Search Results

Search found 22310 results on 893 pages for 'key binding'.

Page 210/893 | < Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >

• Ideas for multiplatform encrypted java mobile storage system

  - by Fernando Miguélez

  Objective I am currently designing the API for a multiplatform storage system that would offer same interface and capabilities accross following supported mobile Java Platforms: J2ME. Minimum configuration/profile CLDC 1.1/MIDP 2.0 with support for some necessary JSRs (JSR-75 for file storage). Android. No minimum platform version decided yet, but rather likely could be API level 7. Blackberry. It would use the same base source of J2ME but taking advantage of some advaced capabilities of the platform. No minimum configuration decided yet (maybe 4.6 because of 64 KB limitation for RMS on 4.5). Basically the API would sport three kind of stores: Files. These would allow standard directory/file manipulation (read/write through streams, create, mkdir, etc.). Preferences. It is a special store that handles properties accessed through keys (Similar to plain old java properties file but supporting some improvements such as different value data types such as SharedPreferences on Android platform) Local Message Queues. This store would offer basic message queue functionality. Considerations Inspired on JSR-75, all types of stores would be accessed in an uniform way by means of an URL following RFC 1738 conventions, but with custom defined prefixes (i.e. "file://" for files, "prefs://" for preferences or "queue://" for message queues). The address would refer to a virtual location that would be mapped to a physical storage object by each mobile platform implementation. Only files would allow hierarchical storage (folders) and access to external extorage memory cards (by means of a unit name, the same way as in JSR-75, but that would not change regardless of underlying platform). The other types would only support flat storage. The system should also support a secure version of all basic types. The user would indicate it by prefixing "s" to the URL (i.e. "sfile://" instead of "file://"). The API would only require one PIN (introduced only once) to access any kind of secure object types. Implementation issues For the implementation of both plaintext and encrypted stores, I would use the functionality available on the underlying platforms: Files. These are available on all platforms (J2ME only with JSR-75, but it is mandatory for our needs). The abstract File to actual File mapping is straight except for addressing issues. RMS. This type of store available on J2ME (and Blackberry) platforms is convenient for Preferences and maybe Message Queues (though depending on performance or size requirements these could be implemented by means of normal files). SharedPreferences. This type of storage, only available on Android, would match Preferences needs. SQLite databases. This could be used for message queues on Android (and maybe Blackberry). When it comes to encryption some requirements should be met: To ease the implementation it will be carried out on read/write operations basis on streams (for files), RMS Records, SharedPreferences key-value pairs, SQLite database columns. Every underlying storage object should use the same encryption key. Handling of encrypted stores should be the same as the unencrypted counterpart. The only difference (from the user point of view) accessing an encrypted store would be the addressing. The user PIN provides access to any secure storage object, but the change of it would not require to decrypt/re-encrypt all the encrypted data. Cryptographic capabilities of underlying platform should be used whenever it is possible, so we would use: J2ME: SATSA-CRYPTO if it is available (not mandatory) or lightweight BoncyCastle cryptographic framework for J2ME. Blackberry: RIM Cryptographic API or BouncyCastle Android: JCE with integraced cryptographic provider (BouncyCastle?) Doubts Having reached this point I was struck by some doubts about what solution would be more convenient, taking into account the limitation of the plataforms. These are some of my doubts: Encryption Algorithm for data. Would AES-128 be strong and fast enough? What alternatives for such scenario would you suggest? Encryption Mode. I have read about the weakness of ECB encryption versus CBC, but in this case the first would have the advantage of random access to blocks, which is interesting for seek functionality on files. What type of encryption mode would you choose instead? Is stream encryption suitable for this case? Key generation. There could be one key generated for each storage object (file, RMS RecordStore, etc.) or just use one for all the objects of the same type. The first seems "safer", though it would require some extra space on device. In your opinion what would the trade-offs of each? Key storage. For this case using a standard JKS (or PKCS#12) KeyStore file could be suited to store encryption keys, but I could also define a smaller structure (encryption-transformation / key data / checksum) that could be attached to each storage store (i.e. using addition files with the same name and special extension for plain files or embedded inside other types of objects such as RMS Record Stores). What approach would you prefer? And when it comes to using a standard KeyStore with multiple-key generation (given this is your preference), would it be better to use a record-store per storage object or just a global KeyStore keeping all keys (i.e. using the URL identifier of abstract storage object as alias)? Master key. The use of a master key seems obvious. This key should be protected by user PIN (introduced only once) and would allow access to the rest of encryption keys (they would be encrypted by means of this master key). Changing the PIN would only require to reencrypt this key and not all the encrypted data. Where would you keep it taking into account that if this got lost all data would be no further accesible? What further considerations should I take into account? Platform cryptography support. Do SATSA-CRYPTO-enabled J2ME phones really take advantage of some dedicated hardware acceleration (or other advantage I have not foreseen) and would this approach be prefered (whenever possible) over just BouncyCastle implementation? For the same reason is RIM Cryptographic API worth the license cost over BouncyCastle? Any comments, critics, further considerations or different approaches are welcome.

  Read the article

• CouchDB Find One not working

  - by Andrew

  I am a couchDB newbie and am doing the examples in the O'Reilly CouchDB guide. I have a problem using a view to retrieve a document by key: curl http://127.0.0.1:5984/basic/_design/example/_view/by_date?key="2009/01/15 15:52:20" gives the reply: curl: (52) Empty reply from server but just retrieving all rows: curl http://127.0.0.1:5984/basic/_design/example/_view/by_date gives me 3 rows including the specific row I am looking for: {"id":"hello-world","key":"2009/01/15 15:52:20","value":"Hello World"} why doesn't the key query work? I am using CouchDB version 0.10.0 on Ubuntu 9.10

  Read the article

• Is it possible to use pure Encoding and Decoding keys in asymmetric cryptography instead of private

  - by macropas

  Is it possible to use pure Encoding and Decoding keys instead of private and public keys? As I know in .Net asymmetric RSA implementation private key RSAParameters parameters = (new RSACryptoServiceProvider()).ExportParameters(true) is a superset of public key. And using private key we can both encode and decode our data. But I need key only for decoding data. How to do it? I experimented on nulling RSAParameters fields, but RSACryptoServiceProvider object can't import such parameters.

  Read the article

• iphone Odd Problem when using a custom cell

  - by Brodie4598

  Please note where I have the NSLOG. All it is displaying in the log is the first three items in the nameSection. After some testing, I discovered it is displaying how many keys there are because if I add a key to the plist, it will log a fourth item in log. nameSection should be an array of the strings that make up the key array in the plist file. the plist file has 3 dictionaries, each with several arrays of strings. The code picks the dictionary I am working with correctly, then should use the array names as sections in the table and the strings en each array as what to display in each cell. so if the dictionary i am working with has 3 arrays, NSLOG will display 3 strings from the first array: 2010-05-01 17:03:26.957 Checklists[63926:207] string0 2010-05-01 17:03:26.960 Checklists[63926:207] string1 2010-05-01 17:03:26.962 Checklists[63926:207] string2 then stop with: 2010-05-01 17:03:26.963 Checklists[63926:207] * Terminating app due to uncaught exception 'NSRangeException', reason: '* -[NSCFArray objectAtIndex:]: index (3) beyond bounds (3)' if i added an array to the dictionary, it log 4 items instead of 3. I hope this explanation makes sense... -(NSInteger)numberOfSectionsInTableView:(UITableView *)tableView{ return [keys count]; } -(NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger) section { NSString *key = [keys objectAtIndex:section]; NSArray *nameSection = [names objectForKey:key]; return [nameSection count]; } -(UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { NSUInteger section = [indexPath section]; NSString *key = [keys objectAtIndex: section]; NSArray *nameSection = [names objectForKey:key]; static NSString *SectionsTableIdentifier = @"SectionsTableIdentifier"; static NSString *ChecklistCellIdentifier = @"ChecklistCellIdentifier "; ChecklistCell *cell = (ChecklistCell *)[tableView dequeueReusableCellWithIdentifier: SectionsTableIdentifier]; if (cell == nil) { NSArray *nib = [[NSBundle mainBundle] loadNibNamed:@"ChecklistCell" owner:self options:nil]; for (id oneObject in nib) if ([oneObject isKindOfClass:[ChecklistCell class]]) cell = (ChecklistCell *)oneObject; } NSUInteger row = [indexPath row]; NSDictionary *rowData = [self.keys objectAtIndex:row]; NSString *tempString = [[NSString alloc]initWithFormat:@"%@",[nameSection objectAtIndex:row]]; NSLog(@"%@",tempString); cell.colorLabel.text = [tempArray objectAtIndex:0]; cell.nameLabel.text = [tempArray objectAtIndex:1]; return cell; return cell; } - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { UITableViewCell *cell = [tableView cellForRowAtIndexPath:indexPath]; if (cell.accessoryType == UITableViewCellAccessoryNone) { cell.accessoryType = UITableViewCellAccessoryCheckmark; } else if (cell.accessoryType == UITableViewCellAccessoryCheckmark) { cell.accessoryType = UITableViewCellAccessoryNone; } [tableView deselectRowAtIndexPath:indexPath animated:NO]; } -(NSString *)tableView:(UITableView *)tableView titleForHeaderInSection:(NSInteger)section{ NSString *key = [keys objectAtIndex:section]; return key; }

  Read the article

• Vim syntax highlighting for ruby 1.9

  - by Peter

  Ruby 1.9 has a few new syntax elements, such as the {key: value} hash literal syntax. Has anyone written or seen an updated syntax/ruby.vim highlighting file that will highlight key: just like it highlights :key in {:key => value}?

  Read the article

• What is the best way to store three attributes entry sets in Java?

  - by user321524

  HashMaps allow for mapping key value pairs; what is the recommendation if there is an extra value? i.e HashMap maps key-value pairs: Key, Value What is the best way to map: Key, Value, Value1? Thanks.

  Read the article

• python programme.

  - by siva

  hi, i am siva this is frist time taken the python programming language i have a small problem please help me the question is **Write two functions, called countSubStringMatch and countSubStringMatchRecursive that take two arguments, a key string and a target string. These functions iteratively and recursively count the number of instances of the key in the target string. You should complete definitions for def countSubStringMatch(target,key): and def countSubStringMatchRecursive (target, key): **

  Read the article

• Have Javascript insert a backspace within ContentEditable Div.

  - by DavidR

  An odd request, I know. I want Javascript to pretend the user just pressed the backspace. That's all I really want, if you want more info: My last topic here, gives more explaination. In short: I press a key, javascript converts the key to the greek equivalent, then puts that key in instead. The problem is, when onKeyUp is activated, it starts a function which looks for combinable character pairs put together (for accents) and inserts that key.

  Read the article

• CouchDB: accessing nested structutes in map function

  - by Vegar

  I have a document based on a xml structure that I have stored in a CouchDB database. Some of the keys contains namespaces and are on the form "namespace:key": {"mykey":{nested:key":"nested value"}} In the map function, I want to emit the nested value as a key, but the colon inside the name makes it hard... emit(doc.mykey.nested:key, doc) <-- will not work. Does anyone know how this can be solved?

  Read the article

• Emulating a "OR" condition in Datastore.

  - by Jelle

  Hello again, I'm using the Google App Engine with Python (Django). How to emulate "SELECT * FROM bla WHERE touser = common.userstats("key") OR fromuser = common.userstats("key") ORDER BY date ASC"? I was thinking of something like this, but I can't get it in the order I want. recievedlist = models.P1.all() recievedlist.filter("touser =", common.userstats("key")) plus1list = recievedlist.fetch(50) sendlist = models.P1.all() sendlist.filter("fromuser =", common.userstats("key")) plus1list += sendlist.fetch(50) # order plus1list

  Read the article

• Loop through a Map with JSTL

  - by Dean

  I'm looking to have JSTL loop through a Map and output the value of the key and it's value. For example I have a Map which can have any number of entries, i'd like to loop through this map using JSTL and output both the key and it's value. I know how to access the value using the key, ${myMap['keystring']}, but how do I access the key?

  Read the article

• How to pass an associative array as argument to a function in Bash?

  - by niksfirefly

  How do you pass an associative array as an argument to a function? Is this possible in Bash? The code below is not working as expected: function iterateArray { local ADATA="${@}" # associative array for key in "${!ADATA[@]}" do echo "key - ${key}" echo "value: ${ADATA[$key]}" done } Passing associative arrays to a function like normal arrays does not work: iterateArray "$A_DATA" or iterateArray "$A_DATA[@]"

  Read the article

• mysql error #1452 appearing when trying to add a constraint

  - by user1701484

  I am trying to alter a table so That I can add a foreign key constraint in mysql database: ALTER TABLE `Question` ADD CONSTRAINT `FK_question` FOREIGN KEY (`QuestionId`) REFERENCES `Image_Question` (`QuestionId`) ON DELETE CASCADE ; Problem is that it is giving me this error: 1452 - Cannot add or update a child row: a foreign key constraint fails (mobile_app. '#sql-4517_15241', CONSTRAINT FK_question FOREIGN KEY (QuestionId) REFERENCES Image_Question (QuestionId) ON DELETE CASCADE) What does this error actually mean and what are the possible solutions I might have to undertake in order to fix this?

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• How to use HTTP method DELETE on Google App Engine?

  - by Jader Dias

  I can use this verb in the Python Windows SDK. But not in production. Why? What am I doing wrong? The error message includes (only seen via firebug or fiddler) Malformed request or something like that My code looks like: from google.appengine.ext import db from google.appengine.ext import webapp class Handler(webapp.RequestHandler): def delete(self): key = self.request.get('key') item = db.get(key) item.delete() self.response.out.write(key)

  Read the article

• Security review of an authenticated Diffie Hellman variant

  - by mtraut

  EDIT I'm still hoping for some advice on this, i tried to clarify my intentions... When i came upon device pairing in my mobile communication framework i studied a lot of papers on this topic and and also got some input from previous questions here. But, i didn't find a ready to implement protocol solution - so i invented a derivate and as i'm no crypto geek i'm not sure about the security caveats of the final solution: The main questions are Is SHA256 sufficient as a commit function? Is the addition of the shared secret as an authentication info in the commit string safe? What is the overall security of the 1024 bit group DH I assume at most 2^-24 bit probability of succesful MITM attack (because of 24 bit challenge). Is this plausible? What may be the most promising attack (besides ripping the device out off my numb, cold hands) This is the algorithm sketch For first time pairing, a solution proposed in "Key agreement in peer-to-peer wireless networks" (DH-SC) is implemented. I based it on a commitment derived from: A fix "UUID" for the communicating entity/role (128 bit, sent at protocol start, before commitment) The public DH key (192 bit private key, based on the 1024 bit Oakley group) A 24 bit random challenge Commit is computed using SHA256 c = sha256( UUID || DH pub || Chall) Both parties exchange this commitment, open and transfer the plain content of the above values. The 24 bit random is displayed to the user for manual authentication DH session key (128 bytes, see above) is computed When the user opts for persistent pairing, the session key is stored with the remote UUID as a shared secret Next time devices connect, commit is computed by additionally hashing the previous DH session key before the random challenge. For sure it is not transfered when opening. c = sha256( UUID || DH pub || DH sess || Chall) Now the user is not bothered authenticating when the local party can derive the same commitment using his own, stored previous DH session key. After succesful connection the new DH session key becomes the new shared secret. As this does not exactly fit the protocols i found so far (and as such their security proofs), i'd be very interested to get an opinion from some more crypto enabled guys here. BTW. i did read about the "EKE" protocol, but i'm not sure what the extra security level is.

  Read the article

• Is it possible to use pure Encrypting and Decrypting keys in asymmetric cryptography instead of priv

  - by macropas

  Is it possible to use pure Encrypting and Decrypting keys instead of private and public keys? As I know in .Net asymmetric RSA implementation private key RSAParameters parameters = (new RSACryptoServiceProvider()).ExportParameters(true) is a superset of public key. And using private key we can both encrypt and decrypt our data. But I need key only for decrypting data. How to do it? I experimented on nulling RSAParameters fields, but RSACryptoServiceProvider object can't import such parameters.

  Read the article

• C# Keyboard Input (Beginner Help)

  - by ThickBook

  I am trying to ask user "enter any key and when that key is pressed it shows that "You Pressed "Key". Can you help what's wrong in this code? This is what I have written using System; class Program { public static void Main(string[] args) { Console.Write("Enter any Key: "); char name = Console.Read(); Console.WriteLine("You pressed {0}", name); } }

  Read the article

• Is HashMap in Java collision safe

  - by changed

  Hi I am developing a parser that needs to put key value pairs in hashmap. But a key can have multiple values which i can do in this way HashMap<String,ArrayList<String>> . But what happens if number of keys are very large and it start matching with other key's hashcode. Will that rewrite previous key's value ? thanks -devSunday

  Read the article

• Foreign Keys in SQLITE in the Google Gears framework

  - by Maxim Gershkovich

  Hi all, Could someone please tell me why the following foreign key constraint (although executes fine) is not enforced by SQLITE? Could someone pleasse provide an example of how I can go about enforcing the relationship? CREATE TABLE User (UserID TEXT Unique NOT NULL PRIMARY KEY, FirstName TEXT NOT NULL, LastName TEXT NOT NULL, Username TEXT NOT NULL, Password TEXT NOT NULL, Email TEXT NOT NULL, SignupDate TEXT NOT NULL) CREATE TABLE Category (CategoryID TEXT Unique NOT NULL PRIMARY KEY, UserID TEXT, FOREIGN KEY(UserID) REFERENCES User(UserID))

  Read the article

• Adding keys to superglobals in php

  - by gautam kumar

  Is there any way by which I can add keys to superglobals in php without defining the corresponding values to those key? For example: $_SESSION['key']='set';//key` automatically gets defined. But I want to do something like this add_key($_SESSION,'key')//key is added to $_SESSION array. Is it possible?

  Read the article

• Basic question about encryption - what exactly are keys?

  - by Tomas

  Hi, I was browsing and found good articles about encryption. However, none of them described why the key lenght is important and what exactly the key is used for. My guess is that could work this way: 0101001101010101010 Key: 01010010101010010101 //the longer the key, the longer unique sequence XOR or smth: //result Is this at least a bit how it works or I am missing something? Thanks

  Read the article

• Change|Assign parent for the Model instance on Google App Engine Datastore

  - by Vladimir Prudnikov

  Is it possible to change or assign new parent to the Model instance that already in datastore? For example I need something like this task = db.get(db.Key(task_key)) project = db.get(db.Key(project_key)) task.parent = project task.put() but it doesn't works this way because task.parent is built-in method. I was thinking about creating a new Key instance for the task but there is no way to change key as well. Any thoughts?

  Read the article

• MySql Alter Syntax error with mulitple FK

  - by acidzombie24

  If i do the first one i have no problem. When i do addition i get a syntax error. What is wrong with the syntax? The error says syntax error near [entire 2nd line] alter table `ban_Status` add FOREIGN KEY (`banned_user`) REFERENCES `user_data`(`id`) alter table `ban_Status` add FOREIGN KEY (`banned_user`) REFERENCES `user_data`(`id`), FOREIGN KEY (`banning_user`) REFERENCES `user_data`(`id`), FOREIGN KEY (`unban_user`) REFERENCES `user_data`(`id`)

  Read the article

• Why is Dictionary.First() so slow?

  - by Rotsor

  Not a real question because I already found out the answer, but still interesting thing. I always thought that hash table is the fastest associative container if you hash properly. However, the following code is terribly slow. It executes only about 1 million iterations and takes more than 2 minutes of time on a Core 2 CPU. The code does the following: it maintains the collection todo of items it needs to process. At each iteration it takes an item from this collection (doesn't matter which item), deletes it, processes it if it wasn't processed (possibly adding more items to process), and repeats this until there are no items to process. The culprit seems to be the Dictionary.Keys.First() operation. The question is why is it slow? Stopwatch watch = new Stopwatch(); watch.Start(); HashSet<int> processed = new HashSet<int>(); Dictionary<int, int> todo = new Dictionary<int, int>(); todo.Add(1, 1); int iterations = 0; int limit = 500000; while (todo.Count > 0) { iterations++; var key = todo.Keys.First(); var value = todo[key]; todo.Remove(key); if (!processed.Contains(key)) { processed.Add(key); // process item here if (key < limit) { todo[key + 13] = value + 1; todo[key + 7] = value + 1; } // doesn't matter much how } } Console.WriteLine("Iterations: {0}; Time: {1}.", iterations, watch.Elapsed); This results in: Iterations: 923007; Time: 00:02:09.8414388. Simply changing Dictionary to SortedDictionary yields: Iterations: 499976; Time: 00:00:00.4451514. 300 times faster while having only 2 times less iterations. The same happens in java. Used HashMap instead of Dictionary and keySet().iterator().next() instead of Keys.First().

  Read the article

< Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >