip")); //Not sure how to get the Pageable object. //But the repository doesnt accept without it. return solrTemplate.queryForPage(query,{Pageable Instance to be passed here}) } From my jUnit I am loading context files needed for Solr and Spring //In jUnit the test method looks like this service.tryFacets("some value"); and it fails with - method not found in the service class at the call to the repository method. *********EDIT**************** As per ChristophStrobl's advice created a copyfield called multivaluedCopyField and the searchString argument works good. But the facet still isnt working...Now my code looks like this. I get the MyPOJO object as response but the facetcount and the faceted values are missing. public interface MyRepository extends SolrCrudRepository<MyPOJO, String> { @Query(value = "*:*") @Facet(fields={"zip"}) public FacetPage<MyPOJO> findByQueryandAnno(String searchTerm,Pageable page); } My service class looks like public class MyService { @Inject MyRepository solrRepo; public FacetPage<MyPOJO> tryFacets(String searchString){ //Here is where I am struggling SimpleFacetQuery query = new SimpleQuery(new SimpleStringCriteria(searchString)).setPageRequest new PageRequest(0,5)); query.setFacetOptions(new FacetOptions("zip")); FacetPage<MyPOJO> facetedPOJO= solrRepo.findByQueryandAnno(searchString,query.getPageRequest()); return facetedPOJO; } My jUnit method call is like service.tryFacets("some value");

    Read the article

  • Best practices regarding equals: to overload or not to overload?

    - by polygenelubricants
    Consider the following snippet: import java.util.*; public class EqualsOverload { public static void main(String[] args) { class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } } List<Thing> myThings = Arrays.asList(new Thing(42)); System.out.println(myThings.contains(new Thing(42))); // prints "false" } } Note that contains returns false!!! We seems to have lost our things!! The bug, of course, is the fact that we've accidentally overloaded, instead of overridden, Object.equals(Object). If we had written class Thing as follows instead, then contains returns true as expected. class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.x == ((Thing) o).x); } } Effective Java 2nd Edition, Item 36: Consistently use the Override annotation, uses essentially the same argument to recommend that @Override should be used consistently. This advice is good, of course, for if we had tried to declare @Override equals(Thing other) in the first snippet, our friendly little compiler would immediately point out our silly little mistake, since it's an overload, not an override. What the book doesn't specifically cover, however, is whether overloading equals is a good idea to begin with. Essentially, there are 3 situations: Overload only, no override -- ALMOST CERTAINLY WRONG! This is essentially the first snippet above Override only (no overload) -- one way to fix This is essentially the second snippet above Overload and override combo -- another way to fix The 3rd situation is illustrated by the following snippet: class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.equals((Thing) o)); } } Here, even though we now have 2 equals method, there is still one equality logic, and it's located in the overload. The @Override simply delegates to the overload. So the questions are: What are the pros and cons of "override only" vs "overload & override combo"? Is there a justification for overloading equals, or is this almost certainly a bad practice?

    Read the article

  • Is this a valid pattern for raising events in C#?

    - by Will Vousden
    Update: For the benefit of anyone reading this, since .NET 4, the lock is unnecessary due to changes in synchronization of auto-generated events, so I just use this now: public static void Raise<T>(this EventHandler<T> handler, object sender, T e) where T : EventArgs { if (handler != null) { handlerCopy(sender, e); } } And to raise it: SomeEvent.Raise(this, new FooEventArgs()); Having been reading one of Jon Skeet's articles on multithreading, I've tried to encapsulate the approach he advocates to raising an event in an extension method like so (with a similar generic version): public static void Raise(this EventHandler handler, object @lock, object sender, EventArgs e) { EventHandler handlerCopy; lock (@lock) { handlerCopy = handler; } if (handlerCopy != null) { handlerCopy(sender, e); } } This can then be called like so: protected virtual void OnSomeEvent(EventArgs e) { this.someEvent.Raise(this.eventLock, this, e); } Are there any problems with doing this? Also, I'm a little confused about the necessity of the lock in the first place. As I understand it, the delegate is copied in the example in the article to avoid the possibility of it changing (and becoming null) between the null check and the delegate call. However, I was under the impression that access/assignment of this kind is atomic, so why is the lock necessary? Update: With regards to Mark Simpson's comment below, I threw together a test: static class Program { private static Action foo; private static Action bar; private static Action test; static void Main(string[] args) { foo = () => Console.WriteLine("Foo"); bar = () => Console.WriteLine("Bar"); test += foo; test += bar; test.Test(); Console.ReadKey(true); } public static void Test(this Action action) { action(); test -= foo; Console.WriteLine(); action(); } } This outputs: Foo Bar Foo Bar This illustrates that the delegate parameter to the method (action) does not mirror the argument that was passed into it (test), which is kind of expected, I guess. My question is will this affect the validity of the lock in the context of my Raise extension method? Update: Here is the code I'm now using. It's not quite as elegant as I'd have liked, but it seems to work: public static void Raise<T>(this object sender, ref EventHandler<T> handler, object eventLock, T e) where T : EventArgs { EventHandler<T> copy; lock (eventLock) { copy = handler; } if (copy != null) { copy(sender, e); } }

    Read the article

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • How do you return a pointer to a base class with a virtual function?

    - by Nick Sweet
    I have a base class called Element, a derived class called Vector, and I'm trying to redefine two virtual functions from Element in Vector. //element.h template <class T> class Element { public: Element(); virtual Element& plus(const Element&); virtual Element& minus(const Element&); }; and in another file //Vector.h #include "Element.h" template <class T> class Vector: public Element<T> { T x, y, z; public: //constructors Vector(); Vector(const T& x, const T& y = 0, const T& z =0); Vector(const Vector& u); ... //operations Element<T>& plus(const Element<T>& v) const; Element<T>& minus(const Element<T>& v) const; ... }; //sum template <class T> Element<T>& Vector<T>::plus(const Element<T>& v) const { Element<T>* ret = new Vector((x + v.x), (y + v.y), (z + v.z)); return *ret; } //difference template <class T> Element<T>& Vector<T>::minus(const Element<T>& v) const { Vector<T>* ret = new Vector((x - v.x), (y - v.y), (z - v.z)); return *ret; } but I always get error: 'const class Element' has no member named 'getx' So, can I define my virtual functions to take Vector& as an argument instead, or is there a way for me to access the data members of Vector through a pointer to Element? I'm still fairly new to inheritance polymorphism, fyi.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 141 142 143 144 145 146 147 148 149 150 151 152  | Next Page >