Search Results

Search found 105398 results on 4216 pages for 'i am that man with hair'.

Page 182/4216 | < Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >

  • FileUtils.mv adding linebreaks in Windows

    - by Lowgain
    I am streaming wav data from a flash application. If I get the data and do the following: f = File.open('c:/test.wav') f << wav_data.pack('c'*wav_data.length) f.close The wav file works perfectly. If I do this: f = Tempfile.new('test.wav') f << wav_data.pack('c'*wav_data.length) f.close FileUtils.mv(f.path, 'c:/') The file is there, but sounds all garbled. Checking in a hex editor shows that everywhere the working file had an 0A (or \n), the garbled version had 0D0A (or \r\n) I am using this in conjuction with rails+paperclip, and am going to be using a combination of Heroku and S3 for the live app, so I am hoping this problem will solve itself, but I'd like to get this working on my local machine for the time being. Does anybody know of any reason FileUtils.mv would be doing this, and if there is a way to change its behaviour?

    Read the article

  • How to use variables with regex?

    - by dontoo
    This is the input string: 23x^45*y or 2x^2 or y^4*x^3. I am matching ^[0-9]+ after letter x. In other words I am matching x followed by ^ followed by numbers. Problem is that I don't know that I am matching x, it could be any letter that I stored as variable in my char array. For example: foreach (char cEle in myarray) // cEle is letter in char array x, y, z, ... { match CEle in regex(input) //PSEUDOCODE } I am new to regex and I new that this can be done if I define regex variables, but I don't know how.

    Read the article

  • Scala type conversion error, need help!

    - by Mansoor Ashraf
    Hello I am getting a weird error when trying to use a Java map in Scala. This is the snippet of code val value:Double = map.get(name) if (value eq null) map.put(name, time) else map.put(name, value + time) the map is defined as val map=new ConcurrentHashMap[String,Double] and this is the error I am getting error: type mismatch; found : Double required: ?{val eq: ?} Note that implicit conversions are not applicable because they are ambiguous: both method double2Double in object Predef of type (Double)java.lang.Double and method doubleWrapper in object Predef of type (Double)scala.runtime.RichDouble are possible conversion functions from Double to ?{val eq: ?} if (value eq null) map.put(name, time) I am new to Scala so I am having a hard time parsing the stacktrace. Any help would be appreciated

    Read the article

  • How to use sprintf instead of hardcoded values

    - by astha goyal
    I am developing a firewall for Linux as my project. I am able to capture packets and to block them. I am using IPTABLES. How can I use variables with sprintf instead of hardcoded values? sprintf(comm, "iptables -A INPUT -s $str -j DROP") // inplace of: sprintf(comm, "iptables -A INPUT -s 192.168.0.43 -j DROP")

    Read the article

  • How to send an IM in C or C++ on Windows

    - by dave9909
    Specifically I am talking about using AIM and sending instant messages to an existing AIM screename. How would I accomplish this? I am trying to do it the simplest way possible -efficiency is not that important. I thought maybe all I would have to do is open a socket connections some how but I am probably wrong.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Managing Lotus Notes Mail Format using C#

    - by Pari
    Hi, I am accessing mail body and fetching it in another mail. But i am not getting original format of previous mail in new mail. Problem i am facing in this situation are: Not getting images in destination mail. Font is also varying. I am accessing mail body as follows: NotesRichTextItem rtItem = (NotesRichTextItem)docInbox.GetFirstItem("Body"); String Body = rtItem.GetFormattedText(false , 0); String bodyFormat = rtItem.type.ToString(); also tried this code: NotesItem itemBody = docInbox.GetFirstItem("Body"); String bodyFormat = itemBody.type.ToString(); String Body = itemBody.Text; But not getting solution in both case.

    Read the article

  • Skip sanitization for videos in html5lib

    - by pug
    I am using a wmd-editor in django, much like this one in which I am typing. I would like to allow the users to embed videos in it. For that I am using the Markdown video extension here. The problem is that I am also sanitizing user input using html5lib sanitization and it doesn't allow object tags which are required to embed the videos. One solution could be to check the input for urls of well-known video sites and skip the sanitization in those cases. Is there a better solution?

    Read the article

  • How to hide specific header item in grid

    - by Vara Prasad.M
    Hi, I am using RadGrid and i am displaying the header item with months if the month data is null then i have to make invisible the entire column including the header text i am using Telerik version Grid. Please reply it fast Waiting for the reply, Thanks in Advance Vara Prasad.M

    Read the article

  • localization in iphone

    - by shishir.bobby
    HI all, i m working on an app,which need localization. I am using a tab bars, having five tabs, and navigation controller. i am able to change title according to locales,but the navigation controllers rightbarbutton which navigates to previuos view, showing English(united states), when i change local to english. What i am doing wrong. plz suggest me some solution. regard shishir

    Read the article

  • Trying to debug a 'Assertion failure in -[UIActionSheet showInView:]' error....

    - by dsobol
    I am working through "Beginning iPad Application Development" and am getting hung up in Chapter 3 where I have created a project that works with an Action Sheet. As it stands now, my application loads into the simulator just fine with no errors that I am aware of, but as it runs, it crashes with the following errors showing up in the debugger window: 2010-05-31 19:44:39.703 UsingViewsActionSheet[49538:207] * Assertion failure in -[UIActionSheet showInView:], /SourceCache/UIKit_Sim/UIKit-1145.66/UIAlert.m:7073 2010-05-31 19:44:39.705 UsingViewsActionSheet[49538:207] * Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'Invalid parameter not satisfying: view != nil' I am sure that this is the block where the app breaks based upon my use of breakpoints. //Implement viewDidLoad to do additional setup after loading the view, typically from a nib. - (void)viewDidLoad { UIActionSheet *action = [[UIActionSheet alloc] initWithTitle:@"This is my Action Sheet!" delegate:self cancelButtonTitle:@"OK" destructiveButtonTitle:@"Delete Message!" otherButtonTitles:@"Option 1", @"Option 2", @"Option 3", nil]; [action showInView:self.view]; // <-- This line seems to trigger the crash.... [action release]; [super viewDidLoad]; } Am I missing something obvious, or is there more to the problem than is shown here? I have looked at the abstract for showInView and cannot divine anything there yet. I appreciate any and all asssitance. Regards, Steve O'Sullivan

    Read the article

  • How to get the sending email address from outlook 2007

    - by Naresh
    I am working on outlook add-in project using Visual studio 2008 for MS Outlook 2007 in C#. Here I am explaining my problem... I got multiple accounts (3 Accounts) with my outlook 2007. I need to get accounts form Account box in New Mail Message window. When we click New Mail Message, a new window will appear from which we can send a new mail. Here (On this window) we can see Account Dropdown (Left side) under the Send Button. If we have multiple accounts with outlook, we can see all the accounts in Account Drop Down if we click on Account Box. If we click on the particular email, a right mark will appear to that Email Account and a message can bee seen on the top of the Send button is "This message will be sent via [email protected]". So, I want to get these email accounts into a string and that particular email account (which has right mark) into another string. I got these 3 email accounts into a string. But, I am not getting the particular email account(which has the right mark when we send a new email). I am using this code.... using Outlook = Microsoft.Office.Interop.Outlook; using Office = Microsoft.Office.Core; using Microsoft.Office.Interop.Outlook; Outlook._Application myOutlookApp = new Outlook.Application(); Outlook.Accounts myAccounts = myOutlookApp.Session.Accounts; foreach (Outlook.Account account in myAccounts) { string emailAddress = account.SmtpAddress; } I am able to get all the accounts from the above code..But, I just want to get the email address which we will use for sending an email at that particular moment..

    Read the article

  • Unable to import nltk in NetBeans

    - by afs
    Hello all, I am trying to import NLTK in my python code and I get this error: Traceback (most recent call last): File "/home/afs/NetBeansProjects/NER/getNE_followers.py", line 7, in import nltk ImportError: No module named nltk I am using NetBeans: 6.7.1, Python 2.6 NLTK. My NLTK module is installed in /usr/local/lib/python2.6/dist-packages/nltk/ and I have added this in Python paths in Netbeans. What am I missing here? Thanks in advance.

    Read the article

  • Running Magento for multiple clients - single Installaton vs. multiple installations

    - by Chris Hopkins
    Hi There I am looking to set-up a Magento (Community Edition) installation for multiple clients and have researched the matter for a few days now. I can see that the Enterprise Edition has what I need in it, but surprisingly I am not willing to shell out the $12,000 odd yearly subscription. It seems there are a few options available to be but I am worried about the performance I will get out of the various options. Option 1) Single install using AITOC advanced permissions module So this is really what I am after; one installation so that I can update my core files all at the same time and also manage all my store users from one place. The problems here are that I don't know anything about the reliability of this extra product and that I have to pay a bit extra. I am also worried that if I have 10 stores running off this one installation it might all slow down so much and keel over as I have heard allot about Magento's slowness. Module Link: http://www.aitoc.com/en/magentomods_advanced_permissions.html Option 2) Multiple installations of Magento on one server for each shop So here I have 10 Magento installations on one server all running happily away not using any extra money, but I now have 10 separate stores to update and maintain which could be annoying. Also I haven't been able to find a whole lot of other people using this method and when I have they are usually asking how to stop their servers from dying. So this route seems like it could be even worse on my server as I will have more going on on my server but if my server could take it each Magento installation would be simpler and less likely to slow down due to each one having to run 10 shops on its own? Option 3) Use lots of servers and lots of Magento installations I just so do not want to do this. Option 4) Buy Magento Enterprise I do not have the money to do this. So which route is less likely to blow up my server? And does anyone have experience with this holy grail of a module? Thanks for reading and thanks in advance for any help - Chris Hopkins

    Read the article

  • Uploading to TwitVid using x_verify_credentials_authorization

    - by deepa
    Hi, I am developing an iPhone application that uploads videos to TwitVid using the library TwitVid-iPhone-OAuth3. I have selected this library since Twitter is shifting to OAuth mechanism of authentication. 1) Does this new library allows to upload without user-name and password parameters? 2) I am using the following steps for uploading videos (assumed that new library allows to upload without user-name and password parameters). But, I am getting the error 'Incorrect Signature'. I am not able to identify the mistake that I am doing here. Could you please help me out to solve this problem. Authenticate the app using OAuth (MGTwitterEngine etc) which redirects the user to the web-page asking for log-in and app authentication. If the user authenticates the app, access token will obtained as final step. Upload the video to TwitVid using the following code snippet: OAuth *authorizer = [[OAuth alloc] initWithConsumerKey: @"my_consumer_key" andConsumerSecret: @"my_consumer_secret"]; authorizer.oauth_token = //The key-part of the access token obtained in step 2 authorizer.oauth_token_secret = //The secret-part of the access token obtained in step 2 authorizer.oauth_token_authorized = YES; //Since authenticated in steps 1 and 2 NSString *authHeader = [authorizer oAuthHeaderForMethod: @"POST" andUrl: @"https://api.twitter.com/1/account/verify_credentials.xml" andParams: nil]; twitVid = [[TwitVid alloc] init]; [mTwitVid setDelegate: self]; [mTwitVid authenticateWithXVerifyCredentialsAuthorization: authHeader xAuthServiceProvider: nil]; Thanks and Regards, Deepa

    Read the article

  • Conditional CSS file doesn't override regular CSS

    - by dmr
    I am using conditional comments to link to a css file (let's call it "IEonly.css") if the IE version is less than 8. I am trying to override some properties in the regular css file. Strangely enough, IEonly.css will set new css properties correctly, but it won't override the properties in the regular CSS file! (I am trying to make this work for IE7). Help!

    Read the article

  • What the performance impact of enabling WebSphere PMI

    - by Andrew Whitehouse
    I am currently looking at some JProfiler traces from our WebSphere-based application, and am noticing that a significant amount of CPU time is being spent in the class com.ibm.io.async.AsyncLibrary.getCompletionData2. I am guessing, but I am wondering whether this is PMI-related (and we do have this enabled). My knowledge of PMI is limited, as this is managed by another team. Is it expected that PMI can have this sort of impact? (If so) Is the only option to turn it off completely? Or are there some types of data capture that have a particularly high overhead?

    Read the article

  • Converting From Castle Windsor To StructureMap In An MVC2 Project

    - by alphadogg
    I am learning about best practices in MVC2 and I am knocking off a copy of the "Who Can Help Me" project (http://whocanhelpme.codeplex.com/) off Codeplex. In it, they use Castle Windsor for their DI container. One "learning" task I am trying to do is convert this subsystem in this project to use StructureMap. Basically, at Application_Start(), the code news up a Windsor container. Then, it goes through multiple assemblies, using MEF: public static void Register(IContainer container) { var catalog = new CatalogBuilder() .ForAssembly(typeof(IComponentRegistrarMarker).Assembly) .ForMvcAssembly(Assembly.GetExecutingAssembly()) .ForMvcAssembliesInDirectory(HttpRuntime.BinDirectory, "CPOP*.dll") // Won't work in Partial trust .Build(); var compositionContainer = new CompositionContainer(catalog); compositionContainer .GetExports<IComponentRegistrar>() .Each(e => e.Value.Register(container)); } and any class in any assembly that has an IComponentRegistrar interface will get its Register() method run. For example, the controller registrar's Register() method implementation basically is: public void Register(IContainer container) { Assembly.GetAssembly(typeof(ControllersRegistrarMarker)).GetExportedTypes() .Where(IsController) .Each(type => container.AddComponentLifeStyle( type.Name.ToLower(), type, LifestyleType.Transient )); } private static bool IsController(Type type) { return typeof(IController).IsAssignableFrom(type); } Hopefully, I am not butchering WCHM too much. I am wondering how does one do this with StructureMap?

    Read the article

  • Visual Studio 2008 breakpoint is not working

    - by user279521
    I am working on an ASP.NET project and I cannot make the breakpoints work! The project does not stop where I place a breakpoint. It does not seem to matter where I place the breakpoint. I am in debug mode; I am using IE 8, Windows 7 OS; Has anyone ever had this problem?

    Read the article

  • Rails + MongoMapper + EmbeddedDocument form help

    - by Bob Martens
    I am working on a pretty simple web application (famous last words) and am working with Rails 2.3.5 + MongoMapper 0.7.2 and using embedded documents. I have two questions to ask: First, are there any example applications out there using Rails + MongoMapper + EmbeddedDocument? Preferably on GitHub or some other similar site so that I can take a look at the source and see where I am supposed to head? If not ... ... what is the best way to approach this task? How would I go about creating a form to handle an embedded document. What I am attempting to do is add addresses to users. I can toss up the two models in question if you would like. Thanks for the help!

    Read the article

  • Difficulties using custom control - RichTextEditor

    - by Chris
    I am working on a school project that uses ASP.NET. I found this TextEditor control ( http://blogs.msdn.com/kirti/archive/2007/11/10/rich-text-editor-is-here.aspx ) that I am trying to include but it isn't working. The error I am getting is: Error Rendering Control - TextEditor. An unhandled exception has occurred. Index was out of range. Must be non-negative and less than the size of the collection. Parameter name: index. I see this error when I go Design part of the editor. I just don't understand this error at all. Also I am a lil bit confused as there is no parameter called index. :( What I have done is reference the binary in my project and then on the page I am trying to use it have registered its namespace and assembly with this line: <%@ Register Assembly="RichTextEditor" Namespace="AjaxControls" TagPrefix="rtt" %> I then go ahead and try to add the control to the page with this line of code: <rtt:richtexteditor ID="TextEditor" Theme="Blue" runat="server" /> Any help would be much appreciated. I haven't done anything like add a custom control before.

    Read the article

  • Hopping from a C++ to a Perl/Unix job

    - by rocknroll
    Hi all, I have been a C++ / Linux Developer till now and I am adept in this stack. Of late I have been getting opportunities that require Perl, Unix (with knowledge of C++,shell scripting) expertise. Organizations are showing interest even though I don't have much scripting experience to boast off. The role is more in a Support, maintenance project involving SQL as well. Off late I am in a fix whether to forgo these offers or not. I don't know the dynamics of an IT organization and thus on one hand I fear that my C++ experience will be nullified and on the positive side I am getting to work on a new technology stack which will only add to my skill set. I am sure, most of you at some point of time have encountered such dilemmas and would have taken some decision. I want you to share your perspectives on such a scenario where a person is required to change his/her technology stack when changing his/her job. What are the merits and demerits in going with either of the choices? Also I know that C++ isn't going anywhere in the near future. What about perl? I have no clue as to what the future holds for perl developer? Whether there are enough opportunities for a perl developer? I am asking this question here because most of my fellow programmers face this career choice dilemma. Thanks.

    Read the article

  • Access is denied error with pregenerated .pyc or .pyo files

    - by mukul sharma
    Hi All, I am getting an Access is denied error while I am trying to run the .pyo file by double click or from the command prompt. Lets say I have abc.py (keeping main method entry point) which imports files xyz.py and imports wx etc. I generate the .pyo file. But once I try to run abc.pyo I get the access is denied error. I am not getting why this happening? Any help will really appreciated. Thanks

    Read the article

< Previous Page | 178 179 180 181 182 183 184 185 186 187 188 189  | Next Page >