Search Results

Search found 6361 results on 255 pages for 'speed'.

Page 212/255 | < Previous Page | 208 209 210 211 212 213 214 215 216 217 218 219  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • count on LINQ union

    - by brechtvhb
    I'm having this link statement: List<UserGroup> domains = UserRepository.Instance.UserIsAdminOf(currentUser.User_ID); query = (from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentFrom equals uug.User_ID where domains.Contains(uug.UserGroup) select doc) .Union(from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentTo equals uug.User_ID where domains.Contains(uug.UserGroup) select doc); Running this statement doesn't cause any problems. But when I want to count the resultset the query suddenly runs quite slow. totalRecords = query.Count(); The result of this query is : SELECT COUNT([t5].[DocumentID]) FROM ( SELECT [t4].[DocumentID], [t4].[DocumentFrom], [t4].[DocumentTo] FROM ( SELECT [t0].[DocumentID], [t0].[DocumentFrom], [t0].[DocumentTo FROM [dbo].[Document] AS [t0] INNER JOIN [dbo].[User_UserGroup] AS [t1] ON [t0].[DocumentFrom] = [t1].[User_ID] WHERE ([t1].[UserGroupID] = 2) OR ([t1].[UserGroupID] = 3) OR ([t1].[UserGroupID] = 6) UNION SELECT [t2].[DocumentID], [t2].[DocumentFrom], [t2].[DocumentTo] FROM [dbo].[Document] AS [t2] INNER JOIN [dbo].[User_UserGroup] AS [t3] ON [t2].[DocumentTo] = [t3].[User_ID] WHERE ([t3].[UserGroupID] = 2) OR ([t3].[UserGroupID] = 3) OR ([t3].[UserGroupID] = 6) ) AS [t4] ) AS [t5] Can anyone help me to improve the speed of the count query? Thanks in advance!

    Read the article

  • What is more viable to use? Javascript libraries or UI Programming tools?

    - by Haresh Karkar
    What is more viable to use:- Javascript Libraries: YUI, jQuery, ExtJs OR UI Programming tools: GWT, ExtGWT, SmartGWT It has become very difficult to choose between them as they are constantly increasing their capabilities to meet newer requirements. We all know the power of jQuery in UI manipulations. The latest news from Microsoft about jQuery being officially part of .Net developr’s toolkit will definitely make jQuery a preferred choice against other JavaScript libraries [See link: http://weblogs.asp.net/scottgu/archive/2008/09/28/jquery-and-microsoft.aspx]. But on the other hand, GWT is building a framework which could be used on client as well as on the sever side. This is definitely going to make developers’ life easy as it does not require developer to be an expert in browser quirks, XMLHttpRequest, and JavaScript in order to develop high-performance web applications. It includes SDK (Java API libraries, compiler, and development server which allows to write client-side applications in Java and deploy them as JavaScript), Speed Tracer and plug-in for Eclipse. GWT is used by many products like Google Wave and AdWords. So question is still un-answered, what is more viable to use? Any thoughts?

    Read the article

  • Can a GeneralPath be modified?

    - by Dov
    java2d is fairly expressive, but requires constructing lots of objects. In contrast, the older API would let you call methods to draw various shapes, but lacks all the new features like transparency, stroke, etc. Java has fairly high costs associated with object creation. For speed, I would like to create a GeneralPath whose structure does not change, but go in and change the x,y points inside. path = new GeneralPath(GeneralPath.WIND_EVEN_ODD, 10); path.moveTo(x,y); path.lineTo(x2, y2); double len = Math.sqrt((x2-x)*(x2-x) + (y2-y)*(y2-y)); double dx = (x-x2) * headLen / len; double dy = (y-y2) * headLen / len; double dx2 = -dy * (headWidth/headLen); double dy2 = dx * (headWidth/headLen); path.lineTo(x2 + dx + dx2, y2 + dy + dy2); path.moveTo(x2 + dx - dx2, y2 + dy - dy2); path.lineTo(x2,y2); This one isn't even that long. Imagine a much longer sequence of commands, and only the ones on the end are changing. I just want to be able to overwrite commands, to have an iterator effectively. Does that exist?

    Read the article

  • Banning by IP with php/mysql

    - by incrediman
    I want to be able to ban users by IP. My idea is to keep a list of IP's as rows in an BannedIPs table (the IP column would be an index). To check users' IP's against the table, I will keep a session variable called $_SESSION['IP'] for each session. If on any request, $_SESSION['IP'] doesn't match $_SERVER['REMOTE_ADDR'], I will update $_SESSION['IP'] and check the BannedIPs table to see if the IP is banned. (A flag will also be saved as a session variable specifying whether or not the user is banned) Here are the things I'm wondering: Does that sound like a good strategy with regards to speed and security (would someone be able to get around the IP ban somehow, other than changing IP's)? What's the best way to structure a mysql query that checks to see if a row exists? That is, what's the best way to query the db to see if a row with a certain IP exists (to check if it's banned)? Should I save the IP's as integers or strings? Note that... I estimate there will be between 1,000-10,000 banned IP's stored in the database. $_SERVER['REMOTE_ADDR'] is the IP from which the current request was sent.

    Read the article

  • JQuery Cycle fails on Page Refresh

    - by Darknight
    In a similar issue as this one: http://stackoverflow.com/questions/1719475/jquery-cycle-firefox-squishing-images I've managed to overcome the initial problem using Jeffs answer in the above link. However now I have noticed a new bug, upon page refresh it simply does not work. I have tried a hard refresh (ctrl+F5) but this does not work. However when you come page to the page it loads fine. here is my modified version (taken from Jeff's): <script type="text/javascript"> $(document).ready(function() { var imagesRemaining = $('#slideshow img').length; $('#slideshow img').bind('load', function(e) { imagesRemaining = imagesRemaining - 1; if (imagesRemaining == 0) { $('#slideshow').show(); $('#slideshow').cycle({ fx: 'shuffle', speed: 1200 }); } }); }); </script> Any ideas? I've also tried JQuery Live but could not implement it correctly. I've also tried Meta tags to force images to load. But it only works first time round.

    Read the article

  • WF performance with new 20,000 persisted workflow instances each month

    - by Nikola Stjelja
    Windows Workflow Foundation has a problem that is slow when doing WF instances persistace. I'm planning to do a project whose bussiness layer will be based on WF exposed WCF services. The project will have 20,000 new workflow instances created each month, each instance could take up to 2 months to finish. What I was lead to belive that given WF slownes when doing peristance my given problem would be unattainable given performance reasons. I have the following questions: Is this true? Will my performance be crap with that load(given WF persitance speed limitations) How can I solve the problem? We currently have two possible solutions: 1. Each new buisiness process request(e.g. Give me a new drivers license) will be a new WF instance, and the number of persistance operations will be limited by forwarding all status request operations to saved state values in a separate database. 2. Have only a small amount of Workflow Instances up at any give time, without any persistance ofso ever(only in case of system crashes etc.), by breaking each workflow stap in to a separate worklof and that workflow handling each business process request instance in the system that is at that current step(e.g. I'm submitting my driver license reques form, which is step one... we have 100 cases of that, and my step one workflow will handle every case simultaneusly). I'm very insterested in solution for that problem. If you want to discuss that problem pleas be free to mail me at [email protected]

    Read the article

  • Refactoring ADO.NET - SqlTransaction vs. TransactionScope

    - by marc_s
    I have "inherited" a little C# method that creates an ADO.NET SqlCommand object and loops over a list of items to be saved to the database (SQL Server 2005). Right now, the traditional SqlConnection/SqlCommand approach is used, and to make sure everything works, the two steps (delete old entries, then insert new ones) are wrapped into an ADO.NET SqlTransaction. using (SqlConnection _con = new SqlConnection(_connectionString)) { using (SqlTransaction _tran = _con.BeginTransaction()) { try { SqlCommand _deleteOld = new SqlCommand(......., _con); _deleteOld.Transaction = _tran; _deleteOld.Parameters.AddWithValue("@ID", 5); _con.Open(); _deleteOld.ExecuteNonQuery(); SqlCommand _insertCmd = new SqlCommand(......, _con); _insertCmd.Transaction = _tran; // add parameters to _insertCmd foreach (Item item in listOfItem) { _insertCmd.ExecuteNonQuery(); } _tran.Commit(); _con.Close(); } catch (Exception ex) { // log exception _tran.Rollback(); throw; } } } Now, I've been reading a lot about the .NET TransactionScope class lately, and I was wondering, what's the preferred approach here? Would I gain anything (readibility, speed, reliability) by switching to using using (TransactionScope _scope = new TransactionScope()) { using (SqlConnection _con = new SqlConnection(_connectionString)) { .... } _scope.Complete(); } What you would prefer, and why? Marc

    Read the article

  • Haskell Linear Algebra Matrix Library for Arbitrary Element Types

    - by Johannes Weiß
    I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

    Read the article

  • Direct invocation vs indirect invocation in C

    - by Mohit Deshpande
    I am new to C and I was reading about how pointers "point" to the address of another variable. So I have tried indirect invocation and direct invocation and received the same results (as any C/C++ developer could have predicted). This is what I did: int cost; int *cost_ptr; int main() { cost_ptr = &cost; //assign pointer to cost cost = 100; //intialize cost with a value printf("\nDirect Access: %d", cost); cost = 0; //reset the value *cost_ptr = 100; printf("\nIndirect Access: %d", *cost_ptr); //some code here return 0; //1 } So I am wondering if indirect invocation with pointers has any advantages over direct invocation or vice-versa. Some advantages/disadvantages could include speed, amount of memory consumed performing the operation (most likely the same but I just wanted to put that out there), safeness (like dangling pointers) , good programming practice, etc. 1Funny thing, I am using the GNU C Compiler (gcc) and it still compiles without the return statement and everything is as expected. Maybe because the C++ compiler will automatically insert the return statement if you forget.

    Read the article

  • Is it practical to program with your feet?

    - by bmm
    Has anyone tried using foot pedals in addition to the traditional keyboard and mouse combo to improve your effectiveness in the editor? Any actual experiences out there? Does it work, or is it just for carpal tunnel relief? I found one blog entry from a programmer who actually tried it: So now I can type using my feet for most of the modifier keys. I am using the pedals as I type this. I am still getting used to them, but the burning in my left wrist has definitely reduced. I think I can also type a little faster, but I am too lazy to do the speed tests with and without the pedals to verify this. On the negative side: Working out where to put your feet when you aren’t typing can be a little awkward. The pedals tend to move around the carpet, despite being metal and quite heavy. Some small spikes might have helped. Although the travel on the pedals is small, they are surprisingly stiff. Another programmer's experience: Anybody with hand pain must get foot pedals, since they can remove a tremendous load from your hands. I have two foot pedals, and use one for the SHIFT key, and the other for the CONTROL key. (I still type META by hand.) I have found that in the process of using the Emacs text editor to compose computer programs, I tend to use the SHIFT, CONTROL and META keys constantly, and it is easy to remove most of this load from one's hands. Some foot switch products: Savant Elite Triple Foot Switch FragPedal Bilbo Step On It!

    Read the article

  • jQuery image preload/cache halting browser

    - by Nathan Loding
    In short, I have a very large photo gallery and I'm trying to cache as many of the thumbnail images as I can when the first page loads. There could be 1000+ thumbnails. First question -- is it stupid to try to preload/cache that many? Second question -- when the preload() function fires, the entire browser stops responding for a minute to two. At which time the callback fires, so the preload is complete. Is there a way to accomplish "smart preloading" that doesn't impede on the user experience/speed when attempting to load this many objects? The $.preLoadImages function is take from here: http://binarykitten.me.uk/dev/jq-plugins/107-jquery-image-preloader-plus-callbacks.html Here's how I'm implementing it: $(document).ready(function() { setTimeout("preload()", 5000); }); function preload() { var images = ['image1.jpg', ... 'image1000.jpg']; $.preLoadImages(images, function() { alert('done'); }); } 1000 images is a lot. Am I asking too much?

    Read the article

  • Why do people say that Ruby is slow?

    - by stephen murdoch
    I like Ruby on Rails and I use it for all my web development projects. A few years ago there was a lot of talk about Rails being a memory hog and about how it didn't scale very well but these suggestions were put to bed by Gregg Pollack here. Lately though, I've been hearing people saying that Ruby itself is slow. Why is Ruby considered slow? I do not find Ruby to be slow but then again, I'm just using it to make simple CRUD apps and company blogs. What sort of projects would I need to be doing before I find Ruby becoming slow? Or is this slowness just something that affects all programming languages? What are your options as a Ruby programmer if you want to deal with this "slowness"? Which version of Ruby would best suit an application like Stack Overflow where speed is critical and traffic is intense? The questions are subjective, and I realise that architectural setup (EC2 vs standalone servers etc) makes a big difference but I'd like to hear what people think about Ruby being slow. Finally, I can't find much news on Ruby 2.0 - I take it we're a good few years away from that then?

    Read the article

  • Using prepared statements with JDBCTemplate

    - by Bernhard V
    Hi. I'm using the Jdbc template and want to read from the database using prepared statements. I iterate over many lines in a csv file and on every line I execute some sql select queries with it's values. Now I want to speed up my reading from the database but I just can't get the Jdbc template to work with prepared statements. Actually I even don't know how to do it. There is the PreparedStatementCreator and the PreparedStatementCreator. As in this example both of them are created with anonymous inner classes. But inside the PreparedStatementCreator class I don't have access to the values I want to set in the prepared statement. Since I'm iterating through a csv file I can't hard code them as a String because I don't know them. I also can't pass them to the PreparedStatementCreator because there are no arguments for the constructor. I was used to the creation of prepared statements being fairly simple. Something like PreparedStatement updateSales = con.prepareStatement( "UPDATE COFFEES SET SALES = ? WHERE COF_NAME LIKE ? "); updateSales.setInt(1, 75); updateSales.setString(2, "Colombian"); updateSales.executeUpdate(): as in the Java tutorial. Your help would be very appreciated.

    Read the article

  • What algorithms are suitable for this simple machine learning problem?

    - by user213060
    I have a what I think is a simple machine learning question. Here is the basic problem: I am repeatedly given a new object and a list of descriptions about the object. For example: new_object: 'bob' new_object_descriptions: ['tall','old','funny']. I then have to use some kind of machine learning to find previously handled objects that had similar descriptions, for example, past_similar_objects: ['frank','steve','joe']. Next, I have an algorithm that can directly measure whether these objects are indeed similar to bob, for example, correct_objects: ['steve','joe']. The classifier is then given this feedback training of successful matches. Then this loop repeats with a new object. a Here's the pseudo-code: Classifier=new_classifier() while True: new_object,new_object_descriptions = get_new_object_and_descriptions() past_similar_objects = Classifier.classify(new_object,new_object_descriptions) correct_objects = calc_successful_matches(new_object,past_similar_objects) Classifier.train_successful_matches(object,correct_objects) But, there are some stipulations that may limit what classifier can be used: There will be millions of objects put into this classifier so classification and training needs to scale well to millions of object types and still be fast. I believe this disqualifies something like a spam classifier that is optimal for just two types: spam or not spam. (Update: I could probably narrow this to thousands of objects instead of millions, if that is a problem.) Again, I prefer speed when millions of objects are being classified, over accuracy. What are decent, fast machine learning algorithms for this purpose?

    Read the article

  • Programmatically talking to a Serial Port in OS X or Linux

    - by deadprogrammer
    I have a Prolite LED sign that I like to set up to show scrolling search queries from a apache logs and other fun statistics. The problem is, my G5 does not have a serial port, so I have to use a usb to serial dongle. It shows up as /dev/cu.usbserial and /dev/tty.usbserial . When i do this everything seems to be hunky-dory: stty -f /dev/cu.usbserial speed 9600 baud; lflags: -icanon -isig -iexten -echo iflags: -icrnl -ixon -ixany -imaxbel -brkint oflags: -opost -onlcr -oxtabs cflags: cs8 -parenb Everything also works when I use the serial port tool to talk to it. If I run this piece of code while the above mentioned serial port tool, everthing also works. But as soon as I disconnect the tool the connection gets lost. #!/usr/bin/python import serial ser = serial.Serial('/dev/cu.usbserial', 9600, timeout=10) ser.write("<ID01><PA> \r\n") read_chars = ser.read(20) print read_chars ser.close() So the question is, what magicks do I need to perform to start talking to the serial port without the serial port tool? Is that a permissions problem? Also, what's the difference between /dev/cu.usbserial and /dev/tty.usbserial?

    Read the article

  • Why is the Clojure Hello World program so slow compared to Java and Python?

    - by viksit
    Hi all, I'm reading "Programming Clojure" and I was comparing some languages I use for some simple code. I noticed that the clojure implementations were the slowest in each case. For instance, Python - hello.py def hello_world(name): print "Hello, %s" % name hello_world("world") and result, $ time python hello.py Hello, world real 0m0.027s user 0m0.013s sys 0m0.014s Java - hello.java import java.io.*; public class hello { public static void hello_world(String name) { System.out.println("Hello, " + name); } public static void main(String[] args) { hello_world("world"); } } and result, $ time java hello Hello, world real 0m0.324s user 0m0.296s sys 0m0.065s and finally, Clojure - hellofun.clj (defn hello-world [username] (println (format "Hello, %s" username))) (hello-world "world") and results, $ time clj hellofun.clj Hello, world real 0m1.418s user 0m1.649s sys 0m0.154s Thats a whole, garangutan 1.4 seconds! Does anyone have pointers on what the cause of this could be? Is Clojure really that slow, or are there JVM tricks et al that need to be used in order to speed up execution? More importantly - isn't this huge difference in performance going to be an issue at some point? (I mean, lets say I was using Clojure for a production system - the gain I get in using lisp seems completely offset by the performance issues I can see here). The machine used here is a 2007 Macbook Pro running Snow Leopard, a 2.16Ghz Intel C2D and 2G DDR2 SDRAM. BTW, the clj script I'm using is from here and looks like, #!/bin/bash JAVA=/System/Library/Frameworks/JavaVM.framework/Versions/1.6/Home/bin/java CLJ_DIR=/opt/jars CLOJURE=$CLJ_DIR/clojure.jar CONTRIB=$CLJ_DIR/clojure-contrib.jar JLINE=$CLJ_DIR/jline-0.9.94.jar CP=$PWD:$CLOJURE:$JLINE:$CONTRIB # Add extra jars as specified by `.clojure` file if [ -f .clojure ] then CP=$CP:`cat .clojure` fi if [ -z "$1" ]; then $JAVA -server -cp $CP \ jline.ConsoleRunner clojure.lang.Repl else scriptname=$1 $JAVA -server -cp $CP clojure.main $scriptname -- $* fi

    Read the article

  • Embedded Vimeo Video Callbacks

    - by Andrew
    This post is kind of a follow up to a post I made earlier in regards to HTML5 video callbacks. In that thread, I was given a great piece of code that would allow for the browser to be informed of when the video stops playing and then fire off an action (with jQuery). This is the code I'm currently using: $('video.normal').bind('ended', function(){ $(this).fadeOut().queue(function(){ $(this).siblings('.post-video').fadeIn(); $(this).dequeue(); }); }); Which basically fades the video out when it's completed and brings a poster frame of the video (or similar image) back into view. Well, the scope of the project has changed and now the client is asking for true full screen video and different size videos to be delivered based on user connection speed, something that's a little over my head and a lot over budget. So I've been researching and a Vimeo Plus player seems like a great alternative for visitors using a desktop browser (HD embeds, true full screen, and more). Thing is, I need that above code to continue working in some capacity or another, so does the embedded Vimeo player offer a similar callback that I can utilize? Or am I SOL here? Thanks in advance!

    Read the article

  • Serialization Performance and Google Android

    - by Jomanscool2
    I'm looking for advice to speed up serialization performance, specifically when using the Google Android. For a project I am working on, I am trying to relay a couple hundred objects from a server to the Android app, and am going through various stages to get the performance I need. First I tried a terrible XML parser that I hacked together using Scanner specifically for this project, and that caused unbelievably slow performance when loading the objects (~5 minutes for a 300KB file). I then moved away from that and made my classes implement Serializable and wrote the ArrayList of objects I had to a file. Reading that file into the objects the Android, with the file already downloaded mind you, was taking ~15-30 seconds for the ~100KB serialized file. I still find this completely unacceptable for an Android app, as my app requires loading the data when starting the application. I have read briefly about Externalizable and how it can increase performance, but I am not sure as to how one implements it with nested classes. Right now, I am trying to store an ArrayList of the following class, with the nested classes below it. public class MealMenu implements Serializable{ private String commonsName; private long startMillis, endMillis, modMillis; private ArrayList<Venue> venues; private String mealName; } And the Venue class: public class Venue implements Serializable{ private String name; private ArrayList<FoodItem> foodItems; } And the FoodItem class: public class FoodItem implements Serializable{ private String name; private boolean vegan; private boolean vegetarian; } IF Externalizable is the way to go to increase performance, is there any information as to how java calls the methods in the objects when you try to write it out? I am not sure if I need to implement it in the parent class, nor how I would go about serializing the nested objects within each object.

    Read the article

  • (solved) jQuery click and drag/scroll window: jagged movement

    - by Josh
    Edit: derp, using pageX/Y instead of clientX/Y -- apparently scrollBy expects input with that offset rather than the other. Jaggy movement gone. I am getting jagged movement when doing small scroll increments using the following bindings. Can anyone point me in the right direction for how to smooth this out? FYI, its intermittent. It seems like, if I click and hold for a second, then drag at a decent speed there are no problems. Edit: What the hell? I get this output on debug... obvious jog backwards and forwards. This will happen in succession and seems to have no correlation with the mouse, other than the mouse is moving. x 398 : 403 y 374 : 377 x 403 : 399 y 377 : 374 x 399 : 404 y 374 : 377 Josh sococo.client.panMap = function(e){ e.preventDefault(); var movex = sococo.client.currX - e.pageX ; var movey = sococo.client.currY - e.pageY; console.log( sococo.client.currX +" : " + e.pageX ); window.scrollBy(movex,movey); sococo.client.currY = e.pageY; sococo.client.currX = e.pageX; } $(document).mousedown( function(e){ e.preventDefault(); sococo.client.currX = e.pageX; sococo.client.currY = e.pageY; $(document).bind( "mousemove", sococo.client.panMap ); }); $(document).mouseup( function(e){ e.preventDefault(); $(document).unbind( "mousemove", sococo.client.panMap ); });

    Read the article

  • web browser become slow or no response after several ajax calls

    - by Patrick
    I'm totally newbie to jquery and ajax, my recently project is to help the representatives (reps) to manage customer quotations online. I have a page which displays all the quotations in a big table. I've managed to use ajax to fetch and display the quotations which associate to a particular rep after i click that rep's name. But the only problem is the speed of response. The first few clicks are ok and very smooth. But after several tries, the response become slow and I cant even scroll down the webpage, and later on the web browser craches.... Please have a look at my ajax code. here it is: <!-- AJAX FETCH QUOTES DATA + Tablesorter + FIXED TABLE HEADER--> <script type="text/javascript"> //<![CDATA[ $(function(){ $("a.repID").click(function(){ $('div#loader').append("<p align='center'><img src='images/loadingbar2.gif' id='loading' /></p>"); var repID = $(this).attr("title"); $.ajax({ type:'POST', url:'quote_info.php', data:'repID=' + repID, cache: false, success:function(data) { $("#container").html('<div id="content">' + data + '</div>'); $("#loading").fadeOut(500, function() {$(this).remove();}); $("#sortme").tablesorter(); $('.tbl').fixedtableheader(); } }); return false; }); }); </script> <!-- AJAX FETCH QUOTES DATA + Tablesorter + FIXED TABLE HEADER-->

    Read the article

  • Javascript won't execute in iPhone Safari

    - by Stuart Meyer
    I'm running into this issue only because I recently purchased an iPhone. The javascript for a picture carousel on my website (http://www.stuartmeyerphotography.com) won't execute in Safari for iPhone. I thought it worked on Mac Safari last I checked with a friend who had a Mac (a year ago), but now I need to go back and check that too to make sure it works on the Mac. "View source" on my website would show the entire html page, but I've pulled the code from the body section to show here: carousel({id:'Photos', border:'', size_mode:'image', width:120, height:120, sides:8, steps:75, speed:4, direction:'left', images:['mainthumbs/babiesthumb.jpg','mainthumbs/engagementsthumb.jpg','mainthumbs/dancethumb1.jpg','mainthumbs/artistthumb.jpg','mainthumbs/portraitsthumb1.jpg','mainthumbs/seniorsthumb1.jpg','mainthumbs/wedthumb1.jpg'], links:['babies/babies.html','engagements/engagemainshow/engagementpictures.html','dance/dancepictures.html','artists/artists.html','portraits/portraits.html','seniors/highschoolseniors.html','weddings/weddings.html'], lnk_base:'', lnk_targets:['_iframe1', '_iframe1', '_iframe1', '_iframe1', '_iframe1', '_iframe1', '_iframe1' ], lnk_attr:['width=200,height=300,top=200,menubar=yes', 'width=300,height=200,left=400,scrollbars=yes', 'width=150,height=250,left=200,top=100', ''], titles:['Babies', 'Engagements', 'Dance', 'Artists', 'Portraits', 'HS Seniors', 'Weddings'], image_border_width:1, image_border_color:'#E3F0A1' });   </div> Any thoughts? -Stuart

    Read the article

  • Best and easiest algorithm to search for a vertex on a Graph?

    - by Nazgulled
    Hi, After implementing most of the common and needed functions for my Graph implementation, I realized that a couple of functions (remove vertex, search vertex and get vertex) don't have the "best" implementation. I'm using adjacency lists with linked lists for my Graph implementation and I was searching one vertex after the other until it finds the one I want. Like I said, I realized I was not using the "best" implementation. I can have 10000 vertices and need to search for the last one, but that vertex could have a link to the first one, which would speed up things considerably. But that's just an hypothetical case, it may or may not happen. So, what algorithm do you recommend for search lookup? Our teachers talked about Breadth-first and Depth-first mostly (and Dikjstra' algorithm, but that's a completely different subject). Between those two, which one do you recommend? It would be perfect if I could implement both but I don't have time for that, I need to pick up one and implement it has the first phase deadline is approaching... My guess, is to go with Depth-first, seems easier to implement and looking at the way they work, it seems a best bet. But that really depends on the input. But what do you guys suggest?

    Read the article

  • Fast JSON serialization (and comparison with Pickle) for cluster computing in Python?

    - by user248237
    I have a set of data points, each described by a dictionary. The processing of each data point is independent and I submit each one as a separate job to a cluster. Each data point has a unique name, and my cluster submission wrapper simply calls a script that takes a data point's name and a file describing all the data points. That script then accesses the data point from the file and performs the computation. Since each job has to load the set of all points only to retrieve the point to be run, I wanted to optimize this step by serializing the file describing the set of points into an easily retrievable format. I tried using JSONpickle, using the following method, to serialize a dictionary describing all the data points to file: def json_serialize(obj, filename, use_jsonpickle=True): f = open(filename, 'w') if use_jsonpickle: import jsonpickle json_obj = jsonpickle.encode(obj) f.write(json_obj) else: simplejson.dump(obj, f, indent=1) f.close() The dictionary contains very simple objects (lists, strings, floats, etc.) and has a total of 54,000 keys. The json file is ~20 Megabytes in size. It takes ~20 seconds to load this file into memory, which seems very slow to me. I switched to using pickle with the same exact object, and found that it generates a file that's about 7.8 megabytes in size, and can be loaded in ~1-2 seconds. This is a significant improvement, but it still seems like loading of a small object (less than 100,000 entries) should be faster. Aside from that, pickle is not human readable, which was the big advantage of JSON for me. Is there a way to use JSON to get similar or better speed ups? If not, do you have other ideas on structuring this? (Is the right solution to simply "slice" the file describing each event into a separate file and pass that on to the script that runs a data point in a cluster job? It seems like that could lead to a proliferation of files). thanks.

    Read the article

  • How to preload images using jquery for carousel?

    - by Pandiya Chendur
    I used jquery stepcarousel plugin and it works fine... But how to preload images that is used by the plugin... I am using this, <div id="mygallery" class="stepcarousel"> <div class="belt"> <div class="panel"> <img src="Images/img1.jpg" /> </div> <div class="panel"> <img src="Images/img2.jpg" /> </div> </div> </div> <script type="text/javascript"> stepcarousel.setup({ galleryid: 'mygallery', //id of carousel DIV beltclass: 'belt', //class of inner "belt" DIV containing all the panel DIVs panelclass: 'panel', //class of panel DIVs each holding content autostep: { enable: true, moveby: 1, pause: 3000 }, panelbehavior: { speed: 500, wraparound: false, persist: true }, defaultbuttons: { enable: true, moveby: 1, leftnav: ['Images/lft_arrow.jpg', -5, 220], rightnav: ['Images/rit_arrow.jpg', -5, 220] }, statusvars: ['statusA', 'statusB', 'statusC'], //register 3 variables that contain current panel (start), current panel (last), and total panels contenttype: ['inline'] //content setting ['inline'] or ['ajax', 'path_to_external_file'] }) </script> How to preload images used by mygallery div such that i can avoid flickering.....

    Read the article

< Previous Page | 208 209 210 211 212 213 214 215 216 217 218 219  | Next Page >