Search Results

Search found 6346 results on 254 pages for 'wordpress members'.

Page 237/254 | < Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >

  • How do you prevent IDisposable from spreading to all your classes?

    - by GrahamS
    Start with these simple classes... Let's say I have a simple set of classes like this: class Bus { Driver busDriver = new Driver(); } class Driver { Shoe[] shoes = { new Shoe(), new Shoe() }; } class Shoe { Shoelace lace = new Shoelace(); } class Shoelace { bool tied = false; } A Bus has a Driver, the Driver has two Shoes, each Shoe has a Shoelace. All very silly. Add an IDisposable object to Shoelace Later I decide that some operation on the Shoelace could be multi-threaded, so I add an EventWaitHandle for the threads to communicate with. So Shoelace now looks like this: class Shoelace { private AutoResetEvent waitHandle = new AutoResetEvent(false); bool tied = false; // ... other stuff .. } Implement IDisposable on Shoelace Buit now FxCop will complain: "Implement IDisposable on 'Shoelace' because it creates members of the following IDisposable types: 'EventWaitHandle'." Okay, I implement IDisposable on Shoelace and my neat little class becomes this horrible mess: class Shoelace : IDisposable { private AutoResetEvent waitHandle = new AutoResetEvent(false); bool tied = false; private bool disposed = false; public void Dispose() { Dispose(true); GC.SuppressFinalize(this); } ~Shoelace() { Dispose(false); } protected virtual void Dispose(bool disposing) { if (!this.disposed) { if (disposing) { if (waitHandle != null) { waitHandle.Close(); waitHandle = null; } } // No unmanaged resources to release otherwise they'd go here. } disposed = true; } } Or (as pointed out by commenters) since Shoelace itself has no unmanaged resources, I might use the simpler dispose implementation without needing the Dispose(bool) and Destructor: class Shoelace : IDisposable { private AutoResetEvent waitHandle = new AutoResetEvent(false); bool tied = false; public void Dispose() { if (waitHandle != null) { waitHandle.Close(); waitHandle = null; } GC.SuppressFinalize(this); } } Watch in horror as IDisposable spreads Right that's that fixed. But now FxCop will complain that Shoe creates a Shoelace, so Shoe must be IDisposable too. And Driver creates Shoe so Driver must be IDisposable. and Bus creates Driver so Bus must be IDisposable and so on. Suddenly my small change to Shoelace is causing me a lot of work and my boss is wondering why I need to checkout Bus to make a change to Shoelace. The Question How do you prevent this spread of IDisposable, but still ensure that your unmanaged objects are properly disposed?

    Read the article

  • MVC pattern implementation. What is the n-relation between its components

    - by Srodriguez
    Dear all, I'm working in a C# project and we are , in order to get some unity across the different parts of our UI, trying to use the MVC pattern. The client is windows form based and I'm trying to create a simple MVC pattern implementation. It's been more challenging than expected, but I still have some questions regarding the MVC pattern. The problem comes mostly from the n-n relationships between its components: Here is what I've understood, but I'm not sure at all of it. Maybe someone can correct me? Model: can be shared among different Views. 1-n relationship between Model-View View: shows the state of the model. only one controller (can be shared among different views?). 1-1 relationship with the Model, 1-1 relationship with the controller Controller: handles the user actions on the view and updates the model. One controller can be shared among different views, a controller interacts only with one model? I'm not sure about the two last ones: Can a view have several controller? Or can a view share a controller with another view? Or is it only a 1:1 relationship? Can a controller handle several views? can it interact with several models? Also, I take advantage of this question to ask another MVC related question. I've suppressed all the synchronous calls between the different members of the MVC, making use of the events and delegates. One last call is still synchronous and is actually the most important one: The call between the view and the controller is still synchronous, as I need to know rather the controller has been able to handle the user's action or not. This is very bad as it means that I could block the UI thread (hence the client itself) while the controller is processing or doing some work. How can I avoid this? I can make use of the callback but then how do i know to which event the callback comes from? PS: I can't change the pattern at this stage, so please avoid answers of type "use MVP or MVVC, etc ;) Thanks!

    Read the article

  • MVC pattern implementation. What is the n-relation between its components

    - by Srodriguez
    Dear all, I'm working in a C# project and we are , in order to get some unity across the different parts of our UI, trying to use the MVC pattern. The client is windows form based and I'm trying to create a simple MVC pattern implementation. It's been more challenging than expected, but I still have some questions regarding the MVC pattern. The problem comes mostly from the n-n relationships between its components: Here is what I've understood, but I'm not sure at all of it. Maybe someone can correct me? Model: can be shared among different Views. 1-n relationship between Model-View View: shows the state of the model. only one controller (can be shared among different views?). 1-1 relationship with the Model, 1-1 relationship with the controller Controller: handles the user actions on the view and updates the model. One controller can be shared among different views, a controller interacts only with one model? I'm not sure about the two last ones: Can a view have several controller? Or can a view share a controller with another view? Or is it only a 1:1 relationship? Can a controller handle several views? can it interact with several models? Also, I take advantage of this question to ask another MVC related question. I've suppressed all the synchronous calls between the different members of the MVC, making use of the events and delegates. One last call is still synchronous and is actually the most important one: The call between the view and the controller is still synchronous, as I need to know rather the controller has been able to handle the user's action or not. This is very bad as it means that I could block the UI thread (hence the client itself) while the controller is processing or doing some work. How can I avoid this? I can make use of the callback but then how do i know to which event the callback comes from? PS: I can't change the pattern at this stage, so please avoid answers of type "use MVP or MVVC, etc ;) Thanks!

    Read the article

  • Deriving from a component and implementing IDisposable properly

    - by PaulH
    I have a Visual Studio 2008 C# .NET 2.0 CF project with an abstract class derived from Component. From that class, I derive several concrete classes (as in my example below). But, when I go to exit my Form, though the Form's Dispose() member is called and components.Dispose() is called, my components are never disposed. Can anybody suggest how I can fix this design? public abstract class SomeDisposableComponentBase : Component { private System.ComponentModel.IContainer components; protected SomeDisposableComponentBase() { Initializecomponent(); } protected SomeDisposableComponentBase(IContainer container) { container.Add(this); Initializecomponent(); } private void InitializeComponent() { components = new System.ComponentModel.Container(); } protected abstract void Foo(); #region IDisposable Members bool disposed_; /// Warning 60 CA1063 : Microsoft.Design : Ensure that 'SomeDisposableComponentBase.Dispose()' is declared as public and sealed.* public void Dispose() { // never called Dispose(true); GC.SuppressFinalize(this); } protected virtual void Dispose(bool disposing) { // never called if (!disposed_) { if (disposing && (components != null)) { components.Dispose(); } disposed_ = true; } base.Dispose(disposing); } #endregion } public SomeDisposableComponent : SomeDisposableComponentBase { public SomeDisposableComponent() : base() { } public SomeDisposableComponent(IContainer container) : base(container) { } protected override void Foo() { // Do something... } protected override void Dispose(bool disposing) { // never called base.Dispose(disposing); } } public partial class my_form : Form { private SomeDisposableComponentBase d_; public my_form() { InitializeComponent(); if (null == components) components = new System.ComponentModel.Container(); d_ = new SomeDisposableComponent(components); } /// exit button clicked private void Exit_Click(object sender, EventArgs e) { this.Close(); } /// from the my_form.designer.cs protected override void Dispose(bool disposing) { if (disposing && (components != null)) { // this function is executed as expected when the form is closed components.Dispose(); } base.Dispose(disposing); } } *I note that FX-Cop is giving me a hint here. But, if I try to declare that function as sealed, I get the error: error CS0238: 'SomeDisposableComponentBase.Dispose()' cannot be sealed because it is not an override Declaring that function an override leads to: 'SomeDisposableComponentBase.Dispose()': cannot override inherited member 'System.ComponentModel.Component.Dispose()' because it is not marked virtual, abstract, or override Thanks, PaulH

    Read the article

  • Invalid cast exception

    - by user127147
    I have a simple application to store address details and edit them. I have been away from VB for a few years now and need to refreash my knowledge while working to a tight deadline. I have a general Sub responsible for displaying a form where user can add contact details (by pressing button add) and edit them (by pressing button edit). This sub is stored in a class Contact. The way it is supposed to work is that there is a list with all the contacts and when new contact is added a new entry is displayed. If user wants to edit given entry he or she selects it and presses edit button Public Sub Display() Dim C As New Contact C.Cont = InputBox("Enter a title for this contact.") C.Fname = frmAddCont.txtFName.Text C.Surname = frmAddCont.txtSName.Text C.Address = frmAddCont.txtAddress.Text frmStart.lstContact.Items.Add(C.Cont.ToString) End Sub I call it from the form responsible for adding new contacts by Dim C As New Contact C.Display() and it works just fine. However when I try to do something similar using the edit button I get errors - "Unable to cast object of type 'System.String' to type 'AddressBook.Contact'." Dim C As Contact If lstContact.SelectedItem IsNot Nothing Then C = lstContact.SelectedItem() C.Display() End If I think it may be something simple however I wasn't able to fix it and given short time I have I decided to ask for help here. I have updated my class with advice from other members and here is the final version (there are some problems however). When I click on the edit button it displays only the input box for the title of the contact and actually adds another entry in the list with previous data for first name, second name etc. Public Class Contact Public Contact As String Public Fname As String Public Surname As String Public Address As String Private myCont As String Public Property Cont() Get Return myCont End Get Set(ByVal value) myCont = Value End Set End Property Public Overrides Function ToString() As String Return Me.Cont End Function Sub NewContact() FName = frmAddCont.txtFName.ToString frmStart.lstContact.Items.Add(FName) frmAddCont.Hide() End Sub Public Sub Display() Dim C As New Contact C.Cont = InputBox("Enter a title for this contact.") C.Fname = frmAddCont.txtFName.Text C.Surname = frmAddCont.txtSName.Text C.Address = frmAddCont.txtAddress.Text 'frmStart.lstContact.Items.Add(C.Cont.ToString) frmStart.lstContact.Items.Add(C) End Sub End Class

    Read the article

  • Go - Using a container/heap to implement a priority queue

    - by Seth Hoenig
    In the big picture, I'm trying to implement Dijkstra's algorithm using a priority queue. According to members of golang-nuts, the idiomatic way to do this in Go is to use the heap interface with a custom underlying data structure. So I have created Node.go and PQueue.go like so: //Node.go package pqueue type Node struct { row int col int myVal int sumVal int } func (n *Node) Init(r, c, mv, sv int) { n.row = r n.col = c n.myVal = mv n.sumVal = sv } func (n *Node) Equals(o *Node) bool { return n.row == o.row && n.col == o.col } And PQueue.go: // PQueue.go package pqueue import "container/vector" import "container/heap" type PQueue struct { data vector.Vector size int } func (pq *PQueue) Init() { heap.Init(pq) } func (pq *PQueue) IsEmpty() bool { return pq.size == 0 } func (pq *PQueue) Push(i interface{}) { heap.Push(pq, i) pq.size++ } func (pq *PQueue) Pop() interface{} { pq.size-- return heap.Pop(pq) } func (pq *PQueue) Len() int { return pq.size } func (pq *PQueue) Less(i, j int) bool { I := pq.data.At(i).(Node) J := pq.data.At(j).(Node) return (I.sumVal + I.myVal) < (J.sumVal + J.myVal) } func (pq *PQueue) Swap(i, j int) { temp := pq.data.At(i).(Node) pq.data.Set(i, pq.data.At(j).(Node)) pq.data.Set(j, temp) } And main.go: (the action is in SolveMatrix) // Euler 81 package main import "fmt" import "io/ioutil" import "strings" import "strconv" import "./pqueue" const MATSIZE = 5 const MATNAME = "matrix_small.txt" func main() { var matrix [MATSIZE][MATSIZE]int contents, err := ioutil.ReadFile(MATNAME) if err != nil { panic("FILE IO ERROR!") } inFileStr := string(contents) byrows := strings.Split(inFileStr, "\n", -1) for row := 0; row < MATSIZE; row++ { byrows[row] = (byrows[row])[0 : len(byrows[row])-1] bycols := strings.Split(byrows[row], ",", -1) for col := 0; col < MATSIZE; col++ { matrix[row][col], _ = strconv.Atoi(bycols[col]) } } PrintMatrix(matrix) sum, len := SolveMatrix(matrix) fmt.Printf("len: %d, sum: %d\n", len, sum) } func PrintMatrix(mat [MATSIZE][MATSIZE]int) { for r := 0; r < MATSIZE; r++ { for c := 0; c < MATSIZE; c++ { fmt.Printf("%d ", mat[r][c]) } fmt.Print("\n") } } func SolveMatrix(mat [MATSIZE][MATSIZE]int) (int, int) { var PQ pqueue.PQueue var firstNode pqueue.Node var endNode pqueue.Node msm1 := MATSIZE - 1 firstNode.Init(0, 0, mat[0][0], 0) endNode.Init(msm1, msm1, mat[msm1][msm1], 0) if PQ.IsEmpty() { // make compiler stfu about unused variable fmt.Print("empty") } PQ.Push(firstNode) // problem return 0, 0 } The problem is, upon compiling i get the error message: [~/Code/Euler/81] $ make 6g -o pqueue.6 Node.go PQueue.go 6g main.go main.go:58: implicit assignment of unexported field 'row' of pqueue.Node in function argument make: *** [all] Error 1 And commenting out the line PQ.Push(firstNode) does satisfy the compiler. But I don't understand why I'm getting the error message in the first place. Push doesn't modify the argument in any way.

    Read the article

  • On Redirect - Failed to generate a user instance of SQL Server...

    - by Craig Russell
    Hello (this is a long post sorry), I am writing a application in ASP.NET MVC 2 and I have reached a point where I am receiving this error when I connect remotely to my Server. Failed to generate a user instance of SQL Server due to failure in retrieving the user's local application data path. Please make sure the user has a local user profile on the computer. The connection will be closed. I thought I had worked around this problem locally, as I was getting this error in debug when site was redirected to a baseUrl if a subdomain was invalid using this code: protected override void Initialize(RequestContext requestContext) { string[] host = requestContext.HttpContext.Request.Headers["Host"].Split(':'); _siteProvider.Initialise(host, LiveMeet.Properties.Settings.Default["baseUrl"].ToString()); base.Initialize(requestContext); } protected override void OnActionExecuting(ActionExecutingContext filterContext) { if (Site == null) { string[] host = filterContext.HttpContext.Request.Headers["Host"].Split(':'); string newUrl; if (host.Length == 2) newUrl = "http://sample.local:" + host[1]; else newUrl = "http://sample.local"; Response.Redirect(newUrl, true); } ViewData["Site"] = Site; base.OnActionExecuting(filterContext); } public Site Site { get { return _siteProvider.GetCurrentSite(); } } The Site object is returned from a Provider named siteProvider, this does two checks, once against a database containing a list of all available subdomains, then if that fails to find a valid subdomain, or valid domain name, searches a memory cache of reserved domains, if that doesn't hit then returns a baseUrl where all invalid domains are redirected. locally this worked when I added the true to Response.Redirect, assuming a halting of the current execution and restarting the execution on the browser redirect. What I have found in the stack trace is that the error is thrown on the second attempt to access the database. #region ISiteProvider Members public void Initialise(string[] host, string basehost) { if (host[0].Contains(basehost)) host = host[0].Split('.'); Site getSite = GetSites().WithDomain(host[0]); if (getSite == null) { sites.TryGetValue(host[0], out getSite); } _site = getSite; } public Site GetCurrentSite() { return _site; } public IQueryable<Site> GetSites() { return from p in _repository.groupDomains select new Site { Host = p.domainName, GroupGuid = (Guid)p.groupGuid, IsSubDomain = p.isSubdomain }; } #endregion The Linq query ^^^ is hit first, with a filter of WithDomain, the error isn't thrown till the WithDomain filter is attempted. In summary: The error is hit after the page is redirected, so the first iteration is executing as expected (so permissions on the database are correct, user profiles etc) shortly after the redirect when it filters the database query for the possible domain/subdomain of current redirected page, it errors out.

    Read the article

  • .Net Entity Framework SaveChanges is adding without add method

    - by tmfkmoney
    I'm new to the entity framework and I'm really confused about how savechanges works. There's probably a lot of code in my example which could be improved, but here's the problem I'm having. The user enters a bunch of picks. I make sure the user hasn't already entered those picks. Then I add the picks to the database. var db = new myModel() var predictionArray = ticker.Substring(1).Split(','); // Get rid of the initial comma. var user = Membership.GetUser(); var userId = Convert.ToInt32(user.ProviderUserKey); // Get the member with all his predictions for today. var memberQuery = (from member in db.Members where member.user_id == userId select new { member, predictions = from p in member.Predictions where p.start_date == null select p }).First(); // Load all the company ids. foreach (var prediction in memberQuery.predictions) { prediction.CompanyReference.Load(); } var picks = from prediction in predictionArray let data = prediction.Split(':') let companyTicker = data[0] where !(from i in memberQuery.predictions select i.Company.ticker).Contains(companyTicker) select new Prediction { Member = memberQuery.member, Company = db.Companies.Where(c => c.ticker == companyTicker).First(), is_up = data[1] == "up", // This turns up and down into true and false. }; // Save the records to the database. // HERE'S THE PART I DON'T UNDERSTAND. // This saves the records, even though I don't have db.AddToPredictions(pick) foreach (var pick in picks) { db.SaveChanges(); } // This does not save records when the db.SaveChanges outside of a loop of picks. db.SaveChanges(); foreach (var pick in picks) { } // This saves records, but it will insert all the picks exactly once no matter how many picks you have. //The fact you're skipping a pick makes no difference in what gets inserted. var counter = 1; foreach (var pick in picks) { if (counter == 2) { db.SaveChanges(); } counter++; } There's obviously something going on with the context I don't understand. I'm guessing I've somehow loaded my new picks as pending changes, but even if that's true I don't understand I have to loop over them to save changes. Can someone explain this to me?

    Read the article

  • passing data from a client form via jquery ajax dinamicly

    - by quantum62
    i wanna insert specification of members that enter in textboxs of form in the database .i do this operation with jquery ajax when i call webmetod with static value the operation do successfully.for example this code is ok. $.ajax({ type: "POST", url:"MethodInvokeWithJQuery.aspx/executeinsert", data: '{ "username": "user1", "name":"john","family":"michael","password":"123456","email": "[email protected]", "tel": "123456", "codemeli": "123" }', contentType: "application/json; charset=utf-8", dataType: "json", async: true, cache: false, success: function (msg) { $('#myDiv2').text(msg.d); }, error: function (x, e) { alert("The call to the server side failed. " + x.responseText); } } ); but when i wanna use of values that enter in textboxes dynamically error occur.whats problem?i try this two code <script type="text/javascript"> $(document).ready( function () { $("#Button1").click( function () { var username, family, name, email, tel, codemeli, password; username = $('#<%=TextBox1.ClientID%>').val(); name = $('#<%=TextBox2.ClientID%>').val(); family = $('#<%=TextBox3.ClientID%>').val(); password = $('#<%=TextBox4.ClientID%>').val(); email = $('#<%=TextBox5.ClientID%>').val(); tel = $('#<%=TextBox6.ClientID%>').val(); codemeli = $('#<%=TextBox7.ClientID%>').val(); $.ajax( { type: "POST", url: "WebApplication20.aspx/executeinsert", data: "{'username':'username','name':name, 'family':family,'password':password, 'email':email,'tel':tel, 'codemeli':codemeli}", contentType: "application/json;charset=utf-8", dataType: "json", async: true, cache: false, success: function(msg) { alert(msg); }, error: function (x, e) { alert("The call to the server side failed. " + x.responseText); } } ); } ) }) </script> or $(document).ready( function () { $("#Button1").click( function () { var username, family, name, email, tel, codemeli, password; username = $('#<%=TextBox1.ClientID%>').val(); name = $('#<%=TextBox2.ClientID%>').val(); family = $('#<%=TextBox3.ClientID%>').val(); password = $('#<%=TextBox4.ClientID%>').val(); email = $('#<%=TextBox5.ClientID%>').val(); tel = $('#<%=TextBox6.ClientID%>').val(); codemeli = $('#<%=TextBox7.ClientID%>').val(); $.ajax( { type: "POST", url: "WebApplication20.aspx/executeinsert", data: '{"username" : '+username+', "name": '+name+', "family": '+family+', "password": '+password+', "email": '+email+', "tel": '+tel+' , "codemeli": '+codemeli+'}', contentType: "application/json;charset=utf-8", dataType: "json", async: true, cache: false, success: function(msg) { alert(msg); }, error: function (x, e) { alert("The call to the server side failed. " + x.responseText); } } ); } ) })

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • Working with friends. Poor career choice?

    - by a_person
    Hi all, Hope you can help me solve somewhat of a moral dilemma. Some time ago, after just a few years of living in U.S. and having to take any job I could get my hands on a friend of mine submitted recommended me for an open position at the company that he was working for. I could have not been happier. I do not have a degree of any sort, however, by being passionate about CS and with constant drive for self education I've became a somewhat of a strong generalist. Every place I worked for recognized me for that quality and used me on various projects where set of technology in hand had no overlap with set of knowledge of the team members. Rapidly I've advanced to Sr. Programmer position and the trend of me following a friend from one place to another have started and continued on for a few years. My friend's goal always been to become an IT Director, mine is to become the best programmer I can be. To my knowledge I've accommodated his goals as much as I could by taking a back seat, and letting him take the lead. Fast forward to today. He's a manager, and I am on his team. I am unhappy and I in considerable amount of suffering. I am not being utilized to my potential, it's almost exact opposite, I am being micromanaged to an unhealthy extent, my decisions, and suggestions are constantly met with negative connotation. Last week I had to hear about how my friend is a better programmer than I am. My ego was ecstatic about this one /s. In addition to that working in the field of BI have exhausted itself for most parts. The only pleasure of my work is being derived from making everything as dynamic and parameter driven as possible. This is the only area where a friend of mine does not feel competent enough to actually micromanage. Because of my situation I feel a fair amount of guilt and ever growing resentment. I need your advice, maybe you've dealt with this expression of ego before, needs of self vs the needs of your friend. Is working with a friend a poor choice? Thank you for reading in.

    Read the article

  • Combobox INotifyPropertyChanged event not raised!!!

    - by nagiah
    I created a combobox and set observable collection as the itemsource and implemented INotifyPropertyChanged on the observable collection item. Even after that, when I select different item in the combobox, the OnPropertyChange method is not invoked. I think I am not making the binding properly. Could any one please correct me/ suggest me in this regard. ---------------------------------MainPage.xaml--------------------------------------------------- <StackPanel Width="300"> <ComboBox Name="cboName"></ComboBox> <TextBox Name="tbxName" Text="{Binding Path=name,Mode=TwoWay,ElementName=cboName}" ></TextBox> </StackPanel> ---------------------------MainPage.xaml.cs----------------------------------------------- using System; using System.Collections.Generic; using System.Linq; using System.Net; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; using System.Collections.ObjectModel; using System.Collections.Specialized; using System.ComponentModel; namespace MasterDetailsUpdate { public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); Loaded += new RoutedEventHandler(MainPage_Loaded); } void MainPage_Loaded(object sender, RoutedEventArgs e) { ObservableCollection<Person> persons = new ObservableCollection<Person>(); persons.Add(new Person { city = "c1", name = "n1" }); persons.Add(new Person { city = "c2", name = "n2" }); persons.Add(new Person { city = "c3", name = "" }); persons.Add(new Person { city = "c4", name = "" }); persons.Add(new Person { city = "c5", name = "n1" }); cboName.ItemsSource = persons; cboName.DisplayMemberPath = "name"; } } public class Person : INotifyPropertyChanged { private string _name; private string _city; public string name { set { _name = value; OnPropertyChanged("name"); } get { return _name; } } public string city { set { _city = value; OnPropertyChanged("city"); } get { return _city; } } #region INotifyPropertyChanged Members public event PropertyChangedEventHandler PropertyChanged; private void OnPropertyChanged(string propertyName) { if (PropertyChanged != null) { this.PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } #endregion } } Thank You

    Read the article

  • C++ Undeclared Identifier (but it is declared?)

    - by Joshua
    I'm pretty sure I've included the qanda class, but when I try to declare a vector that contains it or a class of that type I get an error saying that qanda is undefined. Any idea what the problem might be? bot_manager_item.h #pragma once #include "../bot_packet/bot_packet.h" #include <vector> class bot_manager_item; #include "qanda.h" #include "bot_manager.h" class bot_manager_item { public: bot_manager_item(bot_manager* mngr, const char* name, const char* work_dir); ~bot_manager_item(); bool startup(); void cleanup(); void on_push_event(bot_exchange_format f); bool disable; private: void apply_changes(); bot_manager *_mngr; std::string _name; std::string _work_dir; std::string _message; std::string _message_copy; std::vector<qanda> games; qanda test; char _config_full_path[2600]; }; qanda.h #ifndef Q_AND_A #define Q_AND_A #include "users.h" #include "..\bot_packet\bot_packet.h" #include "bot_manager.h" #include <string> #include <algorithm> #include <map> #include <vector> #include <fstream> class qanda { public: qanda(bot_manager * manager, std::string name, std::string directory); ~qanda(){}; void room_message(std::string username, std::string user_message); void timer_tick(); private: // data members std::string question; std::string answer; std::string directory; std::string command_prefix; std::string name; Users users; std::map <std::string, std::string> questions_and_answers; int time_per_question; // seconds int time_between_questions; // seconds int timer; // milliseconds bool is_delayed; bool is_playing; bot_manager * manager; // functions void new_question(); void send_message(std::string msg); void announce_question(); void load_questions(); }; #endif

    Read the article

  • jquery buttons icons for dialog

    - by khinester
    I have this code: $(function() { var mainButtons = [ {text: "Invite" , 'class': 'invite-button' , click: function() { // get list of members alert('Invite was clicked...'); } } // end Invite button , {text: "Options" , 'class': 'options-button' , click: function() { alert('Options...'); } } // end Options button ] // end mainButtons , commentButtons = [ {text: "Clear" , 'class': 'clear-button' , click: function() { $('#comment').val('').focus().select(); } } // end Clear button , {text: "Post comment" , 'class': 'post-comment-button' , click: function() { alert('send comment...'); } } // end Post comment ] // end commentButtons $( "#form" ).dialog({ autoOpen: false , height: 465 , width: 700 , modal: true , position: ['center', 35] , buttons: mainButtons }); $( "#user-form" ) .button() .click(function() { $(this).effect("transfer",{ to: $("#form") }, 1500); $( "#form" ).dialog( "open" ); $( ".invite-button" ).button({ icons: {primary:'ui-icon-person',secondary:'ui-icon-triangle-1-s'} }); $( ".options-button" ).button({ icons: {primary:'ui-icon-gear'} }); }); // Add comment... $("#comment, .comment").click(function(){ $('#comment').focus().select(); $("#form").dialog({buttons: commentButtons}); $( ".post-comment-button" ).button({ icons: {primary:'ui-icon-comment'} }); $( ".clear-button" ).button({ icons: {primary:'ui-icon-refresh'} }); }); //Add comment // Bind back the Invite, Options buttons $(".files, .email, .event, .map").click(function(){ $("#form").dialog({buttons: mainButtons}); $( ".invite-button" ).button({ icons: {primary:'ui-icon-person',secondary:'ui-icon-triangle-1-s'} }); $( ".options-button" ).button({ icons: {primary:'ui-icon-gear'} }); }); // Tabs $( "#tabs" ).tabs(); $( ".tabs-bottom .ui-tabs-nav, .ui-tabs-nav > *" ) .removeClass( "ui-widget-header" ) .addClass( "ui-corner-bottom" ); }); ? What is the right way to add the button icons? As in my code I had to add it two times, once: $( "#user-form" ) .button() .click(function() { $(this).effect("transfer",{ to: $("#form") }, 1500); $( "#form" ).dialog( "open" ); ... and $(".files, .email, .event, .map").click(function(){ ... Could this code be improved further? I don't seem to be able to get the "transfer" effect to work correctly in a modal. I added: , close: function() { $(this).effect("transfer",{ to: $("#user-form") }, 1500); } to the $( "#form" ).dialog({ How would you go about in getting the "transfer" to work nicely when you open and close the dialog box?

    Read the article

  • Sandbox "Sorry — your last action could not be completed"

    - by aron
    My site was working fine with PayPal's sandbox, and then all of a sudden it stopped. Now I get the wonderful error Sandbox "Sorry — your last action could not be completed" This is my HTML: <body onload="document.Paypal.submit();"> <!-- item_number should get passed back --> <form name="Paypal" method="post" action="https://www.sandbox.paypal.com cgi-bin/webscr" id="Paypal"> <div> <input type="hidden" name="__VIEWSTATE" id="__VIEWSTATE" value="/wEPDwUKLTkyNTEyNzc0NGRk0LKGvSMTla6LgHpbOsdk7iC0iXE=" /> </div> <div> <input type="hidden" name="__EVENTVALIDATION" id="__EVENTVALIDATION" value="/wEWCALKhatPArLPtrsEAreImG4CweeH+AkCgMPhowcC+NaM4gQC+Y2VqwoCouzSnwEVXI9UvQxqI2UcdQ4SmcSWqfEZNw==" /> </div> <input type="hidden" name="cmd" value="_cart" /> <input type="hidden" name="upload" value="1" /> <!-- The following is for itemized PayPal data instead of the aggregated version --> <input type="hidden" name="item_name_1" value="LEADING SKILLS 4/10/2012 6:00 PM Section: Members " /> <input type="hidden" name="amount_1" value="250.00" /> <input type="hidden" name="quantity_1" value="2" /> <input type="hidden" name="handling_cart" value="7.00" /> <input type="hidden" name="tax_cart" value="35.00" /> <!-- STANDARD DATA --> <input name="business" type="hidden" id="business" value="[email protected]" /> <input name="invoice" type="hidden" id="invoice" value="TS-1E8B59A0-B" /> <input type="hidden" name="no_note" value="0" /> <input name="currency_code" type="hidden" id="currency_code" value="USD" /> <input name="shipCountry" type="hidden" id="shipCountry" /> <input type="hidden" name="return" value="http://rockclimbing.venueblue.com/Gateway/paypal/Complete.aspx?id=db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="cancel_returnUrl" type="hidden" id="cancel_returnUrl" value="http://rockclimbing.venueblue.com/ShoppingCart.aspx" /> <input type="hidden" name="cn" value="How did you hear about us?" /> <input name="custom" type="hidden" id="custom" value="db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="notify_url" type="hidden" id="notify_url" value="http://rockclimbing.venueblue.com/Gateway/Paypal/IPN.aspx" /> <input type="submit" value="Submit Payment Info" style="display:none;" /> Processing Order.... </form> </body> Anyone have a clue what happened?

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • Objective-C Basic class related question, retaining the value of a specific object using a class fil

    - by von steiner
    Members, scholars, code gurus. My background is far from any computer programming thus my question may seems basic and somewhat trivial to you. Nevertheless it seems that I can't put my head around it. I have googled and searched for the answer, just to get myself confused even more. With that, I would kindly ask for a simple explanation suitable for a non technical person such as myself and for other alike arriving to this thread. I have left a comment with the text "Here is the issue" below, referring to my question. // character.h #import <Foundation/Foundation.h> @interface character : NSObject { NSString *name; int hitPoints; int armorClass; } @property (nonatomic,retain) NSString *name; @property int hitPoints,armorClass; -(void)giveCharacterInfo; @end // character.m #import "character.h" @implementation character @synthesize name,hitPoints,armorClass; -(void)giveCharacterInfo{ NSLog(@"name:%@ HP:%i AC:%i",name,hitPoints,armorClass); } @end // ClassAtLastViewController.h #import <UIKit/UIKit.h> @interface ClassAtLastViewController : UIViewController { } -(void)callAgain; @end // ClassAtLastViewController.m #import "ClassAtLastViewController.h" #import "character.h" @implementation ClassAtLastViewController - (void)viewDidLoad { //[super viewDidLoad]; character *player = [[character alloc]init]; player.name = @"Minsc"; player.hitPoints = 140; player.armorClass = 10; [player giveCharacterInfo]; [player release]; // Up until here, All peachy! [self performSelector:@selector(callAgain) withObject:nil afterDelay:2.0]; } -(void)callAgain{ // Here is the issue, I assume that since I init the player again I loss everything // Q1. I loss all the data I set above, where is it than? // Q2. What is the proper way to implement this character *player = [[character alloc]init]; [player giveCharacterInfo]; } Many thanks in advance, Kindly remember that my background is more related to Salmons breeding than to computer code, try and lower your answer to my level if it's all the same to you.

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • How do you return a pointer to a base class with a virtual function?

    - by Nick Sweet
    I have a base class called Element, a derived class called Vector, and I'm trying to redefine two virtual functions from Element in Vector. //element.h template <class T> class Element { public: Element(); virtual Element& plus(const Element&); virtual Element& minus(const Element&); }; and in another file //Vector.h #include "Element.h" template <class T> class Vector: public Element<T> { T x, y, z; public: //constructors Vector(); Vector(const T& x, const T& y = 0, const T& z =0); Vector(const Vector& u); ... //operations Element<T>& plus(const Element<T>& v) const; Element<T>& minus(const Element<T>& v) const; ... }; //sum template <class T> Element<T>& Vector<T>::plus(const Element<T>& v) const { Element<T>* ret = new Vector((x + v.x), (y + v.y), (z + v.z)); return *ret; } //difference template <class T> Element<T>& Vector<T>::minus(const Element<T>& v) const { Vector<T>* ret = new Vector((x - v.x), (y - v.y), (z - v.z)); return *ret; } but I always get error: 'const class Element' has no member named 'getx' So, can I define my virtual functions to take Vector& as an argument instead, or is there a way for me to access the data members of Vector through a pointer to Element? I'm still fairly new to inheritance polymorphism, fyi.

    Read the article

  • FluentNHibernate - AutoMappings producing incorrect one-to-many column key

    - by Alberto
    Hi I'm new to NHibernate and FNH and am trying to map these simple classes by using FluentNHibernate AutoMappings feature: public class TVShow : Entity { public virtual string Title { get; set;} public virtual ICollection<Season> Seasons { get; protected set; } public TVShow() { Seasons = new HashedSet<Season>(); } public virtual void AddSeason(Season season) { season.TVShow = this; Seasons.Add(season); } public virtual void RemoveSeason(Season season) { if (!Seasons.Contains(season)) { throw new InvalidOperationException("This TV Show does not contain the given season"); } season.TVShow = null; Seasons.Remove(season); } } public class Season : Entity { public virtual TVShow TVShow { get; set; } public virtual int Number { get; set; } public virtual IList<Episode> Episodes { get; set; } public Season() { Episodes = new List<Episode>(); } public virtual void AddEpisode(Episode episode) { episode.Season = this; Episodes.Add(episode); } public virtual void RemoveEpisode(Episode episode) { if (!Episodes.Contains(episode)) { throw new InvalidOperationException("Episode not found on this season"); } episode.Season = null; Episodes.Remove(episode); } } I'm also using a couple of conventions: public class MyForeignKeyConvention : IReferenceConvention { #region IConvention<IManyToOneInspector,IManyToOneInstance> Members public void Apply(FluentNHibernate.Conventions.Instances.IManyToOneInstance instance) { instance.Column("fk_" + instance.Property.Name); } #endregion } The problem is that FNH is generating the section below for the Seasons property mapping: <bag name="Seasons"> <key> <column name="TVShow_Id" /> </key> <one-to-many class="TVShowsManager.Domain.Season, TVShowsManager.Domain, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null" /> </bag> The column name above should be fk_TVShow rather than TVShow_Id. If amend the hbm files produced by FNH then the code works. Does anyone know what it's wrong? Thanks in advance.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Why is this simple Mobile Form not closed when using the player

    - by ajhvdb
    Hi, I created this simple sample Form with the close button. Everything is working as expected when NOT using the Interop.WMPLib.dll I've seen other applications using this without problems but why isn't the Form process closed when I just add the line: SoundPlayer myPlayer = new SoundPlayer(); and of course dispose it: if (myPlayer != null) { myPlayer.Dispose(); myPlayer = null; } The Form closes but the debugger VS2008 is still active. The Form project and the dll are still active. If you send me an email to [email protected], I can send you the zipped project. Below is the class for the dll: using System; using System.Collections.Generic; using System.Text; using System.Threading; using System.Runtime.InteropServices; using WMPLib; namespace WindowsMobile.Utilities { public delegate void SoundPlayerStateChanged(SoundPlayer sender, SoundPlayerState newState); public enum SoundPlayerState { Stopped, Playing, Paused, } public class SoundPlayer : IDisposable { [DllImport("coredll")] public extern static int waveOutSetVolume(int hwo, uint dwVolume); [DllImport("coredll")] public extern static int waveOutGetVolume(int hwo, out uint dwVolume); WindowsMediaPlayer myPlayer = new WindowsMediaPlayer(); public SoundPlayer() { myPlayer.uiMode = "invisible"; myPlayer.settings.volume = 100; } string mySoundLocation = string.Empty; public string SoundLocation { get { return mySoundLocation; } set { mySoundLocation = value; } } public void Pause() { myPlayer.controls.pause(); } public void PlayLooping() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.settings.setMode("loop", true); } public int Volume { get { return myPlayer.settings.volume; } set { myPlayer.settings.volume = value; } } public void Play() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.controls.play(); } public void Stop() { myPlayer.controls.stop(); myPlayer.close(); } #region IDisposable Members public void Dispose() { try { Stop(); } catch (Exception) { } // need this otherwise the process won't exit?! try { int ret = Marshal.FinalReleaseComObject(myPlayer); } catch (Exception) { } myPlayer = null; GC.Collect(); } #endregion } }

    Read the article

  • How to use command bindings in user controls in wpf?

    - by Sam
    In MainWindow the commandbinding works fine. In UserControl1 it doesnt work. Note the datacontext is set correctly as is evidenced by the content of the button which is the result of a binding. I am not trying to bind the command in the usercontrol to a command in mainwindow or any other such trickery. I am just trying to replicate what I did in MainWindow in UserControl1. // MainWindow xaml <StackPanel> <Button Content="Click Here" Command="{Binding ClickHereCommand}" Height="25" Width="90"></Button> <local:UserControl1></local:UserControl1> </StackPanel> // MainWindow public partial class MainWindow : Window { public static RoutedCommand ClickHereCommand { get; set; } public MainWindow() { InitializeComponent(); this.DataContext = this; ClickHereCommand = new RoutedCommand(); CommandBindings.Add(new CommandBinding(ClickHereCommand, ClickHereExecuted)); } public void ClickHereExecuted(object sender, ExecutedRoutedEventArgs e) { System.Windows.MessageBox.Show("hello"); } } // UserControl1 xaml <UserControl x:Class="CommandBindingTest.UserControl1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" mc:Ignorable="d" d:DesignHeight="300" d:DesignWidth="300" x:Name="root"> <Grid DataContext="{Binding ElementName=root}" > <Button Content="{Binding ButtonContent}" Command="{Binding ClickHereCommand}" Height="25" Width="90"></Button> </Grid> </UserControl> // UserControl1 public partial class UserControl1 : UserControl, INotifyPropertyChanged { private string _ButtonContent; public string ButtonContent { get { return _ButtonContent; } set { if (_ButtonContent != value) { _ButtonContent = value; OnPropertyChanged("ButtonContent"); } } } public static RoutedCommand ClickHereCommand { get; set; } public UserControl1() { InitializeComponent(); ClickHereCommand = new RoutedCommand(); CommandBindings.Add(new CommandBinding(ClickHereCommand, ClickHereExecuted)); ButtonContent = "Click Here"; } public void ClickHereExecuted(object sender, ExecutedRoutedEventArgs e) { System.Windows.MessageBox.Show("hello from UserControl1"); } #region INotifyPropertyChanged Members public event PropertyChangedEventHandler PropertyChanged; public void OnPropertyChanged(string name) { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(name)); } } #endregion }

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • PHP-MySQL: Arranging rows from seperate tables together/Expression to determine row origin

    - by Koroviev
    I'm new to PHP and have a two part question. I need to take rows from two separate tables, and arrange them in descending order by their date. The rows do not correspond in order or number and have no relationship with each other. ---EDIT--- They each contain updates on a site, one table holds text, links, dates, titles etc. from a blog. The other has titles, links, specifications, etc. from images. I want to arrange some basic information (title, date, small description) in an updates section on the main page of the site, and for it to be in order of date. Merging them into one table and modifying it to suit both types isn't what I'd like to do here, the blog table is Wordpress' standard wp_posts and I don't feel comfortable adding columns to make it suit the image table too. I'm afraid it could clash with upgrading later on and it seems like a clumsy solution (but that doesn't mean I'll object if people here advise me it's the best solution). ------EDIT 2------ Here are the DESCRIBES of each table: mysql> describe images; +---------+--------------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +---------+--------------+------+-----+-------------------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | project | varchar(255) | NO | | NULL | | | title | varchar(255) | NO | | NULL | | | time | timestamp | NO | | CURRENT_TIMESTAMP | | | img_url | varchar(255) | NO | | NULL | | | alt_txt | varchar(255) | YES | | NULL | | | text | text | YES | | NULL | | | text_id | int(11) | YES | | NULL | | +---------+--------------+------+-----+-------------------+----------------+ mysql> DESCRIBE wp_posts; +-----------------------+---------------------+------+-----+---------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +-----------------------+---------------------+------+-----+---------------------+----------------+ | ID | bigint(20) unsigned | NO | PRI | NULL | auto_increment | | post_author | bigint(20) unsigned | NO | | 0 | | | post_date | datetime | NO | | 0000-00-00 00:00:00 | | | post_date_gmt | datetime | NO | | 0000-00-00 00:00:00 | | | post_content | longtext | NO | | NULL | | | post_title | text | NO | | NULL | | | post_excerpt | text | NO | | NULL | | | post_status | varchar(20) | NO | | publish | | | comment_status | varchar(20) | NO | | open | | | ping_status | varchar(20) | NO | | open | | | post_password | varchar(20) | NO | | | | | post_name | varchar(200) | NO | MUL | | | | to_ping | text | NO | | NULL | | | pinged | text | NO | | NULL | | | post_modified | datetime | NO | | 0000-00-00 00:00:00 | | | post_modified_gmt | datetime | NO | | 0000-00-00 00:00:00 | | | post_content_filtered | text | NO | | NULL | | | post_parent | bigint(20) unsigned | NO | MUL | 0 | | | guid | varchar(255) | NO | | | | | menu_order | int(11) | NO | | 0 | | | post_type | varchar(20) | NO | MUL | post | | | post_mime_type | varchar(100) | NO | | | | | comment_count | bigint(20) | NO | | 0 | | +-----------------------+---------------------+------+-----+---------------------+----------------+ ---END EDIT--- I can do this easily with a single table like this (I include it here in case I'm using an over-elaborate method without knowing it): $content = mysql_query("SELECT post_title, post_text, post_date FROM posts ORDER BY post_date DESC"); while($row = mysql_fetch_array($content)) { echo $row['post_date'], $row['post_title'], $row['post_text']; } But how is it possible to call both tables into the same array to arrange them correctly? By correctly, I mean that they will intermix their echoed results based on their date. Maybe I'm looking at this from the wrong perspective, and calling them to a single array isn't the answer? Additionally, I need a way to form a conditional expression based on which table they came from, so that rows from table 1 get echoed differently than rows from table 2? I want results from table 1 to be echoed differently (with different strings concatenated around them, I mean) for the purpose of styling them differently than those from table two. And vice versa. I know an if...else statement would work here, but I have no idea how can I write the expression that would determine which table the row is from. All and any help is appreciated, thanks.

    Read the article

< Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >