Search Results

Search found 24073 results on 963 pages for 'mount point'.

Page 156/963 | < Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >

  • WriteableBitmap failing badly, pixel array very inaccurate

    - by dawmail333
    I have tried, literally for hours, and I have not been able to budge this problem. I have a UserControl, that is 800x369, and it contains, simply, a path that forms a worldmap. I put this on a landscape page, then I render it into a WriteableBitmap. I then run a conversion to turn the 1d Pixels array into a 2d array of integers. Then, to check the conversion, I wire up the custom control's click command to use the Point.X and Point.Y relative to the custom control in the newly created array. My logic is thus: wb = new WriteableBitmap(worldMap, new TranslateTransform()); wb.Invalidate(); intTest = wb.Pixels.To2DArray(wb.PixelWidth); My conversion logic is as such: public static int[,] To2DArray(this int[] arr,int rowLength) { int[,] output = new int[rowLength, arr.Length / rowLength]; if (arr.Length % rowLength != 0) throw new IndexOutOfRangeException(); for (int i = 0; i < arr.Length; i++) { output[i % rowLength, i / rowLength] = arr[i]; } return output; } Now, when I do the checking, I get completely and utterly strange results: apparently all pixels are either at values of -1 or 0, and these values are completely independent of the original colours. Just for posterity: here's my checking code: private void Check(object sender, MouseButtonEventArgs e) { Point click = e.GetPosition(worldMap); ChangeNotification(intTest[(int)click.X,(int)click.Y].ToString()); } The result show absolutely no correlation to the path that the WriteableBitmap has rendered into it. The path has a fill of solid white. What the heck is going on? I've tried for hours with no luck. Please, this is the major problem stopping me from submitting my first WP7 app. Any guidance?

    Read the article

  • Float addition promoted to double?

    - by Andreas Brinck
    I had a small WTF moment this morning. Ths WTF can be summarized with this: float x = 0.2f; float y = 0.1f; float z = x + y; assert(z == x + y); //This assert is triggered! (Atleast with visual studio 2008) The reason seems to be that the expression x + y is promoted to double and compared with the truncated version in z. (If i change z to double the assert isn't triggered). I can see that for precision reasons it would make sense to perform all floating point arithmetics in double precision before converting the result to single precision. I found the following paragraph in the standard (which I guess I sort of already knew, but not in this context): 4.6.1. "An rvalue of type float can be converted to an rvalue of type double. The value is unchanged" My question is, is x + y guaranteed to be promoted to double or is at the compiler's discretion? UPDATE: Since many people has claimed that one shouldn't use == for floating point, I just wanted to state that in the specific case I'm working with, an exact comparison is justified. Floating point comparision is tricky, here's an interesting link on the subject which I think hasn't been mentioned.

    Read the article

  • debian packages version convention

    - by JackWu
    I'm using debian/Ubuntu, and get confused about versions of packages. When using dpkg -l command, I get: ii vim 2:7.3.429-2ubuntu2.1 Vi IMproved - enhanced vi editor ii vim-common 2:7.3.429-2ubuntu2.1 Vi IMproved - Common files ii vim-runtime 2:7.3.429-2ubuntu2.1 Vi IMproved - Runtime files ii vim-tiny 2:7.3.429-2ubuntu2.1 Vi IMproved - enhanced vi editor - compact version ii virt-what 1.11-1 detect if we are running in a virtual machine ii w3m 0.5.3-5ubuntu1 WWW browsable pager with excellent tables/frames support ii watershed 6 reduce superfluous executions of idempotent command ii wget 1.13.4-2ubuntu1 retrieves files from the web ii whiptail 0.52.11-2ubuntu10 Displays user-friendly dialog boxes from shell scripts ii whoopsie 0.1.33 Ubuntu crash database submission daemon ii wimlib9 1.5.0-1~webupd8~precise Library to extract, create, modify, and mount WIM files ii wimtools 1.5.0-1~webupd8~precise Tools to extract, create, modify, and mount WIM files ii wireless-tools 30~pre9-5ubuntu2 Tools for manipulating Linux Wireless Extensions ii wpasupplicant 0.7.3-6ubuntu2.1 client support for WPA and WPA2 (IEEE 802.11i) ii x11-common 1:7.6+12ubuntu2 X Window System (X.Org) infrastructure ii x11-utils 7.6+4ubuntu0.1 X11 utilities ii xauth 1:1.0.6-1 X authentication utility ii xbitmaps 1.1.1-1 Base X bitmaps ii xclip 0.12-1 command line interface to X selections ii xfonts-encodings 1:1.0.4-1ubuntu1 Encodings for X.Org fonts ii xfonts-utils 1:7.6+1 X Window System font utility programs ii xkb-data 2.5-1ubuntu1.3 X Keyboard Extension (XKB) configuration data ii xml-core 0.13 XML infrastructure and XML catalog file support rc xpdf 3.02-21build1 Portable Document Format (PDF) reader ii xterm 271-1ubuntu2.1 X terminal emulator ii xz-lzma 5.1.1alpha+20110809-3 XZ-format compression utilities - compatibility commands ii xz-utils 5.1.1alpha+20110809-3 XZ-format compression utilities ii zabbix-agent 1:1.8.11-1 network monitoring solution - agent ii zlib1g 1:1.2.3.4.dfsg-3ubuntu4 compression library - runtime ii zlib1g-dev 1:1.2.3.4.dfsg-3ubuntu4 compression library - development ii zsh 4.3.17-1ubuntu1 shell with lots of features The third column is version, but it all messed up in a way I can't understand. I mean, different packages use total different naming specification. Here are the major questions: Why there are ubuntu in them, and there are not? what all the special -~+ mean? alpha and build, dfsg, what are they? Can I just use them casually? vim and other packages have 2:, what does that mean? How version comparison works, since they can be so different? Can anyone please explain this to me? Or where can I find an official document? Thanks in advance.

    Read the article

  • Grub Solaris FreeBSD dual boot

    - by pallavt
    I have solaris 10 installed on the first hard disk and freebsd installed on the second hard disk I edited the /boot/grub/menu.lst from solaris to the following title FreeBSD root (hd1,0) kernel /boot/loader Now when I try to boot into freebsd via the grub, it gives the following error root (hd1,0) Filesystem type unknown, partition type 0xee kernel /boot/loader Error 17: cannot mount selected partition

    Read the article

  • Auto-implemented getters and setters vs. public fields

    - by tclem
    I see a lot of example code for C# classes that does this: public class Point { public int x { get; set; } public int y { get; set; } } Or, in older code, the same with an explicit private backing value and without the new auto-implemented properties: public class Point { private int _x; private int _y; public int x { get { return _x; } set { _x = value; } } public int y { get { return _y; } set { _y = value; } } } My question is why. Is there any functional difference between doing the above and just making these members public fields, like below? public class Point { public int x; public int y; } To be clear, I understand the value of getters and setters when you need to do some translation of the underlying data. But in cases where you're just passing the values through, it seems needlessly verbose.

    Read the article

  • TSQL - make a literal float value

    - by David B
    I understand the host of issues in comparing floats, and lament their use in this case - but I'm not the table author and have only a small hurdle to climb... Someone has decided to use floats as you'd expect GUIDs to be used. I need to retrieve all the records with a specific float value. sp_help MyTable -- Column_name Type Computed Length Prec -- RandomGrouping float no 8 53 Here's my naive attempt: --yields no results SELECT RandomGrouping FROM MyTable WHERE RandomGrouping = 0.867153569942739 And here's an approximately working attempt: --yields 2 records SELECT RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.867153569942739 - 0.00000001 AND 0.867153569942739 + 0.00000001 -- 0.867153569942739 -- 0.867153569942739 In my naive attempt, is that literal a floating point literal? Or is it really a decimal literal that gets converted later? If my literal is not a floating point literal, what is the syntax for making a floating point literal? EDIT: Another possibility has occurred to me... it may be that a more precise number than is displayed is stored in this column. It may be impossible to create a literal that represents this number. I will accept answers that demonstrate that this is the case. EDIT: response to DVK. TSQL is MSSQLServer's dialect of SQL. This script works, and so equality can be performed deterministically between float types: DECLARE @X float SELECT top 1 @X = RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.839110948199148 - 0.000000000001 AND 0.839110948199148 + 0.000000000001 --yields two records SELECT * FROM MyTable WHERE RandomGrouping = @X I said "approximately" because that method tests for a range. With that method I could get values that are not equal to my intended value. The linked article doesn't apply because I'm not (intentionally) trying to straddle the world boundaries between decimal and float. I'm trying to work with only floats. This isn't about the non-convertibility of decimals to floats.

    Read the article

  • A weird crash...

    - by Nima
    Hi, I have a piece of code that runs in debug mode in VS2008, C++. The problem is that when I am debugging the code line by line, at a very weird point of the code, it crashes and says: debug assertion faild. Expression: _BLOCK_TYPE_IS_VALID(pHead-nBlockUse) The crash point is on the first closed curly bracket (after mesh-edges[e].needsUpdate=false;) I don't understand why on a curly bracket? does that make sense to you guys? Can anybody help me understanding what is going on..? for(int e=0; e<mesh->edges.size(); e++) { if(mesh->edges[e].valid && mesh->edges[e].v[0]>=0 && mesh->edges[e].v[1]>=0 && mesh->points[mesh->edges[e].v[0]].writable && mesh->points[mesh->edges[e].v[1]].writable) { //update v_hat and its corresponding error DecEdge Current = DecEdge(e); pair<Point, float> ppf = computeVhat(e); Current.v_hat = ppf.first; Current.error = ppf.second; edgeSoup.push(Current); mesh->edges[e].needsUpdate=false; } }

    Read the article

  • Error with mounting partiotn ubuntu

    - by Master
    I have ext3 partition and i get this error mount: wrong fs type, bad option, bad superblock on /dev/sdb1, missing codepage or helper program, or other error In some cases useful info is found in syslog - try dmesg | tail or so Command in fstab is /dev/sdb1 /media/Server ext3 defaults 0 0

    Read the article

  • Read floppy from OpenVMS machine

    - by Goyuix
    I have a floppy I need to read the contents from - unfortunately it was formatted and the data written on an OpenVMS server. I believe the floppy is formatted "Files-11" and I can see parts of the MFT [equivalent] and file contents through a hex editor, however I would love to be able to mount this and actually read the files off. Is there a Files-11 FUSE module or other kernel module I can install to read this format? Any standalone utilities that can understand a floppy image taken with dd?

    Read the article

  • Read NTFS partition on RHEL 5.8

    - by Alex Farber
    I have RHEL 5.8 64 bit, and NTFS partition on the same disk. How can I get access to this partition? This answer Unable to mount NTFS drive with RHEL 6 doesn't work for me: [root@localhost alex]# rpm -Uvh http://download.fedora.redhat.com/pub/epel/6/i386/epel-release-6-5.noarch.rpm Retrieving http://download.fedora.redhat.com/pub/epel/6/i386/epel-release-6-5.noarch.rpm error: skipping http://download.fedora.redhat.com/pub/epel/6/i386/epel-release-6-5.noarch.rpm - transfer failed - Unknown or unexpected error

    Read the article

  • how to install debian from a rescue cd (via ssh)

    - by tommy
    situation: server with RAID 1 (2x1000GB) currently logged in via SSH (network based debian rescue cd) need to accomplish: install a debian based Xen (maybe with: http://wiki.xen.org/xenwiki/LiveCD ?) keep RAID 1 problem: I have no physical access to the server, so i can't just drop in a cd or plug-in a usb drive. Does anyone have an ideas (or a tutorial handy) on how I can mount the LiveCD (on a read-only rescue-cd??) and the install the distru without breaking the RAID?

    Read the article

  • Methods of cooling with no more room in case?

    - by Wesley
    Hi all, I've got an HP DC7100 and an HP m8530f. The DC7100 is a small form factor desktop while the m8530f has a mATX board with lots of extra features like front I/O and HP Personal Media Drive bay. Both of these have very little space (especially the DC7100) and don't have any other places to mount fans. What other possible ways of cooling are there, if there isn't much space left inside the case? Thanks in advance.

    Read the article

  • Signable, streamable, "readable" archive format?

    - by alexvoda
    Is there any archive format that offers the following: be digitally sign-able with a digital certificate from a trusted source like Verisign - for preventing changes to the file (I am not referring to read only, but in case the file was changed it should no longer be signed telling the user this is not the original file) be stream-able - be able to be opened even if not all of the content has been transfered (also not strictly linearly) be "readable" - be able to read the data without extracting to a temporary folder (AFAIK if you open a file in a zip archive it is extracted first, and this stays true even for zip based formats like OOXML. This is not what I want) be portable - support on at least Windows, Linux and Mac OS X is a must, or at least future support be free of patents - Be open source - also preferably a license that allows commercial use(as far as i know GPL a share-alike licence so it doesn't allow comercial use, BSD on the other hand alows it) Note: Though it may come in handy eventually I can not think right now of a scenario that would require both point 1 and point 2 simultaneously. Or lets leave it a be able to check the signature only when the whole file was downloaded. I am not interested in: being able to be compressed being supported on legacy systems Does any existing archive format fit this description (tar evolutions like DAR and pax come to mind) ? If there is, are there programing libraries available for the above mentioned OSs? If not, would it be hard to create such a thing? EDIT: clarrified piont 5 EDIT 2: added a note to clarify point 1 and 2 P.S.: This is my first question on StackOverflow

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • What is the state of ext3 support in Mac OS X 10.6? [closed]

    - by gzuki
    Possible Duplicate: Mount ext2/ext3 in Mac OS X Snow Leopard I have a 1tb hard drive, I want it to have one partition that can serve as an interchange between linux (ubuntu) and mac (snow leopard). HFS+ scares me a bit, and I can't seem to get a clear picture on whether or not something like fuse can reliably write ext3 partitions in mac. Any good advice on this topic? Should I just pick HFS+ or ext3 and hope for the best (or just deal with only getting read-only on one OS)?

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Is anyone familiar with SDPT.clsSDPT?

    - by David Stratton
    Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

    Read the article

  • Any way to map WebDAV with SSL as network drive in Windows XP?

    - by Shadow
    I'm trying to map WebDAV with SSL as a network drive in Windows XP. (I've been at this for several hours) I can read the share just fine using a browser and with Network Places, but it refuses to mount as a network drive. I've tried it using the Windows explorer interface and net use. Net use with the \\server@ssl:443\webdav method gives System error 53. https://server/webdav gives error 67. Any help would be appreciated.

    Read the article

  • Cannot call DLL import entry in C# from C++ project. EntryPointNotFoundException

    - by kriau
    I'm trying to call from C# a function in a custom DLL written in C++. However I'm getting the warning during code analysis and the error at runtime: Warning: CA1400 : Microsoft.Interoperability : Correct the declaration of 'SafeNativeMethods.SetHook()' so that it correctly points to an existing entry point in 'wi.dll'. The unmanaged entry point name currently linked to is SetHook. Error: System.EntryPointNotFoundException was unhandled. Unable to find an entry point named 'SetHook' in DLL 'wi.dll'. Both projects wi.dll and C# exe has been compiled in to the same DEBUG folder, both files reside here. There is only one file with the name wi.dll in the whole file system. C++ function definition looks like: #define WI_API __declspec(dllexport) bool WI_API SetHook(); I can see exported function using Dependency Walker: as decorated: bool SetHook(void) as undecorated: ?SetHook@@YA_NXZ C# DLL import looks like (I've defined these lines using CLRInsideOut from MSDN magazine): [DllImport("wi.dll", EntryPoint = "SetHook", CallingConvention = CallingConvention.Cdecl)] [return: MarshalAsAttribute(UnmanagedType.I1)] internal static extern bool SetHook(); I've tried without EntryPoint and CallingConvention definitions as well. Both projects are 32-bits, I'm using W7 64 bits, VS 2010 RC. I believe that I simply have overlooked something.... Thanks in advance.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • MSSQL 2005 FOR XML

    - by Lima
    Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Can someone implement LVM on an existing single-hard disk system ?

    - by jfmessier
    I am using SuSE Linux (10) and I am considering expanding the available disk, without resizing an existing partition (which is not easy to do on a VM). Instead, I want to create another virtual disk, and add it in a new LVM volume, which would include the existing disk, and this new one, in a seamless single mount point. We are using VMware vServer 4, under Lab Manager and Virtual Centre. Does SuSE support LVM in version 10 ? Thanks :-)

    Read the article

< Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >