Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 222/246 | < Previous Page | 218 219 220 221 222 223 224 225 226 227 228 229  | Next Page >

  • CSS Collapsing/Hiding divs with no data in <span>

    - by Chance
    I am trying to display an address which includes the following information: Title, division, address1, address2, town/state/zip, and country (5 seperate lines worth of data). The problem is sometimes the company may only have the title, address1, and town/state/zip yet other times it may be all but address2. This is determined upon a db record request server side. Therefore how can I make my output look proper when some of my labels will be blank? I would like div's that contain an empty span to be essentially collapsed/removed. My only idea of how was to use jquery and a selector to find all divs with blank spans (since thats all an asp.net label really is) and then remove those divs however this seems like such bad form. Is there any way to do this with css? Possible Code would be something like: $('span:empty:only-child').parent('div').remove(); Picture Examples (Ignore spacing/indentation issues which I will fix) Missing Division, Address2, and Country All Possible Fields The Html <asp:Label runat="server" ID="lblBillingAddressHeader" CssClass="lblBillingAddressHeader" Text="Billing Address:" /> <div style="position:relative; top:150px; left: 113px;"> <div class="test"> <asp:Label runat="server" ID="lblBillingDivision" CssClass="lblBillingShippingDivisionFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress" CssClass="lblBillingShippingFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress2" CssClass="lblBillingShippingFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress3" CssClass="lblBillingShippingFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress4" CssClass="lblBillingShippingFont" /> </div> </div> The CSS .test { position: relative; top: 0px; left: 0px; height: 12px; width: 300px; } .lblBillingShippingDivisionFont { font-size: small; font-weight: bold; } .lblBillingShippingFont { font-size: 10.6px; }

    Read the article

  • asp.net custom templated datalist - throws argument out of range (index) on button press

    - by MrTortoise
    I have a class BaseTemplate public abstract class BaseTemplate : ITemplate This adds the controls, and provides abstract methods to implement in the inheriting class. The inheriting class then adds its html according to its data source and manages the data binding. this all works fine - I get the control appearing with properly parsed html. the problem is that the base class adds controls into the template that have their own CommandName arguments ... the idea is that the class that implements the custom templated dataList will provide the logic of setting the Selected and Edit Indexes. This class also manages the data binding etc. It sets all of the templates ont he datalist in the Init method (which was another cause of this exception). the exception gets throw when i hit one of these buttons .. but after the ItemCommand event is being processed. The stack trace does not include any references to my methods or objects which is why i am so stuck. The Exception Details Exception Details: System.ArgumentOutOfRangeException: Specified argument was out of the range of valid values. Parameter name: index The Stack Trace: [ArgumentOutOfRangeException: Specified argument was out of the range of valid values. Parameter name: index] System.Web.UI.ControlCollection.get_Item(Int32 index) +8665582 System.Web.UI.WebControls.DataList.GetItem(ListItemType itemType, Int32 repeatIndex) +8667655 System.Web.UI.WebControls.DataList.System.Web.UI.WebControls.IRepeatInfoUser.GetItemStyle(ListItemType itemType, Int32 repeatIndex) +11 System.Web.UI.WebControls.RepeatInfo.RenderVerticalRepeater(HtmlTextWriter writer, IRepeatInfoUser user, Style controlStyle, WebControl baseControl) +8640873 System.Web.UI.WebControls.RepeatInfo.RenderRepeater(HtmlTextWriter writer, IRepeatInfoUser user, Style controlStyle, WebControl baseControl) +27 System.Web.UI.WebControls.DataList.RenderContents(HtmlTextWriter writer) +208 System.Web.UI.WebControls.BaseDataList.Render(HtmlTextWriter writer) +30 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.HtmlControls.HtmlForm.RenderChildren(HtmlTextWriter writer) +163 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +32 System.Web.UI.HtmlControls.HtmlForm.Render(HtmlTextWriter output) +51 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.HtmlControls.HtmlForm.RenderControl(HtmlTextWriter writer) +40 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.Page.Render(HtmlTextWriter writer) +29 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1266 This is driving me absolutley stark raving bonkers ... im talking cthulu style.

    Read the article

  • How to check for local Wi-Fi (not just cellular connection) using iPhone SDK?

    - by Michael
    I'm currently using the following to check whether Wi-Fi is available for my application: #import <SystemConfiguration/SystemConfiguration.h> static inline BOOL addressReachable(const struct sockaddr_in *hostAddress); BOOL localWiFiAvailable() { struct sockaddr_in localWifiAddress; bzero(&localWifiAddress, sizeof(localWifiAddress)); localWifiAddress.sin_len = sizeof(localWifiAddress); localWifiAddress.sin_family = AF_INET; // IN_LINKLOCALNETNUM is defined in <netinet/in.h> as 169.254.0.0 localWifiAddress.sin_addr.s_addr = htonl(IN_LINKLOCALNETNUM); return addressReachable(&localWifiAddress); } static inline BOOL addressReachable(const struct sockaddr_in *hostAddress) { const SCNetworkReachabilityRef target = SCNetworkReachabilityCreateWithAddress(kCFAllocatorDefault, (const struct sockaddr *)hostAddress); if (target != NULL) { SCNetworkReachabilityFlags flags = 0; const BOOL reachable = SCNetworkReachabilityGetFlags(target, &flags); CFRelease(target); return reachable && (flags & kSCNetworkFlagsReachable); } return NO; } This, however, does not return NO as it should when the iPhone is connected only to a cellular network but not a Wi-Fi network. Does anyone know how to fix this? Edit So this is what I ended up using: #import <arpa/inet.h> // For AF_INET, etc. #import <ifaddrs.h> // For getifaddrs() #import <net/if.h> // For IFF_LOOPBACK BOOL localWiFiAvailable() { struct ifaddrs *addresses; struct ifaddrs *cursor; BOOL wiFiAvailable = NO; if (getifaddrs(&addresses) != 0) return NO; cursor = addresses; while (cursor != NULL) { if (cursor -> ifa_addr -> sa_family == AF_INET && !(cursor -> ifa_flags & IFF_LOOPBACK)) // Ignore the loopback address { // Check for WiFi adapter if (strcmp(cursor -> ifa_name, "en0") == 0) { wiFiAvailable = YES; break; } } cursor = cursor -> ifa_next; } freeifaddrs(addresses); return wiFiAvailable; } Thanks "unforgiven" (and Matt Brown apparently).

    Read the article

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • Can't retrieve more than 2 gmail messages using Zend framework imap access - server dies - doens't r

    - by Ali
    Hi guys I'm working on a google apps application. Basically I've set it up so users can add multiple gmail addresses and check on their inboxes in the application. It works fine with a google apps email address however when I add a gmail address it just dies out. I'm using this code here: $mail = new Zend_Mail_Storage_Imap($mail_options); $all_messages = array(); $page = isset($_GET['page'])?$_GET['page']:1; $limit = isset($_GET['limit'])?$_GET['limit']:20; $offset = (($page-1)*$limit)+1; $end = ($page*$limit)>$c?$c:($page*$limit); for ($i=$offset;$i<=$end;$i++){ $h2t = new html2text(); $h2t->set_allowed_tags('<a>'); if(!$mail[$i]) break; else{ $one_message = $mail->getMessage($i); $one_message->id = $i; $one_message->UID = $mail->getUniqueId($i); $one_message->parts = array(); $one_message->body = ''; $count = 1; foreach (new RecursiveIteratorIterator($mail->getMessage($i)) as $ii=>$part) { try { $tpart = $part; //$tpart->_content = ''; $one_message->parts[$count] = $tpart; $count++; // check for html body if (strtok($part->contentType, ';') == 'text/html') { $b = $part->getContent(); if($part->contentTransferEncoding == 'quoted-printable') $b = quoted_printable_decode($b); $one_message->html_body = $b; $h2t->set_html($b); $one_message->body = $h2t->get_text(); } //check for text body if (strtok($part->contentType, ';') == 'text/plain') { $b = $part->getContent(); if($part->contentTransferEncoding == 'quoted-printable') $b = quoted_printable_decode($b); $one_message->text_body = $b; $one_message->body = $b;//$part->getContent(); } } catch (Zend_Mail_Exception $e) { // ignore } } $all_messages[] = $one_message; } } No matter what the emails it dies out on retrieving just 2 emails... whats going on here?

    Read the article

  • Why wont my while loop take new input (c++)

    - by Van
    I've written a program to get a string input from a user and parse it into tokens and move a robot according to the input. My problem is trying to issue more than one command. The code looks like: void Navigator::manualDrive() { const int bufSize = 42; char uinput[bufSize]; char delim[] = " "; char *token; while(true) { Navigator::parseInstruction(uinput); } } /* parseInstruction(char *c) -- parses cstring instructions received * and moves robot accordingly */ void Navigator::parseInstruction(char * c) { const int bufSize = 42; char uinput[bufSize]; char delim[] = " "; char *token; cout << "Enter your directions below: \n"; cin.ignore(); cin.getline (uinput, bufSize); token=strtok(uinput, delim); if(strcmp("forward", token) == 0) { int inches; token = strtok(NULL, delim); inches = atoi (token); Navigator::travel(inches); } if(strcmp("back",token) == 0) { int inches; token = strtok(NULL, delim); inches = atoi (token); double value = fabs(0.0735 * fabs(inches) - 0.0550); myRobot.backward(1/*speed*/, value/*time*/); } if(strcmp("turn",token) == 0) { int degrees; token = strtok(NULL, delim); if(strcmp("left",token) == 0) { token = strtok(uinput, delim); degrees = atoi (token); double value = fabs(0.0041 * degrees - 0.0523); myRobot.turnLeft(1/*speed*/, value/*time*/); } } if(strcmp("turn",token) == 0) { int degrees; token = strtok(NULL, delim); if(strcmp("right",token) == 0) { token = strtok(uinput, delim); degrees = atoi (token); double value = fabs(0.0041 * degrees - 0.0523); myRobot.turnRight(1/*speed*/, value/*time*/); } } if(strcmp("stop",token) == 0) { myRobot.motors(0,0); } } In the function manualDrive I have a while loop calling the function parseInstruction infinitely. The program outputs "Enter your directions below: " When I give the program instructions it executes them, and then it outputs "enter your directions below: " again and when I input my directions again it does not execute them and outputs "Enter your directions below: " instead. I'm sure this is a very simple fix I'm just very new to c++. So if you could please help me out and tell me why the program only takes the first set of directions. thanks

    Read the article

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • How can I group an array of rectangles into "Islands" of connected regions?

    - by Eric
    The problem I have an array of java.awt.Rectangles. For those who are not familiar with this class, the important piece of information is that they provide an .intersects(Rectangle b) function. I would like to write a function that takes this array of Rectangles, and breaks it up into groups of connected rectangles. Lets say for example, that these are my rectangles (constructor takes the arguments x, y, width,height): Rectangle[] rects = new Rectangle[] { new Rectangle(0, 0, 4, 2), //A new Rectangle(1, 1, 2, 4), //B new Rectangle(0, 4, 8, 2), //C new Rectangle(6, 0, 2, 2) //D } A quick drawing shows that A intersects B and B intersects C. D intersects nothing. A tediously drawn piece of ascii art does the job too: +-------+ +---+ ¦A+---+ ¦ ¦ D ¦ +-+---+-+ +---+ ¦ B ¦ +-+---+---------+ ¦ +---+ C ¦ +---------------+ Therefore, the output of my function should be: new Rectangle[][]{ new Rectangle[] {A,B,C}, new Rectangle[] {D} } The failed code This was my attempt at solving the problem: public List<Rectangle> getIntersections(ArrayList<Rectangle> list, Rectangle r) { List<Rectangle> intersections = new ArrayList<Rectangle>(); for(Rectangle rect : list) { if(r.intersects(rect)) { list.remove(rect); intersections.add(rect); intersections.addAll(getIntersections(list, rect)); } } return intersections; } public List<List<Rectangle>> mergeIntersectingRects(Rectangle... rectArray) { List<Rectangle> allRects = new ArrayList<Rectangle>(rectArray); List<List<Rectangle>> groups = new ArrayList<ArrayList<Rectangle>>(); for(Rectangle rect : allRects) { allRects.remove(rect); ArrayList<Rectangle> group = getIntersections(allRects, rect); group.add(rect); groups.add(group); } return groups; } Unfortunately, there seems to be an infinite recursion loop going on here. My uneducated guess would be that java does not like me doing this: for(Rectangle rect : allRects) { allRects.remove(rect); //... } Can anyone shed some light on the issue?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Decode base64 data as array in Python

    - by skerit
    I'm using this handy Javascript function to decode a base64 string and get an array in return. This is the string: base64_decode_array('6gAAAOsAAADsAAAACAEAAAkBAAAKAQAAJgEAACcBAAAoAQAA') This is what's returned: 234,0,0,0,235,0,0,0,236,0,0,0,8,1,0,0,9,1,0,0,10,1,0,0,38,1,0,0,39,1,0,0,40,1,0,0 The problem is I don't really understand the javascript function: var base64chars = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/'.split(""); var base64inv = {}; for (var i = 0; i < base64chars.length; i++) { base64inv[base64chars[i]] = i; } function base64_decode_array (s) { // remove/ignore any characters not in the base64 characters list // or the pad character -- particularly newlines s = s.replace(new RegExp('[^'+base64chars.join("")+'=]', 'g'), ""); // replace any incoming padding with a zero pad (the 'A' character is zero) var p = (s.charAt(s.length-1) == '=' ? (s.charAt(s.length-2) == '=' ? 'AA' : 'A') : ""); var r = []; s = s.substr(0, s.length - p.length) + p; // increment over the length of this encrypted string, four characters at a time for (var c = 0; c < s.length; c += 4) { // each of these four characters represents a 6-bit index in the base64 characters list // which, when concatenated, will give the 24-bit number for the original 3 characters var n = (base64inv[s.charAt(c)] << 18) + (base64inv[s.charAt(c+1)] << 12) + (base64inv[s.charAt(c+2)] << 6) + base64inv[s.charAt(c+3)]; // split the 24-bit number into the original three 8-bit (ASCII) characters r.push((n >>> 16) & 255); r.push((n >>> 8) & 255); r.push(n & 255); } // remove any zero pad that was added to make this a multiple of 24 bits return r; } What's the function of those "<<<" and "" characters. Or is there a function like this for Python?

    Read the article

  • Multiplying matrices: error: expected primary-expression before 'struct'

    - by justin
    I am trying to write a program that is supposed to multiply matrices using threads. I am supposed to fill the matrices using random numbers in a thread. I am compiling in g++ and using PTHREADS. I have also created a struct to pass the data from my command line input to the thread so it can generate the matrix of random numbers. The sizes of the two matrices are also passed in the command line as well. I keep getting: main.cpp:7: error: expected primary-expression before 'struct' my code @ line 7 =: struct a{ int Arow; int Acol; int low; int high; }; My inpust are : Sizes of two matrices ( 4 arguments) high and low ranges in which o generate the random numbers between. Complete code: [headers] using namespace std; void *matrixACreate(struct *); void *status; int main(int argc, char * argv[]) { int Arow = atoi(argv[1]); // Matrix A int Acol = atoi(argv[2]); // WxX int Brow = atoi(argv[3]); // Matrix B int Bcol = atoi(argv[4]); // XxZ, int low = atoi(argv[5]); // Range low int high = atoi(argv[6]); struct a{ int Arow; // Matrix A int Acol; // WxX int low; // Range low int high; }; pthread_t matrixAthread; //pthread_t matrixBthread; pthread_t runner; int error, retValue; if (Acol != Brow) { cout << " This matrix cannot be multiplied. FAIL" << endl; return 0; } error = pthread_create(&matrixAthread, NULL, matrixACreate, struct *a); //error = pthread_create(&matrixAthread, NULL, matrixBCreate, sendB); retValue = pthread_join(matrixAthread, &status); //retValue = pthread_join(matrixBthread, &status); return 0; } void matrixACreate(struct * a) { struct a *data = (struct a *) malloc(sizeof(struct a)); data->Arow = Arow; data->Acol = Acol; data->low = low; data->high = high; int range = ((high - low) + 1); cout << Arow << endl<< Acol << endl; }// just trying to print to see if I am in the thread

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • C strange array behaviour

    - by LukeN
    After learning that both strncmp is not what it seems to be and strlcpy not being available on my operating system (Linux), I figured I could try and write it myself. I found a quote from Ulrich Drepper, the libc maintainer, who posted an alternative to strlcpy using mempcpy. I don't have mempcpy either, but it's behaviour was easy to replicate. First of, this is the testcase I have #include <stdio.h> #include <string.h> #define BSIZE 10 void insp(const char* s, int n) { int i; for (i = 0; i < n; i++) printf("%c ", s[i]); printf("\n"); for (i = 0; i < n; i++) printf("%02X ", s[i]); printf("\n"); return; } int copy_string(char *dest, const char *src, int n) { int r = strlen(memcpy(dest, src, n-1)); dest[r] = 0; return r; } int main() { char b[BSIZE]; memset(b, 0, BSIZE); printf("Buffer size is %d", BSIZE); insp(b, BSIZE); printf("\nFirst copy:\n"); copy_string(b, "First", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); printf("\nSecond copy:\n"); copy_string(b, "Second", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); return 0; } And this is its result: Buffer size is 10 00 00 00 00 00 00 00 00 00 00 First copy: F i r s t b = 46 69 72 73 74 00 62 20 3D 00 b = 'First' Second copy: S e c o n d 53 65 63 6F 6E 64 00 00 01 00 b = 'Second' You can see in the internal representation (the lines insp() created) that there's some noise mixed in, like the printf() format string in the inspection after the first copy, and a foreign 0x01 in the second copy. The strings are copied intact and it correctly handles too long source strings (let's ignore the possible issue with passing 0 as length to copy_string for now, I'll fix that later). But why are there foreign array contents (from the format string) inside my destination? It's as if the destination was actually RESIZED to match the new length.

    Read the article

  • Zend Framework decorator subform add a class tag to DD wrapper tag

    - by Samuele
    I have this form: class Request_Form_Prova extends Zend_Form { public function init() { $this->setMethod('post'); $SubForm_Step = new Zend_Form_SubForm(); $SubForm_Step->setAttrib('class','Step'); $this->addSubform($SubForm_Step, 'Chicco'); $PrivacyCheck = $SubForm_Step->createElement('CheckBox', 'PrivacyCheck'); $PrivacyCheck->setLabel('I have read and I agre bla bla...') ->setRequired(true) ->setUncheckedValue(''); $PrivacyCheck->getDecorator('Label')->setOption('class', 'inline'); $SubForm_Step->addElement($PrivacyCheck); $SubForm_Step->addElement('submit', 'submit', array( 'ignore' => true, 'label' => 'OK', )); } } That generate this HTML: <form enctype="application/x-www-form-urlencoded" method="post" action=""> <dl class="zend_form"> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> <dt id="Chicco-PrivacyCheck-label"><label for="Chicco-PrivacyCheck" class="inline required">I have read and I agre bla bla...</label></dt> <dd id="Chicco-PrivacyCheck-element"> <input type="hidden" name="Chicco[PrivacyCheck]" value=""><input type="checkbox" name="Chicco[PrivacyCheck]" id="Chicco-PrivacyCheck" value="1"> </dd> <dt id="submit-label">&nbsp;</dt> <dd id="submit-element"> <input type="submit" name="Chicco[submit]" id="Chicco-submit" value="OK"> </dd> </dl> </fieldset> </dd> </dl> </form> How can I add a class="Test" to the <dd id="Chicco-element"> elemnt? In order to have it like that: <dd id="Chicco-element" class="Test"> I thought something like that but it don't work: $SubForm_Step->getDecorator('DdWrapper')->setOption('class', 'Test'); OR $SubForm_Step->getDecorator('DtDdWrapper')->setOption('class', 'Test'); How can I do it? And last question: How can I wrap that DD and DT element of a SubForm in another DL element? Like that: ( second line ) <dl class="zend_form"> <dl> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> .......

    Read the article

  • MODX parse error function implode (is it me or modx?)

    - by Ian
    Hi, I cannot for the life of me figure this out, maybe someone can help. Using MODX a form takes user criteria to create a filter and return a list of documents. The form is one text field and a few checkboxes. If both text field and checkbox data is posted, the function works fine; if just the checkbox data is posted the function works fine; but if just the text field data is posted, modx gives me the following error: Error: implode() [function.implode]: Invalid arguments passed. I've tested this outside of modx with flat files and it all works fine leading me to assume a bug exists within modx. But I'm not convinced. Here's my code: <?php $order = array('price ASC'); //default sort order if(!empty($_POST['tour_finder_duration'])){ //duration submitted $days = htmlentities($_POST['tour_finder_duration']); //clean up post array_unshift($order,"duration DESC"); //add duration sort before default $filter[] = 'duration,'.$days.',4'; //add duration to filter[] (field,criterion,mode) $criteria[] = 'Number of days: <strong>'.$days.'</strong>'; //displayed on results page } if(!empty($_POST['tour_finder_dests'])){ //destination/s submitted $dests = $_POST['tour_finder_dests']; foreach($dests as $value){ //iterate through dests array $filter[] = 'searchDests,'.htmlentities($value).',7'; //add dests to filter[] $params['docid'] = $value; $params['field'] = 'pagetitle'; $pagetitle = $modx->runSnippet('GetField',$params); $dests_array[] = '<a href="[~'.$value.'~]" title="Read more about '.$pagetitle.'" class="tourdestlink">'.$pagetitle.'</a>'; } $dests_array = implode(', ',$dests_array); $criteria[] = 'Destinations: '.$dests_array; //displayed on results page } if(is_array($filter)){ $filter = implode('|',$filter);//pipe-separated string } if(is_array($order)){ $order = implode(',',$order);//comma-separated string } if(is_array($criteria)){ $criteria = implode('<br />',$criteria); } echo '<br />Order: '.$order.'<br /> Filter: '.$filter.'<br /> Criteria: '.$criteria; //next: extract docs using $filter and $order, display user's criteria using $criteria... ?> The echo statement is displayed above the MODX error message and the $filter array is correctly imploded. Any help will save my computer from flying out the window. Thanks

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Php plugin to replace '->' with '.' as the member access operator ? Or even better: alternative synt

    - by Gigi
    Present day usable solution: Note that if you use an ide or an advanced editor, you could make a code template, or record a macro that inserts '->' when you press Ctrl and '.' or something. Netbeans has macros, and I have recorded a macro for this, and I like it a lot :) (just click the red circle toolbar button (start record macro),then type -> into the editor (thats all the macro will do, insert the arrow into the editor), then click the gray square (stop record macro) and assign the 'Ctrl dot' shortcut to it, or whatever shortcut you like) The php plugin: The php plugin, would also have to have a different string concatenation operator than the dot. Maybe a double dot ? Yea... why not. All it has to do is set an activation tag so that it doesnt replace / interpreter '.' as '->' for old scripts and scripts that dont intent do use this. Something like this: <php+ $obj.i = 5 ?> (notice the modified '<?php' tag to '<?php+' ) This way it wouldnt break old code. (and you can just add the '<?php+' code template to your editor and then type 'php tab' (for netbeans) and it would insert '<?php+' ) With the alternative syntax method you could even have old and new syntax cohabitating on the same page like this (I am illustrating this to show the great compatibility of this method, not because you would want to do this): <?php+ $obj.i = 5; ?> <?php $obj->str = 'a' . 'b'; ?> You could change the tag to something more explanatory, in case somebody who doesnt know about the plugin reads the script and thinks its a syntax error <?php-dot.com $obj.i = 5; ?> This is easy because most editors have code templates, so its easy to assign a shortcut to it. And whoever doesnt want the dot replacement, doesnt have to use it. These are NOT ultimate solutions, they are ONLY examples to show that solutions exist, and that arguments against replacing '->' with '.' are only excuses. (Just admit you like the arrow, its ok : ) With this potential method, nobody who doesnt want to use it would have to use it, and it wouldnt break old code. And if other problems (ahem... excuses) arise, they could be fixed too. So who can, and who will do such a thing ?

    Read the article

  • Any thoughts on how to create a true 'punch-out' area in a Sprite?

    - by rhtx
    I've been working on this for awhile, now. You might also call it a 'reverse mask', or an 'inverse mask'. Basically, I'm creating a view window within a display object. I need to allow objects on the stage that are under the window to be able to interact with the mouse. This is similar to a WPF question: http://stackoverflow.com/questions/740994/use-wpf-object-to-punch-hole-in-another, which has a much shorter write-up. I've got a Class called PunchOutShield, which creates a Sprite that covers the stage (or over some desired area). The Sprite's Graphics object is filled using the color and transparency of Flex's modal screen. The result is a screen that looks like the screen which appears behind a modal PopUp. PunchOutShield has a method called punch, which takes two arguments - the first is a Shape object, which defines the shape of the punch-through area; the second is a Point object, which indicates where to position the punch-through area. It took some experimenting, but I found that I can successfully create a punch-out area (i.e. - the modal screen does not display within the bounds of the given Shape). To do this, I set cacheAsBitmap to true on the Sprite that is used to create the modal screen, and also on the Shape object, which is added to the modal screen Sprite's displayList. If I set the blend mode of the Shape to ERASE, a completely transparent area is created in the modal screen. So far, great. The problem is that Shape does not subclass InteractiveObject, so there is no way to set mouseEnabled = false on it. And so, it prevents interaction between the mouse and any objects that are visible through the punch-out area. On top of that, InteractiveObject isn't available to look at, so I can't see if there is a way to borrow what it's doing to provide the mouseEnabled functionality and apply it to a subclass of Shape. I've tried using another Sprite object, rather than a Shape object, but the blending doesn't work out correctly. I'm not sure why there is a difference, but the Shape object seems to somehow combine with the parenting Sprite, allowing the ERASE blendMode to effect the desired punch-out visual appearance. It wouldn't be the end of the world if I had to draw up the screen with a series of rectangles so that the punch-out area was just simply not drawn, but that approach won't work if the punch-out area is complex. Or round. Any thoughts on this approach, or on an alternative approach?

    Read the article

  • Question about InputMismatchException while using Scanner

    - by aser
    The question : Input file: customer’s account number, account balance at beginning of month, transaction type (withdrawal, deposit, interest), transaction amount Output: account number, beginning balance, ending balance, total interest paid, total amount deposited, number of deposits, total amount withdrawn, number of withdrawals package sentinel; import java.io.*; import java.util.*; public class Ex7 { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { int AccountNum; double BeginningBalance; double TransactionAmount; int TransactionType; double AmountDeposited=0; int NumberOfDeposits=0; double InterestPaid=0.0; double AmountWithdrawn=0.0; int NumberOfWithdrawals=0; boolean found= false; Scanner inFile = new Scanner(new FileReader("Account.in")); PrintWriter outFile = new PrintWriter("Account.out"); AccountNum = inFile.nextInt(); BeginningBalance= inFile.nextDouble(); while (inFile.hasNext()) { TransactionAmount=inFile.nextDouble(); TransactionType=inFile.nextInt(); outFile.printf("Account Number: %d%n", AccountNum); outFile.printf("Beginning Balance: $%.2f %n",BeginningBalance); outFile.printf("Ending Balance: $%.2f %n",BeginningBalance); outFile.println(); switch (TransactionType) { case '1': // case 1 if we have a Deposite BeginningBalance = BeginningBalance + TransactionAmount; AmountDeposited = AmountDeposited + TransactionAmount; NumberOfDeposits++; outFile.printf("Amount Deposited: $%.2f %n",AmountDeposited); outFile.printf("Number of Deposits: %d%n",NumberOfDeposits); outFile.println(); break; case '2':// case 2 if we have an Interest BeginningBalance = BeginningBalance + TransactionAmount; InterestPaid = InterestPaid + TransactionAmount; outFile.printf("Interest Paid: $%.2f %n",InterestPaid); outFile.println(); break; case '3':// case 3 if we have a Withdraw BeginningBalance = BeginningBalance - TransactionAmount; AmountWithdrawn = AmountWithdrawn + TransactionAmount; NumberOfWithdrawals++; outFile.printf("Amount Withdrawn: $%.2f %n",AmountWithdrawn); outFile.printf("Number of Withdrawals: %d%n",NumberOfWithdrawals); outFile.println(); break; default: System.out.println("Invalid transaction Tybe: " + TransactionType + TransactionAmount); } } inFile.close(); outFile.close(); } } But is gives me this : Exception in thread "main" java.util.InputMismatchException at java.util.Scanner.throwFor(Scanner.java:840) at java.util.Scanner.next(Scanner.java:1461) at java.util.Scanner.nextInt(Scanner.java:2091) at java.util.Scanner.nextInt(Scanner.java:2050) at sentinel.Ex7.main(Ex7.java:36) Java Result: 1

    Read the article

  • due at midnight - program compiles but has logic error(s)

    - by Leslie Laraia
    not sure why this program isn't working. it compiles, but doesn't provide the expected output. the input file is basically just this: Smith 80000 Jones 100000 Scott 75000 Washington 110000 Duffy 125000 Jacobs 67000 Here is the program: import java.io.File; import java.io.FileNotFoundException; import java.util.Scanner; /** * * @author Leslie */ public class Election { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { // TODO code application logic here File inputFile = new File("C:\\Users\\Leslie\\Desktop\\votes.txt"); Scanner in = new Scanner(inputFile); int x = 0; String line = ""; Scanner lineScanner = new Scanner(line); line = in.nextLine(); while (in.hasNextLine()) { line = in.nextLine(); x++; } String[] senatorName = new String[x]; int[] votenumber = new int[x]; double[] votepercent = new double[x]; System.out.printf("%44s", "Election Results for State Senator"); System.out.println(); System.out.printf("%-22s", "Candidate"); //Prints the column headings to the screen System.out.printf("%22s", "Votes Received"); System.out.printf("%22s", "%of Total Votes"); int i; for(i=0; i<x; i++) { while(in.hasNextLine()) { line = in.nextLine(); String candidateName = lineScanner.next(); String candidate = candidateName.trim(); senatorName[i] = candidate; int votevalue = lineScanner.nextInt(); votenumber[i] = votevalue; } } votepercent = percentages(votenumber, x); for (i = 0; i < x; i++) { System.out.println(); System.out.printf("%-22s", senatorName[i]); System.out.printf("%22d", votenumber[i]); System.out.printf("%22.2f", votepercent[i]); System.out.println(); } } public static double [] percentages(int[] votenumber, int z) { double [] percentage = new double [z]; double total = 0; for (double element : votenumber) { total = total + element; } for(int i=0; i < votenumber.length; i++) { int y = votenumber[i]; percentage[i] = (y/total) * 100; } return percentage; } }

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • Why wont my while loop wont take new input (c++)

    - by Van
    I've written a program to get a string input from a user and parse it into tokens and move a robot according to the input. My problem is trying to issue more than one command. The code looks like: void Navigator::manualDrive() { const int bufSize = 42; char uinput[bufSize]; char delim[] = " "; char *token; while(true) { Navigator::parseInstruction(uinput); } } /* parseInstruction(char *c) -- parses cstring instructions received * and moves robot accordingly */ void Navigator::parseInstruction(char * c) { const int bufSize = 42; char uinput[bufSize]; char delim[] = " "; char *token; cout << "Enter your directions below: \n"; cin.ignore(); cin.getline (uinput, bufSize); token=strtok(uinput, delim); if(strcmp("forward", token) == 0) { int inches; token = strtok(NULL, delim); inches = atoi (token); Navigator::travel(inches); } if(strcmp("back",token) == 0) { int inches; token = strtok(NULL, delim); inches = atoi (token); double value = fabs(0.0735 * fabs(inches) - 0.0550); myRobot.backward(1/*speed*/, value/*time*/); } if(strcmp("turn",token) == 0) { int degrees; token = strtok(NULL, delim); if(strcmp("left",token) == 0) { token = strtok(uinput, delim); degrees = atoi (token); double value = fabs(0.0041 * degrees - 0.0523); myRobot.turnLeft(1/*speed*/, value/*time*/); } } if(strcmp("turn",token) == 0) { int degrees; token = strtok(NULL, delim); if(strcmp("right",token) == 0) { token = strtok(uinput, delim); degrees = atoi (token); double value = fabs(0.0041 * degrees - 0.0523); myRobot.turnRight(1/*speed*/, value/*time*/); } } if(strcmp("stop",token) == 0) { myRobot.motors(0,0); } } In the function manualDrive I have a while loop calling the function parseInstruction infinitely. The program outputs "Enter your directions below: " When I give the program instructions it executes them, and then it outputs "enter your directions below: " again and when I input my directions again it does not execute them and outputs "Enter your directions below: " instead. I'm sure this is a very simple fix I'm just very new to c++. So if you could please help me out and tell me why the program only takes the first set of directions. thanks

    Read the article

  • Linker Issues with boost::thread under linux using Eclipse and CMake

    - by OcularProgrammer
    I'm in the process of attempting to port some code across from PC to Ubuntu, and am having some issues due to limited experience developing under linux. We use CMake to generate all our build stuff. Under windows I'm making VS2010 projects, and under Linux I'm making Eclipse projects. I've managed to get my OpenCV stuff ported across successfully, but am having major headaches trying to port my threaded boost apps. Just so we're clear, the steps I have followed so-far on a clean Ubuntu 12 installation. (I've done 2 clean re-installs to try and fix potential library cock-ups, now I'm just giving up and asking): Install Eclipse and Eclipse CDT using my package manager Install CMake and CMake Gui using my package manager Install libboost-all-dev using my package manager So-far that's all I've done. I can create the eclipse project using CMake with no errors, so CMake is successfully finding my boost install. When I try and build through eclipse is when I get issues; The app I'm attempting to build uses boost::asio for some UDP I/O and boost::thread to create worker threads for the asio I/O services. I can successfully compile each module, but when I come to link I get spammed with errors such as: /usr/bin/c++ CMakeFiles/RE05DevelopmentDemo.dir/main.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/RE05FusionListener/RE05FusionListener.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/NewEye/NewEye.cpp.o -o RE05DevelopmentDemo -rdynamic -Wl,-Bstatic -lboost_system-mt -lboost_date_time-mt -lboost_regex-mt -lboost_thread-mt -Wl,-Bdynamic /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `void boost::call_once<void (*)()>(boost::once_flag&, void (*)()) [clone .constprop.98]': make[2]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' (.text+0xc8): undefined reference to `pthread_key_create' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::interruption_enabled()': (.text+0x540): undefined reference to `pthread_getspecific' make[1]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x570): undefined reference to `pthread_getspecific' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x59f): undefined reference to `pthread_getspecific' Some Gotchas that I have collected from other StackOverflow posts and have already checked: The boost libs are all present at /usr/lib I am not getting any compile errors for inability to find the boost headers, so they must be getting found. I am trying to link statically, but I believe eclipse should be passing the correct arguments to make that happen since my CMakeLists.txt includes SET(Boost_USE_STATIC_LIBS ON) I'm officially out of ideas here, I have tried doing local builds of boost and a bunch of other stuff with no more success. I even re-installed Ubuntu to ensure I haven't completely fracked the libs directories and links with multiple weird versions or anything else. Any help would be muchly appreciated.

    Read the article

< Previous Page | 218 219 220 221 222 223 224 225 226 227 228 229  | Next Page >