Search Results

Search found 27296 results on 1092 pages for 'desktop search'.

Page 221/1092 | < Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >

  • Why is Article Marketing One of the Best Search Engine Optimization Techniques?

    Search engine optimization is a tool that is used in order to help people to improve the rankings of their website when it comes to different search results on the Internet. The better your search engine organisation, the more likely it will be that you will generate much higher streams of traffic to your website, and therefore you will be able to achieve more sales, and therefore more wealth. When it comes to SEO techniques that you might consider using there are loads of ways of going about this.

    Read the article

  • Snowfall application with Windows 7 compatibility

    - by Shiki
    Okay, this may seem to be a strange question. I'm searching for a 'snowfall application'. Back then we had a lot of like this.. in the old ages, when XP came out, so on. Nowadays, I can't find a single working one. It's not like I suddenly want something like this, but a girl asked me whethers its possible or not. IMHO its possible but... Please help me out. =) (Obviously, free software shareware.)

    Read the article

  • Remote Linux system via Windows 7

    - by kaila
    I have a dual boot with Windows 7 and Fedora. Though I can long into both without any problems, I am trying to log in to the linux account via the Windows account. Is that possible? Or, is it possible to access my university's linux server via telnet from home? I did so and got an error, with cold not connect to port 23 message. Also, since most of my mail accounts are on Windows, the passwords to which I have forgotten, I would prefer working on a ;remote' connection.

    Read the article

  • Is there a way to make Windows 8 delay loading the start screen until all startup programs have loaded?

    - by user1403565
    Currently Windows 8 will get to the start screen a good 10-15 seconds before my startup programs have loaded. Since these include my touchpad driver as well as a gamma correction program, I would prefer that they would load before this point. Is there anyway to do this - either by delaying Windows 8 showing the start screen, or perhaps by somehow having these programs run before reaching the login screen?

    Read the article

  • Skype mettra fin à Desktop API en décembre 2013, les développeurs se réunissent pour demander un sursis

    Skype mettra fin à Desktop API en décembre 2013, les développeurs se réunissent pour demander un sursis Suite à l'annonce faite par Microsoft d'abandonner la Desktop API de Skype en décembre, les développeurs se mobilisent pour tenter d'inverser cette décision. Pour ce faire, une pétition a été lancée via le site change.org. L'objectif est de récolté 9 320 voix mais avec les 680 participations enregistrées à l'heure actuelle il leur reste encore beaucoup de chemin à parcourir. Cet avertissement...

    Read the article

  • RDC stops working after a period of time.

    - by xjerx
    I have a workstation with RDC configured for the employee. When they leave at the end of their day they lock the pc (windows key + l). They go home connect to our VPN and log back in. Everything works fine. The following morning they will attempt to log in before they return to the office. The computer does not respond to the RDC request. I've found that it becomes completely inactive to any ICMP requests. Once the user reboots the computer everything works fine again. I'm going to turn off RDC, reboot, turn RDC back on and reboot again to see if it fixes the problem. Until then does anyone have any other ideas?

    Read the article

  • Xcode newb -- #include can't find my file

    - by morgancodes
    I'm trying to get a third party audio library (STK) working inside Xcode. Along with the standard .h files, many of the implementation files include a file called SKINI.msg. SKINI.msg is in the same directory as all of the header files. The header files are getting included fine, but the compiler complains that it can't find SKINI.msg. What do I need to do to get Xcode to happily include SKINI.msg? Edit: Here's the contents of SKINI.msg: /*********************************************************/ /* Definition of SKINI Message Types and Special Symbols Synthesis toolKit Instrument Network Interface These symbols should have the form: \c __SK_<name>_ where <name> is the string used in the SKINI stream. by Perry R. Cook, 1995 - 2010. */ /*********************************************************/ namespace stk { #define NOPE -32767 #define YEP 1 #define SK_DBL -32766 #define SK_INT -32765 #define SK_STR -32764 #define __SK_Exit_ 999 /***** MIDI COMPATIBLE MESSAGES *****/ /*** (Status bytes for channel=0) ***/ #define __SK_NoteOff_ 128 #define __SK_NoteOn_ 144 #define __SK_PolyPressure_ 160 #define __SK_ControlChange_ 176 #define __SK_ProgramChange_ 192 #define __SK_AfterTouch_ 208 #define __SK_ChannelPressure_ __SK_AfterTouch_ #define __SK_PitchWheel_ 224 #define __SK_PitchBend_ __SK_PitchWheel_ #define __SK_PitchChange_ 49 #define __SK_Clock_ 248 #define __SK_SongStart_ 250 #define __SK_Continue_ 251 #define __SK_SongStop_ 252 #define __SK_ActiveSensing_ 254 #define __SK_SystemReset_ 255 #define __SK_Volume_ 7 #define __SK_ModWheel_ 1 #define __SK_Modulation_ __SK_ModWheel_ #define __SK_Breath_ 2 #define __SK_FootControl_ 4 #define __SK_Portamento_ 65 #define __SK_Balance_ 8 #define __SK_Pan_ 10 #define __SK_Sustain_ 64 #define __SK_Damper_ __SK_Sustain_ #define __SK_Expression_ 11 #define __SK_AfterTouch_Cont_ 128 #define __SK_ModFrequency_ __SK_Expression_ #define __SK_ProphesyRibbon_ 16 #define __SK_ProphesyWheelUp_ 2 #define __SK_ProphesyWheelDown_ 3 #define __SK_ProphesyPedal_ 18 #define __SK_ProphesyKnob1_ 21 #define __SK_ProphesyKnob2_ 22 /*** Instrument Family Specific ***/ #define __SK_NoiseLevel_ __SK_FootControl_ #define __SK_PickPosition_ __SK_FootControl_ #define __SK_StringDamping_ __SK_Expression_ #define __SK_StringDetune_ __SK_ModWheel_ #define __SK_BodySize_ __SK_Breath_ #define __SK_BowPressure_ __SK_Breath_ #define __SK_BowPosition_ __SK_PickPosition_ #define __SK_BowBeta_ __SK_BowPosition_ #define __SK_ReedStiffness_ __SK_Breath_ #define __SK_ReedRestPos_ __SK_FootControl_ #define __SK_FluteEmbouchure_ __SK_Breath_ #define __SK_JetDelay_ __SK_FluteEmbouchure_ #define __SK_LipTension_ __SK_Breath_ #define __SK_SlideLength_ __SK_FootControl_ #define __SK_StrikePosition_ __SK_PickPosition_ #define __SK_StickHardness_ __SK_Breath_ #define __SK_TrillDepth_ 1051 #define __SK_TrillSpeed_ 1052 #define __SK_StrumSpeed_ __SK_TrillSpeed_ #define __SK_RollSpeed_ __SK_TrillSpeed_ #define __SK_FilterQ_ __SK_Breath_ #define __SK_FilterFreq_ 1062 #define __SK_FilterSweepRate_ __SK_FootControl_ #define __SK_ShakerInst_ 1071 #define __SK_ShakerEnergy_ __SK_Breath_ #define __SK_ShakerDamping_ __SK_ModFrequency_ #define __SK_ShakerNumObjects_ __SK_FootControl_ #define __SK_Strumming_ 1090 #define __SK_NotStrumming_ 1091 #define __SK_Trilling_ 1092 #define __SK_NotTrilling_ 1093 #define __SK_Rolling_ __SK_Strumming_ #define __SK_NotRolling_ __SK_NotStrumming_ #define __SK_PlayerSkill_ 2001 #define __SK_Chord_ 2002 #define __SK_ChordOff_ 2003 #define __SK_SINGER_FilePath_ 3000 #define __SK_SINGER_Frequency_ 3001 #define __SK_SINGER_NoteName_ 3002 #define __SK_SINGER_Shape_ 3003 #define __SK_SINGER_Glot_ 3004 #define __SK_SINGER_VoicedUnVoiced_ 3005 #define __SK_SINGER_Synthesize_ 3006 #define __SK_SINGER_Silence_ 3007 #define __SK_SINGER_VibratoAmt_ __SK_ModWheel_ #define __SK_SINGER_RndVibAmt_ 3008 #define __SK_SINGER_VibFreq_ __SK_Expression_ } // stk namespace And here's what the compiler said: CompileC build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/Objects-normal/i386/BandedWG.o "../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp" normal i386 c++ com.apple.compilers.gcc.4_2 cd /Users/morganpackard/Desktop/trashme/StkCompile setenv LANG en_US.US-ASCII setenv PATH "/Developer/Platforms/iPhoneSimulator.platform/Developer/usr/bin:/Developer/usr/bin:/usr/bin:/bin:/usr/sbin:/sbin" /Developer/Platforms/iPhoneSimulator.platform/Developer/usr/bin/gcc-4.2 -x c++ -arch i386 -fmessage-length=0 -pipe -Wno-trigraphs -fpascal-strings -fasm-blocks -O0 -Wreturn-type -Wunused-variable -D__IPHONE_OS_VERSION_MIN_REQUIRED=30000 -isysroot /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.2.sdk -fvisibility=hidden -fvisibility-inlines-hidden -mmacosx-version-min=10.5 -gdwarf-2 -iquote /Users/morganpackard/Desktop/trashme/StkCompile/build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/StkCompile-generated-files.hmap -I/Users/morganpackard/Desktop/trashme/StkCompile/build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/StkCompile-own-target-headers.hmap -I/Users/morganpackard/Desktop/trashme/StkCompile/build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/StkCompile-all-target-headers.hmap -iquote /Users/morganpackard/Desktop/trashme/StkCompile/build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/StkCompile-project-headers.hmap -F/Users/morganpackard/Desktop/trashme/StkCompile/build/Debug-iphonesimulator -I/Users/morganpackard/Desktop/trashme/StkCompile/build/Debug-iphonesimulator/include -I/Users/morganpackard/Desktop/trashme/StkCompile/build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/DerivedSources/i386 -I/Users/morganpackard/Desktop/trashme/StkCompile/build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/DerivedSources -include /var/folders/dx/dxSUSyOJFv0MBEh9qC1oJ++++TI/-Caches-/com.apple.Xcode.501/SharedPrecompiledHeaders/StkCompile_Prefix-bopqzvwpuyqltrdumgtjtfrjvtzb/StkCompile_Prefix.pch -c "/Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp" -o /Users/morganpackard/Desktop/trashme/StkCompile/build/StkCompile.build/Debug-iphonesimulator/StkCompile.build/Objects-normal/i386/BandedWG.o /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:33:21: error: SKINI.msg: No such file or directory /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp: In member function 'virtual void stk::BandedWG::controlChange(int, stk::StkFloat)': /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:326: error: '__SK_BowPressure_' was not declared in this scope /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:342: error: '__SK_AfterTouch_Cont_' was not declared in this scope /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:349: error: '__SK_ModWheel_' was not declared in this scope /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:357: error: '__SK_ModFrequency_' was not declared in this scope /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:359: error: '__SK_Sustain_' was not declared in this scope /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:363: error: '__SK_Portamento_' was not declared in this scope /Users/morganpackard/Desktop/trashme/StkCompile/../../../Data/study/iPhone class/stk-4.4.2/src/BandedWG.cpp:367: error: '__SK_ProphesyRibbon_' was not declared in this scope

    Read the article

  • Parsing a Directory of files - Check for a String

    - by i.h4d35
    This is my first post here so kindly pardon any mistakes that I have. I'm still learning to find my way around Stack Exchange. I am trying to write a Java program that tries to scan a Directory full of either .txt,.rtf or.doc files(and none other). The aim is to search all the files in the directory, and find out if a particular string exists in the file. If it does, it returns the string and the filename that it found the string in. The aim of this program is, it is a project for school wherein the program scans the personal folders of call center employees to check if they have stored any CC/DC nos and if yes, report the folder name - to reduce CC fraud. The search function was fairly straight forward and works when I individually specify the filename. However, the searching the directory and passing the files to the search function has me stumped. I've posted my code so far, if you guys could look thru it and give me some feedback/suggestions, I'd really appreciate it. Thanks in advance import java.io.*; import java.util.*; public class parse2{ void traverse(String directory) throws FileNotFoundException { File dir = new File(directory); if (dir.isDirectory()) { String[] children = dir.list(); for (int i=0; i<children.length; i++) { //System.out.println("\n" + children[i]); reader(children[i]); } } } void reader(String loc) throws FileNotFoundException { FileReader fr = new FileReader(loc); BufferedReader br = new BufferedReader(fr); Scanner sc = new Scanner(br); char[] chkArray; int chk=1; char ch; while(sc.hasNext()) { String chkStr = sc.next(); chkArray = chkStr.toCharArray(); if ((chkArray[0]=='4')&&(chkStr.length()>13)) { for(int i=0;i<chkArray.length;i++) { ch=chkArray[i]; if((ch=='0')||(ch=='1')||(ch=='2')||(ch=='3')||(ch=='4')||(ch=='5')||(ch=='6')||(ch=='7')||(ch=='8')||(ch=='9')) { chk=0; continue; } else { chk=1; break; } } if(chk==0) System.out.println("\n"+ chkStr); } else if((chkArray[0]=='5')&&(chkStr.length()>13)) { for(int i=0;i<chkArray.length;i++) { ch=chkArray[i]; if((ch=='0')||(ch=='1')||(ch=='2')||(ch=='3')||(ch=='4')||(ch=='5')||(ch=='6')||(ch=='7')||(ch=='8')||(ch=='9')) { chk=0; continue; } else { chk=1; break; } } if(chk==0) System.out.println("\n"+ chkStr); } else if((chkArray[0]=='6')&&(chkStr.length()>13)) { for(int i=0;i<chkArray.length;i++) { ch=chkArray[i]; if((ch=='0')||(ch=='1')||(ch=='2')||(ch=='3')||(ch=='4')||(ch=='5')||(ch=='6')||(ch=='7')||(ch=='8')||(ch=='9')) { chk=0; continue; } else { chk=1; break; } } if(chk==0) System.out.println("\n"+ chkStr); } } } public static void main(String args[]) throws FileNotFoundException { parse2 P = new parse2(); P.traverse("C:/Documents and Settings/h4d35/Desktop/javatest/chk"); } }

    Read the article

  • BFS Shortest Path: Edge weight either 1 or 2

    - by Hackster
    I am trying to implement a shortest path algorithm using BFS. That is I am trying to find the shortest path from a specified vertex to every other vertex. However, its a special case where all edge weights are either 1 or 2. I know it could be done with Dijkstra's algorithm but I must use Breadth First Search. So far I have a working version of BFS that searches first for a vertex connected with an edge of weight 1. If it cannot find it, then returns a vertex connected with an edge of weight 2. After thinking about it, this is not the correct way to find the shortest path. The problem is I cannot think of any reasoning why BFS would work with weights 1 or 2, as opposed to any weight. Here is the code: public void addEdge(int start, int end, int weight) { adjMat[start][end] = 1; adjMat[end][start] = 1; edge_weight[start][end] = weight; edge_weight[end][start] = weight; } // ------------------------------------------------------------- public void bfs() // breadth-first search { // begin at vertex 0 vertexList[0].wasVisited = true; // mark it displayVertex(0); // display it theQueue.insert(0); // insert at tail int v2; while( !theQueue.isEmpty() ) // until queue empty, { int v1 = theQueue.remove(); // remove vertex at head // until it has no unvisited neighbors while( (v2=getAdjUnvisitedVertex(v1)) != -1 ){// get one, vertexList[v2].wasVisited = true; // mark it displayVertex(v2); // display it theQueue.insert(v2); // insert it } } // end while(queue not empty) // queue is empty, so we're done for(int j=0; j<nVerts; j++) // reset flags vertexList[j].wasVisited = false; } // end bfs() // ------------------------------------------------------------- // returns an unvisited vertex adj to v -- ****WITH WEIGHT 1**** public int getAdjUnvisitedVertex(int v) { for (int j = 0; j < nVerts; j++) if (adjMat[v][j] == 1 && vertexList[j].wasVisited == false && edge_weight[v][j] == 1){ //System.out.println("Vertex found with 1:"+ vertexList[j].label); return j; } for (int k = 0; k < nVerts; k++) if (adjMat[v][k] == 1 && vertexList[k].wasVisited == false && edge_weight[v][k] == 2){ //System.out.println("Vertex found with 2:"+vertexList[k].label); return k; } return -1; } // end getAdjUnvisitedVertex() // ------------------------------------------------------------- } //////////////////////////////////////////////////////////////// public class BFS{ public static void main(String[] args) { Graph theGraph = new Graph(); theGraph.addVertex('A'); // 0 (start for bfs) theGraph.addVertex('B'); // 1 theGraph.addVertex('C'); // 2 theGraph.addEdge(0, 1,2); // AB theGraph.addEdge(1, 2,1); // BC theGraph.addEdge(2, 0,1); // AD System.out.print("Visits: "); theGraph.bfs(); // breadth-first search System.out.println(); } // end main() } The problem then is, that I don't know why BFS can work for the shortest path problem with edges of weight 1 or 2 as opposed to any edges of any weight. Any help is appreciated. Thanks!

    Read the article

  • grep --exclude/--include syntax (do not grep through certain files)

    - by Piskvor
    I'm looking for the string "foo=" (without quotes) in text files in a directory tree. It's on a common Linux machine, I have bash shell: grep -ircl "foo=" * In the directories are also many binary files which match "foo=". As these results are not relevant and slow down the search, I want grep to skip searching these files (mostly JPEG and PNG images): how would I do that? I know there are the --exclude=PATTERN and --include=PATTERN options, but what is the pattern format? manpage of grep says: --include=PATTERN Recurse in directories only searching file matching PATTERN. --exclude=PATTERN Recurse in directories skip file matching PATTERN. Searching on grep include, grep include exclude, grep exclude and variants did not find anything relevant If there's a better way of grepping only in certain files, I'm all for it; moving the offending files is not an option, I can't search only certain directories (the directory structure is a big mess, with everything everywhere). Also, I can't install anything, so I have to do with common tools (like grep or the suggested find). UPDATES: @Adam Rosenfield's answer is just what I was looking for: grep -ircl --exclude=*.{png,jpg} "foo=" * @rmeador's answer is also a good solution: grep -Ir --exclude="*\.svn*" "pattern" * It searches recursively, ignores binary files, and doesn't look inside Subversion hidden folders.(...)

    Read the article

  • Javascript/Greasemonkey: search for something then set result as a value

    - by thewinchester
    Ok, I'm a bit of a n00b when it comes to JS (I'm not the greatest programmer) so please be gentle - specially if my questions been asked already somewhere and I'm too stupid to find the right answer. Self deprecation out of the way, let's get to the question. Problem There is a site me and a large group of friends frequently use which doesn't display all the information we may like to know - in this case an airline bookings site and the class of travel. While the information is buried in the code of the page, it isn't displayed anywhere to the user. Using a Greasemonkey script, I'd like to liberate this piece of information and display it in a suitable format. Here's the psuedocode of what I'm looking to do. Search dom for specified element define variables Find a string of text If found Set result to a variable Write contents to page at a specific location (before a specified div) If not found Do nothing I think I've achieved most of it so far, except for the key bits of: Searching for the string: The page needs to search for the following piece of text in the page HEAD: mileageRequest += "&CLASSES=S,S-S,S-S"; The Content I need to extract and store is between the second equals (=) sign and the last comma ("). The contents of this area can be any letter between A-Z. I'm not fussed about splitting it up into an array so I could use the elements individually at this stage. Writing the result to a location: Taking that found piece of text and writing it to another location. Code so far This is what I've come up so far, with bits missing highlighted. buttons = document.getElementById('buttons'); ''Search goes here var flightClasses = document.createElement("div"); flightClasses.innerHTML = '<div id="flightClasses"> ' + '<h2>Travel classes</h2>' + 'For the above segments, your flight classes are as follows:' + 'write result here' + '</div>'; main.parentNode.insertBefore(flightClasses, buttons); If anyone could help me, or point me in the right direction to finish this off I'd appreciate it.

    Read the article

  • Emacs recursive project search

    - by hekevintran
    I am switching to Emacs from TextMate. One feature of TextMate that I would really like to have in Emacs is the "Find in Project" search box that uses fuzzy matching. Emacs sort of has this with ido, but ido does not search recursively through child directories. It searches only within one directory. Is there a way to give ido a root directory and to search everything under it? Update: The questions below pertain to find-file-in-project.el from Michal Marczyk's answer. If anything in this message sounds obvious it's because I have used Emacs for less than one week. :-) As I understand it, project-local-variables lets me define things in a .emacs-project file that I keep in my project root. How do I point find-file-in-project to my project root? I am not familiar with regex syntax in Emacs Lisp. The default value for ffip-regexp is: ".*\\.\\(rb\\|js\\|css\\|yml\\|yaml\\|rhtml\\|erb\\|html\\|el\\)" I presume that I can just switch the extensions to the ones appropriate for my project. Could you explain the ffip-find-options? From the file: (defvar ffip-find-options "" "Extra options to pass to `find' when using find-file-in-project. Use this to exclude portions of your project: \"-not -regex \\".vendor.\\"\"") What does this mean exactly and how do I use it to exclude files/directories? Could you share an example .emacs-project file?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Open Source Mozilla Prism Alternative

    - by Patrick Klingemann
    Here is what I want to do, very simply: I want to put a URL into a Mozilla Prism (or some alternative), then be provided with an icon on my desktop that when I click it a window opens and the page is displayed. The process for this instance of Prism should be completely independent of any other Prism "applications" that are running. Prism looks like it does this exactly, but I'm running Fedora 12 x86_64 and I can't get it to work, so I'm wondering if there are any alternatives to Prism.

    Read the article

  • How to sort linq result by most similarity/equality

    - by aNui
    I want to do a search for Music instruments which has its informations Name, Category and Origin as I asked in my post. But now I want to sort/group the result by similarity/equality to the keyword such as. If I have the list { Drum, Grand Piano, Guitar, Guitarrón, Harp, Piano} << sorted by name and if I queried "p" the result should be { Piano, Grand Piano, Harp } but it shows Harp first because of the source list's sequence and if I add {Grand Piano} to the list and query "piano" the result shoud be like { Piano, Grand Piano } or query "guitar" it should be { Guitar, Guitarrón } here's my code static IEnumerable<MInstrument> InstrumentsSearch(IEnumerable<MInstrument> InstrumentsList, string query, MInstrument.Category[] SelectedCategories, MInstrument.Origin[] SelectedOrigins) { var result = InstrumentsList .Where(item => SelectedCategories.Contains(item.category)) .Where(item => SelectedOrigins.Contains(item.origin)) .Where(item => { if ( (" " + item.Name.ToLower()).Contains(" " + query.ToLower()) || item.Name.IndexOf(query) != -1 ) { return true; } return false; } ) .Take(30); return result.ToList<MInstrument>(); } Or the result may be like my old self-invented algorithm that I called "by order of occurence", that is just OK to me. And the further things to do is I need to search the Name, Category or Origin such as. If i type "Italy" it should found Piano or something from Italy. Or if I type "string" it should found Guitar. Is there any way to do those things, please tell me. Thanks in advance.

    Read the article

  • Timeout reading verity collection - CF8

    - by Gary
    For a long time now I've been having a problem with using the verity search service bundled with ColdFusion 8. The issue is with timeout errors occurring when perfoming any operation on a collection. It's intermittent, and usually occurs after a few operations have been successfully performed. For instance: If I'm adding records to a collection the first, say 15 records, will go through with no problems, but all subsequent records will timeout until the service is rebooted. I'm on a shared server, Windows 2008, 64bit as far as I know. The error I receive is: "An error occurred while performing an operation in the Search Engine library. Error reading collection information.: com.verity.api.administration.ConfigurationException: java.io.IOException: Read timed out" Having spoken to my hosting company, and after doing some research, it's been suggested that the number of collections on a server may cause this issue. I've reduced the amount of collections I use, and there are currently 39 collections on the server. As I'm on a shared server, I have no control over how many collections other customers use, however I've read that the limit is 128 collections, so I don't see why 39 should cause it to become unusable. The collections aren't big, there's maybe around 5,000 records between all of them. Any ideas?

    Read the article

  • Creating an AJAX Searchable Database.

    - by Austin
    Currently I am using MySQLi to parse a CSV file into a Database, that step has been accomplished. However, My next step would be to make this Database searchable and automatically updated via jQuery.ajax(). Some people suggest that I print out the Database in another page and access it externally. I'm quite new to jquery + ajax so if anyone could point me in the right direction that would be greatly appreciated. I understand that the documentation on ajax should be enough to tell me what I'm looking for but it appears to talk only about retrieving data from an external file, what about from a mysql database? The code so far stands: <head> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> </head> <body> <input type="text" id="search" name="search" /> <input type="submit" value="submit"> <?php show_source(__FILE__); error_reporting(E_ALL);ini_set('display_errors', '1'); $category = NULL; $mc = new Memcache; $mc->addServer('localhost','11211'); $sql = new mysqli('localhost', 'user', 'pword', 'db'); $cache = $mc->get("updated_DB"); $query = 'SELECT cat,name,web,kw FROM infoDB WHERE cat LIKE ? OR name LIKE ? OR web LIKE ? OR kw LIKE ?'; $results = $sql->prepare($query); $results->bind_param('ssss', $query, $query, $query, $query); $results->execute(); $results->store_result(); ?> </body> </html>

    Read the article

  • Is it possible to search locally in jqGrid with treeGrid installed

    - by Nehu
    I am using jqGrid with treeGrid. I have added a filterToolbar. I would like to search locally instead of having a server call. The treegrid docs say that, "When we initialize the grid and the data is read, the datatype is automatically set to local." So, is it possible to implement local search with treeGrid. I tried the below configuration, but it is resulting in server calls. My Configuration is var grid = $("#grid").jqGrid({ treeGrid: true, treeGridModel: 'adjacency', ExpandColumn: 'businessAreaName', ExpandColClick : true, url:'agileProgramme/records.do', datatype: 'json', mtype: 'GET', colNames:['Id' , 'Business Area' , 'Investment' , 'Org' , 'Goal' ], colModel:[ /*00*/ {name:'agileProgrammeId',index:'agileProgrammeId', width:0, editable:false,hidden:true}, /*01*/ {name:'businessAreaName',index:'businessAreaName', width:160, editable:false}, /*02*/ {name:'programmeName',index:'programmeName', width:150, editable:false, classes:'link'}, /*03*/ {name:'org',index:'org', width:50, editable:false, classes:'orgHierarchy', sortable : false}, /*04*/ {name:'goal',index:'goal', width:70, editable:false} ], treeReader : { level_field: "level", parent_id_field: "parent", leaf_field: "leaf", expanded_field: "expanded" }, autowidth: true, height: 240, pager: '#pager', sortname: 'id', sortorder: "asc", toolbar:[true,"top"], caption:"TableGridDemo", emptyrecords: "Empty records", jsonReader : { root: "rows", page: "page", total: "total", records: "records", repeatitems: false, cell: "cell", id: "agileProgrammeId" } }); And to implement the search toolbar $('#grid').jqGrid('filterToolbar', {stringResult: true,searchOnEnter : true}); Would appreciate any help or any pointer on even if it is possible?

    Read the article

  • How do I set default search conditions with Searchlogic?

    - by Danger Angell
    I've got a search form on this page: http://staging-checkpointtracker.aptanacloud.com/events If you select a State from the dropdown you get zero results because you didn't select one or more Event Division (checkboxes). What I want is to default the checkboxes to "checked" when the page first loads...to display Events in all Divisions...but I want changes made by the user to be reflected when they filter. Here's the index method in my Events controller: def index @search = Event.search(params[:search]) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @events } end end Here's my search form: <% form_for @search do |f| %> <div> <%= f.label :state_is, "State" %> <%= f.select :state_is, ['AK','AL','AR','AZ','CA','CO','CT','DC','DE','FL','GA','HI','IA','ID','IL','IN','KS','KY','LA','MA','MD','ME','MI','MN','MO','MS','MT','NC','ND','NE','NH','NJ','NM','NV','NY','OH','OK','OR','PA','RI','SC','SD','TN','TX','UT','VA','VT','WA','WI','WV','WY'], :include_blank => true %> </div> <div> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Sprint", :checked => true %> Sprint (2+ hours)<br/> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Sport" %> Sport (12+ hours)<br/> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Adventure" %> Adventure (18+ hours)<br/> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Expedition" %> Expedition (48+ hours)<br/> </div> <%= f.submit "Find Events" %> <%= link_to 'Clear', '/events' %> <% end %>

    Read the article

  • Solr associations

    - by Tom
    Hi all, The last couple of days we are thinking of using Solr as our search engine of choice. Most of the features we need are out of the box or can be easily configured. There is however one feature that we absolutely need that seems to be well hidden (or missing) in Solr. I'll try to explain with an example. We have lots of documents that are actually businesses: <document> <name>Apache</name> <cat>1</cat> ... </document> <document> <name>McDonalds</name> <cat>2</cat> ... </document> In addition we have another xml file with all the categories and synonyms: <cat id=1> <name>software</name> <synonym>IT<synonym> </cat> <cat id=2> <name>fast food</name> <synonym>restaurant<synonym> </cat> We want to associate both businesses and categories so we can search using the name and/or synonyms of the category. But we do not want to merge these files at indexing time because we should update the categories (adding.remioving synonyms...) without indexing all the businesses again. Is there anything in Solr that does this kind of associations or do we need to develop some specific pieces? All feedback and suggestions are welcome. Thanks in advance, Tom

    Read the article

< Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >