Search Results

Search found 5619 results on 225 pages for 'starts'.

Page 206/225 | < Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • Issues declaring already existing NSMutableArray in new class

    - by Graeme
    I have a class (DataImporter) which has the code to download an RSS feed. I also have a view and separate class (TableView) which displays the data in a UITableView and starts the parsing process, storing parsed information in an NSMutableArray (items) which is located in the (TableView) subclass. Now I wish to add a UIMapView which displays the items in the (items) NSMutableArray. Herein lies the issue - I need to somehow get the data from the (items) NSMutableArray into the new (mapView) subclass which I'm struggling with - and I preferably don't want to have to create a new class to download the data again for the mapView class when it already is in the applications memory. Is there a way I can transfer the information from the NSMutableArray (items) class to the (mapView) class (i.e. how do I declare the NSMutableArray in the (mapView) class)? Here's a overview of how the system works: App opened Data downloaded (using DataImporter class) when (TableView) viewDidLoad runs Data stored in NSMutableArray accessible by the (TableView) class And from here I need to access and declare the array from a new (mapView) class. Any help greatly appreciated, thanks. Code for viewDidLoad MapKit: Data *data = nil; NSString *ilocation = [data locations]; NSString *ilocation2 = @"New Zealand"; NSString *inewlString; inewlString = [ilocation stringByAppendingString:ilocation2]; NSLog(@"inewlString=%@",inewlString); if(forwardGeocoder == nil) { forwardGeocoder = [[BSForwardGeocoder alloc] initWithDelegate:self]; } // Forward geocode! [forwardGeocoder findLocation: inewlString]; Code for parsing data into original NSMutable Array: - (void)beginParsing { NSLog(@"Parsing has begun"); //self.navigationItem.rightBarButtonItem.enabled = NO; // Allocate the array for song storage, or empty the results of previous parses if (incidents == nil) { NSLog(@"Grabbing array"); self.datas = [NSMutableArray array]; } else { [datas removeAllObjects]; [self.tableView reloadData]; } // Create the parser, set its delegate, and start it. self.parser = [[DataImporter alloc] init]; parser.delegate = self; [parser start]; }

    Read the article

  • apply style to range of text with javascript in uiwebview

    - by drawnonward
    I am displaying some simple styled text as html in a UIWebView on iPhone. It is basically a series of paragraphs with the occasional strong or emphasized phrase. At runtime I need to apply styles to ranges of text. There are a few similar scenarios, one of which is highlighting search results. If the user has searched for "something" I would like to change the background color behind occurrences of the word, then later restore the original background. Is it possible to apply styles to ranges of text using javascript? A key part of this is also being able to unset the styles. There seem to be two likely paths to follow. One would be modifying some html in Objective-C and passing it through javascript as the new innerHTML of some container. The other would be to use javascript to directly manipulate DOM nodes. I could manipulate html, but that sounds tedious in Objective-C so I would rather manipulate the DOM if that is a reasonable approach. I am not that familiar with javascript and DOM so I do not know if it is a reasonable approach. I wrote some routines to translate between text ranges and node ranges with offsets. So if I start with text range 100-200 and that starts in one paragraph and ends in a third, I can get the text nodes and the offsets within the nodes that represent the given text range. I just need a way to split a text node at an offset in the text. Currently I just apply styles to the paragraphs containing the text range. A few notes: straight javascript please, no external frameworks like jquery. the changes never need to be written to disk. the changes should be undoable or at least removable. the styles to apply already exist in a css file. it needs to work in iPhone 3.0 and forward. all the source files are shipped with the app. please be verbose. Thanks for any suggestions.

    Read the article

  • Dynamically find other hosts in a LAN in Java

    - by Federico Cristina
    A while ago I developed a little LAN chat app. in Java which allows chatting with other hosts, send images, etc. Although it was created just for fun, now it's being used where I work. Currently, there is no "chat server" on the app. where each client registers, updates it's status, etc. (I liked the idea of symmetric design and not depending on a server running on some other machine). Instead, each host is a client/server which has a hosts.properties file with the hostname of the other hosts, and - for instance - broadcasts to each one of them when sending a massive message/image/whatever. In the beginning there were just a couple of hosts, so this hosts.properties file wasn't an issue. But as the amount of users increased, the need of updating that file was a bit daunting. So now I've decided to get rid of it, and each time the app. starts, dynammically find the other active hosts. However, I cannot find the correct way of implement this. I've tried starting different threads, each one of them searching for other hosts in a known range of IP addresses. Something like this (simplified for the sake of readability): /** HostsLocator */ public static void searchForHosts(boolean waitToEnd) { for (int i=0; i < MAX_IP; i+= MAX_IP / threads) { HostsLocator detector = new HostsLocator(i, i+(MAX_IP / threads - 1)); // range: from - to new Thread(detector).start(); } } public void run() { for (int i=from; i<=to; i++) findHosts( maskAddress + Integer.toString(i) ); } public static boolean findHosts(String IP) { InetAddress address = InetAddress.getByName(IP); if ( address.isReachable(CONNECTION_TIME_OUT) ) // host found! } However: With a single thread and a low value in CONNECTION_TIME_OUT (500ms) I get wrong Host Not Found status for for hosts actually active. With a high value in CONNECTION_TIME_OUT (5000ms) and only one single thread takes forever to end With several threads I've also found problems similar like the first one, due to collisions. So... I guess there's a better way of solving this problem but I couldn't find it. Any advice? Thanks!

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • GLKit Memory Leak copywithZone

    - by TommyT39
    Running the instruments utility against the game I'm writing shows a bunch of memory leaks related to copy with Zone when I cycle through an array and draw some simple cube objects. Im not sure the best way to track this down as I'm new to OpenGL programming. My program is using ARC and is set to build for IOS 5. I am initializing GLKit to use OPenGl 2.0 and using the BafeEffect so I don't have to write my own shaders etc.. This shouldn't be rocket science. Im guessing that I must be not releasing something within the draw function. Below is the code to my draw function. Could you guys take a look and see if anything stands out as the problem? One other thing to note is that I'm using 15 different textures, the cubes can be 1 of 15 different ones. I have a property set on the cube class for the texture and I set it as I create the cube in there array. But I do load all 15 when my programs view did load starts.They are small .jps files that are less than 75k each and each cube uses the same texture all the way around so shouldn't be too big of an issue. Here is the code to my draw function: - (void)draw { GLKMatrix4 xRotationMatrix = GLKMatrix4MakeXRotation(rotation.x); GLKMatrix4 yRotationMatrix = GLKMatrix4MakeYRotation(rotation.y); GLKMatrix4 zRotationMatrix = GLKMatrix4MakeZRotation(rotation.z); GLKMatrix4 scaleMatrix = GLKMatrix4MakeScale(scale.x, scale.y, scale.z); GLKMatrix4 translateMatrix = GLKMatrix4MakeTranslation(position.x, position.y, position.z); GLKMatrix4 modelMatrix = GLKMatrix4Multiply(translateMatrix,GLKMatrix4Multiply(scaleMatrix,GLKMatrix4Multiply(zRotationMatrix, GLKMatrix4Multiply(yRotationMatrix, xRotationMatrix)))); GLKMatrix4 viewMatrix = GLKMatrix4MakeLookAt(0, 0, 1, 0, 0, -5, 0, 1, 0); effect.transform.modelviewMatrix = GLKMatrix4Multiply(viewMatrix, modelMatrix); effect.transform.projectionMatrix = GLKMatrix4MakePerspective(0.125*M_TAU, 1.0, 2, 0); effect.texture2d0.name = wallTexture.name; [effect prepareToDraw]; glEnable(GL_DEPTH_TEST); glEnable(GL_CULL_FACE); glEnableVertexAttribArray(GLKVertexAttribPosition); glVertexAttribPointer(GLKVertexAttribPosition, 3, GL_FLOAT, GL_FALSE, 0, triangleVertices); glEnableVertexAttribArray(GLKVertexAttribTexCoord0); glVertexAttribPointer(GLKVertexAttribTexCoord0, 2, GL_FLOAT, GL_FALSE, 0, textureCoordinates); glDrawArrays(GL_TRIANGLES, 0, 18); glDisableVertexAttribArray(GLKVertexAttribPosition); glDisableVertexAttribArray(GLKVertexAttribTexCoord0); }

    Read the article

  • Question about POP3 message termination octet

    - by user361633
    This is from the POP3 RFC. "Responses to certain commands are multi-line. In these cases, which are clearly indicated below, after sending the first line of the response and a CRLF, any additional lines are sent, each terminated by a CRLF pair. When all lines of the response have been sent, a final line is sent, consisting of a termination octet (decimal code 046, ".") and a CRLF pair. If any line of the multi-line response begins with the termination octet, the line is "byte-stuffed" by pre-pending the termination octet to that line of the response. Hence a multi-line response is terminated with the five octets "CRLF.CRLF". When examining a multi-line response, the client checks to see if the line begins with the termination octet. If so and if octets other than CRLF follow, the first octet of the line (the termination octet) is stripped away. If so and if CRLF immediately follows the termination character, then the response from the POP server is ended and the line containing ".CRLF" is not considered part of the multi-line response." Well, i have problem with this, for example gmail sometimes sends the termination octet and then in the NEXT LINE sends the CRLF pair. For example: "+OK blah blah" "blah blah." "\r\n" That's very rare, but it happens sometimes, so obviously i'm unable to determine the end of the message in such case, because i'm expecting a line that consists of '.\r\n'. Seriously, is Gmail violating the POP3 protocol or i'm doing something wrong? Also i have a second question, english is not my first language so i cannot understand that completely: "If any line of the multi-line response begins with the termination octet, the line is "byte-stuffed" by pre-pending the termination octet to that line of the response. Hence a multi-line response is terminated with the five octets "CRLF.CRLF"." When exactly CRLF.CRLF is used? Can someone gives me a simple example? The rfc says that is used when any line of the response begins with the termination octet. But i don't see any lines that starts with '.' in the messages that are terminated with CRLF.CRLF. I checked that. Maybe i don't understand something, that's why i'm asking.

    Read the article

  • XML pass values to timer, AS3

    - by VideoDnd
    My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Function returning MYSQL_ROW

    - by Gabe
    I'm working on a system using lots of MySQL queries and I'm running into some memory problems I'm pretty sure have to do with me not handling pointers right... Basically, I've got something like this: MYSQL_ROW function1() { string query="SELECT * FROM table limit 1;"; MYSQL_ROW return_row; mysql_init(&connection); // "connection" is a global variable if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&connection); else{ resp = mysql_store_result(&connection); //"resp" is also global if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error: " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And function2(): MYSQL_ROW function2(MYSQL_ROW row) { string query = "select * from table2 where code = '" + string(row[2]) + "'"; MYSQL_ROW retorno; mysql_init(&connection); if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&conexao); else{ // My "debugging" shows me at this point `row[2]` is already fubar resp = mysql_store_result(&connection); if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error : " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And main() is an infinite loop basically like this: int main( int argc, char* args[] ){ MYSQL_ROW row = NULL; while (1) { row = function1(); if(row != NULL) function2(row); } } (variable and function names have been generalized to protect the innocent) But after the 3rd or 4th call to function2, that only uses row for reading, row starts losing its value coming to a segfault error... Anyone's got any ideas why? I'm not sure the amount of global variables in this code is any good, but I didn't design it and only got until tomorrow to fix and finish it, so workarounds are welcome! Thanks!

    Read the article

  • Several client waiting for the same event

    - by ff8mania
    I'm developing a communication API to be used by a lot of generic clients to communicate with a proprietary system. This proprietary system exposes an API, and I use a particular classes to send and wait messages from this system: obviously the system alert me that a message is ready using an event. The event is named OnMessageArrived. My idea is to expose a simple SendSyncMessage(message) method that helps the user/client to simply send a message and the method returns the response. The client: using ( Communicator c = new Communicator() ) { response = c.SendSync(message); } The communicator class is done in this way: public class Communicator : IDisposable { // Proprietary system object ExternalSystem c; String currentRespone; Guid currentGUID; private readonly ManualResetEvent _manualResetEvent; private ManualResetEvent _manualResetEvent2; String systemName = "system"; String ServerName = "server"; public Communicator() { _manualResetEvent = new ManualResetEvent(false); //This methods are from the proprietary system API c = SystemInstance.CreateInstance(); c.Connect(systemName , ServerName); } private void ConnectionStarter( object data ) { c.OnMessageArrivedEvent += c_OnMessageArrivedEvent; _manualResetEvent.WaitOne(); c.OnMessageArrivedEvent-= c_OnMessageArrivedEvent; } public String SendSync( String Message ) { Thread _internalThread = new Thread(ConnectionStarter); _internalThread.Start(c); _manualResetEvent2 = new ManualResetEvent(false); String toRet; int messageID; currentGUID = Guid.NewGuid(); c.SendMessage(Message, "Request", currentGUID.ToString()); _manualResetEvent2.WaitOne(); toRet = currentRespone; return toRet; } void c_OnMessageArrivedEvent( int Id, string root, string guid, int TimeOut, out int ReturnCode ) { if ( !guid.Equals(currentGUID.ToString()) ) { _manualResetEvent2.Set(); ReturnCode = 0; return; } object newMessage; c.FetchMessage(Id, 7, out newMessage); currentRespone = newMessage.ToString(); ReturnCode = 0; _manualResetEvent2.Set(); } } I'm really noob in using waithandle, but my idea was to create an instance that sends the message and waits for an event. As soon as the event arrived, checks if the message is the one I expect (checking the unique guid), otherwise continues to wait for the next event. This because could be (and usually is in this way) a lot of clients working concurrently, and I want them to work parallel. As I implemented my stuff, at the moment if I run client 1, client 2 and client 3, client 2 starts sending message as soon as client 1 has finished, and client 3 as client 2 has finished: not what I'm trying to do. Can you help me to fix my code and get my target? Thanks!

    Read the article

  • PHP running as a FastCGI application (php-cgi) - how to issue concurrent requests?

    - by Sbm007
    Some background information: I'm writing my own webserver in Java and a couple of days ago I asked on SO how exactly Apache interfaces with PHP, so I can implement PHP support. I learnt that FastCGI is the best approach (since mod_php is not an option). So I have looked at the FastCGI protocol specification and have managed to write a working FastCGI wrapper for my server. I have tested phpinfo() and it works, in fact all PHP functions seem to work just fine (posting data, sessions, date/time, etc etc). My webserver is able to serve requests concurrently (ie user1 can retrieve file1.html at the same time as user2 requesting some_large_binary_file.zip), it does this by spawning a new Java thread for each user request (terminating when completed or user connection with client is cancelled). However, it cannot deal with 2 (or more) FastCGI requests at the same time. What it does is, it queues them up, so when request 1 is completed immediately thereafter it starts processing request 2. I tested this with 2 PHP pages, one contains sleep(10) and the other phpinfo(). How would I go about dealing with multiple requests as I know it can be done (PHP under IIS runs as FastCGI and it can deal with multiple requests just fine). Some more info: I am coding under windows and my batch file used to execute php-cgi.exe contains: set PHP_FCGI_CHILDREN=8 set PHP_FCGI_MAX_REQUESTS=500 php-cgi.exe -b 9000 But it does not spawn 8 children, the service simply terminates after 500 requests. I have done research and from Wikipedia: Processing of multiple requests simultaneously is achieved either by using a single connection with internal multiplexing (ie. multiple requests over a single connection) and/or by using multiple connections Now clearly the multiple connections isn't working for me, as everytime a client requests something that involves FastCGI it creates a new socket to the FastCGI application, but it does not work concurrently (it queues them up instead). I know that internal multiplexing of FastCGI requests under the same connection is accomplished by issuing each unique FastCGI request with a different request ID. (also see the last 3 paragraphs of 'The Communication Protocol' heading in this article). I have not tested this, but how would I go about implementing that? I take it I need some kind of FastCGI Java thread which contains a Map of some sort and a static function which I can use to add requests to. Then in the Thread's run() function it would have a while loop and for every cycle it would check whether the Map contains new requests, if so it would assign them a request ID and write them to the FastCGI stream. And then wait for input etc etc, As you can see this becomes too complicated. Does anyone know the correct way of doing this? Or any thoughts at all? Thanks very much. Note, if required I can supply the code for my FastCGI wrapper.

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • How can I stop Flash from changing indent when user Clicks on hyperlink in TextField?

    - by Paul Chernoch
    I have a TextField which I initialize by setting htmlText. The text has anchor tags (hyperlinks). When a user clicks on the hyperlink, the indentation of the second and subsequent lines in the paragraph changes. Why? How do I stop it? My html has an image at the beginning of the line, followed by the tag, followed by more text. To style the hyper links to look blue always and underlined when the mouse is over them, I do this: var css:StyleSheet = new StyleSheet(); css.parseCSS("a {color: #0000FF;} a:hover {text-decoration: underline;}"); stepText.styleSheet = css; stepText.htmlText = textToUse; stepText.visible = true; Here is a fragment of the html text (with newlines and exrta whitespace added to improve readability - originally it was one long line): <textformat indent="-37" blockindent="37" > <img src="media/interface/level-1-bullets/solid-circle.png" align="left" hspace="8" vspace="1"/> American Dental Association. (n.d.). <i>Cleaning your teeth and gums (oral hygiene)</i>. Retrieved 11/24/08, from <a href="http://www.ada.org/public/topics/cleaning_faq.asp" target="_blank">http://www.ada.org/public/topics/cleaning_faq.asp </a> </textformat> <br/> As it turns out, the text field is of a width such that it wraps and the second line starts with "Retrieved 11/24/08". Clicking on the hyper link causes this particular line to be indented. Subsequent paragraphs are not affected. ASIDE: The image is a list bullet about 37 pixels wide. (I used images instead of li tags because Flash does not allow nested lists, so I faked it using a series of images with varying amounts of whitespace to simulate three levels of indentation.) IDEA: I was thinking of changing all hyperlinks to use "event:" as the URL protocol, which causes a TextEvent.LINK event to be triggered instead of following the link. Then I would have to open the browser in a second call. I could use this event handler to set the html text to itself, which might clear the problem. (When I switch pages in my application and then come back to the page, everything is OKAY again.) PROBLEM: If I use the "event:" protocol and user tries the right-mouse button click, they will get an error, or so I am told. (See http://www.blog.lessrain.com/as3-texteventlink-and-contextmenu-incompatibilities/ ) I do not like this trade-off.

    Read the article

  • waiting for 2 different events in a single thread

    - by João Portela
    component A (in C++) - is blocked waiting for alarm signals (not relevant) and IO signals (1 udp socket). has one handler for each of these. component B (java) - has to receive the same information the component A udp socket receives. periodicaly gives instructions that should be sent through component A udp socket. How to join both components? it is strongly desirable that: the changes to attach component B to component A are minimal (its not my code and it is not very pleasent to mess with). the time taken by the new operations (usually communicating with component B) interfere very little with the usual processing time of component A - this means that if the operations are going to take a "some" time I would rather use a thread or something to do them. note: since component A receives udp packets more frequently that it has component B instructions to forward, if necessary, it can only forward the instructions (when available) from the IO handler. my initial ideia was to develop a component C (in C++) that would sit inside the component A code (is this called an adapter?) that when instanciated starts the java process and makes the necessary connections (that not so little overhead in the initialization is not a problem). It would have 2 stacks, one for the data to give component B (lets call it Bstack) and for the data to give component A (lets call it Astack). It would sit on its thread (lets call it new-thread) waiting for data to be available in Bstack to send it over udp, and listen on the udp socket to put data on the Astack. This means that the changes to component A are only: when it receives a new UDP packet put it on the Bstack, and if there is something on the Astack sent it over its UDP socket (I decided for this because this socket would only be used in the main thread). One of the problems is that I don't know how to wait for both of these events at the same time using only one thread. so my questions are: Do I really need to use the main thread to send the data over component A socket or can I do it from the new-thread? (I think the answer is no, but I'm not sure about race conditions on sockets) how to I wait for both events? boost::condition_variable or something similar seems the solution in the case of the stack and boost::asio::io_service io_service.run() seems like the thing to use for the socket. Is there any other alternative solution for this problem that I'm not aware of? Thanks for reading this long text but I really wanted you to understand the problem.

    Read the article

  • How to manipulate file paths intelligently in .Net 3.0?

    - by Hamish Grubijan
    Scenario: I am maintaining a function which helps with an install - copies files from PathPart1/pending_install/PathPart2/fileName to PathPart1/PathPart2/fileName. It seems that String.Replace() and Path.Combine() do not play well together. The code is below. I added this section: // The behavior of Path.Combine is weird. See: // http://stackoverflow.com/questions/53102/why-does-path-combine-not-properly-concatenate-filenames-that-start-with-path-dir while (strDestFile.StartsWith(@"\")) { strDestFile = strDestFile.Substring(1); // Remove any leading backslashes } Debug.Assert(!Path.IsPathRooted(strDestFile), "This will make the Path.Combine(,) fail)."); in order to take care of a bug (code is sensitive to a constant @"pending_install\" vs @"pending_install" which I did not like and changed (long story, but there was a good opportunity for constant reuse). Now the whole function: //You want to uncompress only the files downloaded. Not every file in the dest directory. private void UncompressFiles() { string strSrcDir = _application.Client.TempDir; ArrayList arrFiles = new ArrayList(); GetAllCompressedFiles(ref arrFiles, strSrcDir); IEnumerator enumer = arrFiles.GetEnumerator(); while (enumer.MoveNext()) { string strDestFile = enumer.Current.ToString().Replace(_application.Client.TempDir, String.Empty); // The behavior of Path.Combine is weird. See: // http://stackoverflow.com/questions/53102/why-does-path-combine-not-properly-concatenate-filenames-that-start-with-path-dir while (strDestFile.StartsWith(@"\")) { strDestFile = strDestFile.Substring(1); // Remove any leading backslashes } Debug.Assert(!Path.IsPathRooted(strDestFile), "This will make the Path.Combine(,) fail)."); strDestFile = Path.Combine(_application.Client.BaseDir, strDestFile); strDestFile = strDestFile.Replace(Path.GetExtension(strDestFile), String.Empty); ZSharpLib.ZipExtractor.ExtractZip(enumer.Current.ToString(), strDestFile); FileUtility.DeleteFile(enumer.Current.ToString()); } } Please do not laugh at the use of ArrayList and the way it is being iterated - it was pioneered by a C++ coder during a .Net 1.1 era. I will change it. What I am interested in: what is a better way of replacing PathPart1/pending_install/PathPart2/fileName with PathPart1/PathPart2/fileName within the current code. Note that _application.Client.TempDir is just _application.Client.BaseDir + @"\pending_install". While there are many ways to improve the code, I am mainly concerned with the part which has to do with String.Replace(...) and Path.Combine(,). I do not want to make changes outside of this function. I wish Path.Combine(,) took an optional bool flag, but it does not. So ... given my constraints, how can I rework this so that it starts to sucks less? Thanks!

    Read the article

  • Import? Initialize? what do to?

    - by Jeremy B
    I'm working on homework and I'm close but I am having an issue. I just learned how to work with packages in eclipse so I have a class that is importing another class from a package (I think I said that right) The main prompts the user to enter an integer between -100 and 100 and I am having an issue with validating it. I know the issue is where I'm importing I'm just unsure the direction I need to go to fix it. This is a section of my main code. (my issue starts with the last couple lines if you want to skip ahead) import myUtils.util.Console; public class ConsoleTestApp { public static void main(String args[]) { // create the Console object Console c = new Console(); // display a welcome message c.println("Welcome to the Console Tester application"); c.println(); // int c.println("Int Test"); int i = c.getIntWithinRange("Enter an integer between -100 and 100: ", -101, 101); c.println(); I have a class called Console that is located in another package that I believe I have properly imported. here is the code I am stuck on in my console class. public int getIntWithinRange(String prompt, int min, int max) { int i = 0; boolean isValid = false; while (isValid == false) { System.out.println(prompt); if (sc.hasNextInt()) { //if user chooses menu option less than 1 the program will print an error message i = sc.nextInt(); if (i < min) { System.out.println("Error! Please enter an int greater than -100"); } else if (i > max) { System.out.println("Error! Please enter an int less than 100"); } else isValid = true; } else System.out.println("Error! Invalid number value"); sc.nextLine(); } // return the int return i; } when I run this I keep getting my last print which is an invalid number value. am I not importing the code from the main method in the other console properly?

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Android onActivityResult is always 0

    - by Dean
    This has been killing me for two days now. I have a main Activity A which calls a second Activity B. Activity B simply presents the user with a listview. When I press an item on the list view I want a couple of strings to be passed back to the main Activity A and Activiy B will finish. The problem is I always get a resultcode of 0 and the data bundle is null. I really don't understand why this is happening. Here is my code. Start Activity B for result; Test.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View v) { Intent i = new Intent(recipeActivity.this, BrowseLoadRecipes.class); startActivityForResult(i, RECIPE_CHOOSER); } }); This starts the second Activity fine. Activity B populates a listview and when I click an item I'm trying to send some data back to the calling Activity A. Any text at the moment, so I used the following in Activity B; lv.setOnItemClickListener(new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> a, View v, int position, long id) { Bundle bundle = new Bundle(); bundle.putString("TEXT", "Please work... pleeeeaasee"); Intent mIntent = new Intent(); mIntent.putExtras(bundle); setResult(RESULT_OK, mIntent); finish(); } }); In the calling activity I have the following listening for the return as follows; protected void onActivityResult(int requestCode, int resultCode, Intent data) { switch(requestCode) { //TODO case RECIPE_CHOOSER: Toast.makeText(getApplicationContext(), "In recipe return", Toast.LENGTH_SHORT).show(); Toast.makeText(getApplicationContext(), "resultCode is " + String.valueOf(resultCode), Toast.LENGTH_SHORT).show(); if (resultCode == RESULT_OK) { Bundle b = getIntent().getExtras(); Toast.makeText(getApplicationContext(), "Returned " + b.getString("TEXT"), Toast.LENGTH_LONG).show(); } if (resultCode == RESULT_CANCELED) { } break; } } } I can see that the request code is correctly returned, but the resultcode is always a 0 and the data is always a null. I've ran through the debug and the setResult is doing its job and the bundle does indeed have the data I'm passing, but it's lost at some point along the way. Is there something in the manifest I'm missing or something. It's killed my progress on this project so far. Any help would truly be appreciated. Thanks, Dean

    Read the article

  • EXC_MEMORY_ACCESS when trying to delete from Core Data ($cash solution)

    - by llloydxmas
    I have an application that downloads an xml file, parses the file, and creates core data objects while doing so. In the parse code I have a function called 'emptydatacontext' that removes all items from Core Data before creating replacements items from the xml data. This method looks like this: -(void) emptyDataContext { NSFetchRequest * allCon = [[NSFetchRequest alloc] init]; [allCon setEntity:[NSEntityDescription entityForName:@"Condition" inManagedObjectContext:managedObjectContext]]; NSError * error = nil; NSArray * conditions = [managedObjectContext executeFetchRequest:allCon error:&error]; DebugLog(@"ERROR: %@",error); DebugLog(@"RETRIEVED: %@", conditions); [allCon release]; for (NSManagedObject * condition in conditions) { [managedObjectContext deleteObject:condition]; } // Update the data model effectivly removing the objects we removed above. //NSError *error; if (![managedObjectContext save:&error]) { DebugLog(@"%@", [error domain]); } } The first time this runs it deletes all objects and functions as it should - creating new objects from the xml file. I created a 'update' button that starts the exact same process of retrieving the file the proceeding with the parse & build. All is well until its time to delete the core data objects. This 'deleteObject' call creates a "EXC_BAD_ACCESS" error each time. This only happens on the second time through. Captured errors return null. If I log the 'conditions' array I get a list of NSManagedObjects on the first run. On the second this log request causes a crash exactly as the deleteObject call does. I have a feeling it is something very simple I'm missing or not doing correctly to cause this behavior. The data works great on my tableviews - its only when trying to update I get the crashes. I have spent days & days on this trying numerous alternative methods. Whats left of my hair is falling out. I'd be willing to ante up some cash for anyone willing to look at my code and see what I'm doing wrong. Just need to get past this hurdle. Thanks in advance for the help!

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • CoreGraphics taking a while to show on a large view - can i get it to repeat pixels?

    - by Andrew
    This is my coregraphics code: void drawTopPaperBackground(CGContextRef context, CGRect rect) { CGRect paper3 = CGRectMake(10, 14, 300, rect.size.height - 14); CGRect paper2 = CGRectMake(13, 12, 294, rect.size.height - 12); CGRect paper1 = CGRectMake(16, 10, 288, rect.size.height - 10); //Shadow CGContextSetShadowWithColor(context, CGSizeMake(0,0), 10, [[UIColor colorWithWhite:0 alpha:0.5]CGColor]); CGPathRef path = createRoundedRectForRect(paper3, 0); CGContextSetFillColorWithColor(context, [[UIColor blackColor] CGColor]); CGContextAddPath(context, path); CGContextFillPath(context); //Layers of paper //CGContextSaveGState(context); drawPaper(context, paper3); drawPaper(context, paper2); drawPaper(context, paper1); //CGContextRestoreGState(context); } void drawPaper(CGContextRef context, CGRect rect) { //Shadow CGContextSaveGState(context); CGContextSetShadowWithColor(context, CGSizeMake(0,0), 1, [[UIColor colorWithWhite:0 alpha:0.5]CGColor]); CGPathRef path = createRoundedRectForRect(rect, 0); CGContextSetFillColorWithColor(context, [[UIColor blackColor] CGColor]); CGContextAddPath(context, path); CGContextFillPath(context); //CGContextRestoreGState(context); //Gradient //CGContextSaveGState(context); CGColorRef startColor = [UIColor colorWithWhite:0.92 alpha:1.0].CGColor; CGColorRef endColor = [UIColor colorWithWhite:0.94 alpha:1.0].CGColor; CGRect firstHalf = CGRectMake(rect.origin.x, rect.origin.y, rect.size.width / 2, rect.size.height); CGRect secondHalf = CGRectMake(rect.origin.x + (rect.size.width / 2), rect.origin.y, rect.size.width / 2, rect.size.height); drawVerticalGradient(context, firstHalf, startColor, endColor); drawVerticalGradient(context, secondHalf, endColor, startColor); //CGContextRestoreGState(context); //CGContextSaveGState(context); CGRect redRect = rectForRectWithInset(rect, -1); CGMutablePathRef redPath = createRoundedRectForRect(redRect, 0); //CGContextSaveGState(context); CGContextSetStrokeColorWithColor(context, [[UIColor blackColor] CGColor]); CGContextAddPath(context, path); CGContextClip(context); CGContextAddPath(context, redPath); CGContextSetShadowWithColor(context, CGSizeMake(0, 0), 15.0, [[UIColor colorWithWhite:0 alpha:0.1] CGColor]); CGContextStrokePath(context); CGContextRestoreGState(context); } The view is a UIScrollView, which contains a textview. Every time the user types something and goes onto a new line, I call [self setNeedsDisplay]; and it redraws the code. But when the view starts to get long - around 1000 height, it has very noticeable lag. How can i make this code more efficient? Can i take a line of pixels and make it just repeat that, or stretch it, all the way down?

    Read the article

  • Blit Queue Optimization Algorithm

    - by martona
    I'm looking to implement a module that manages a blit queue. There's a single surface, and portions of this surface (bounded by rectangles) are copied to elsewhere within the surface: add_blt(rect src, point dst); There can be any number of operations posted, in order, to the queue. Eventually the user of the queue will stop posting blits, and ask for an optimal set of operations to actually perform on the surface. The task of the module is to ensure that no pixel is copied unnecessarily. This gets tricky because of overlaps of course. A blit could re-blit a previously copied pixel. Ideally blit operations would be subdivided in the optimization phase in such a way that every block goes to its final place with a single operation. It's tricky but not impossible to put this together. I'm just trying to not reinvent the wheel. I looked around on the 'net, and the only thing I found was the SDL_BlitPool Library which assumes that the source surface differs from the destination. It also does a lot of grunt work, seemingly unnecessarily: regions and similar building blocks are a given. I'm looking for something higher-level. Of course, I'm not going to look a gift horse in the mouth, and I also don't mind doing actual work... If someone can come forward with a basic idea that makes this problem seem less complex than it does right now, that'd be awesome too. EDIT: Thinking about aaronasterling's answer... could this work? Implement customized region handler code that can maintain metadata for every rectangle it contains. When the region handler splits up a rectangle, it will automatically associate the metadata of this rectangle with the resulting sub-rectangles. When the optimization run starts, create an empty region handled by the above customized code, call this the master region Iterate through the blt queue, and for every entry: Let srcrect be the source rectangle for the blt beng examined Get the intersection of srcrect and master region into temp region Remove temp region from master region, so master region no longer covers temp region Promote srcrect to a region (srcrgn) and subtract temp region from it Offset temp region and srcrgn with the vector of the current blt: their union will cover the destination area of the current blt Add to master region all rects in temp region, retaining the original source metadata (step one of adding the current blt to the master region) Add to master region all rects in srcrgn, adding the source information for the current blt (step two of adding the current blt to the master region) Optimize master region by checking if adjacent sub-rectangles that are merge candidates have the same metadata. Two sub-rectangles are merge candidates if (r1.x1 == r2.x1 && r1.x2 == r2.x2) | (r1.y1 == r2.y1 && r1.y2 == r2.y2). If yes, combine them. Enumerate master region's sub-rectangles. Every rectangle returned is an optimized blt operation destination. The associated metadata is the blt operation`s source.

    Read the article

< Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >