Search Results

Search found 14184 results on 568 pages for 'peter small'.

Page 239/568 | < Previous Page | 235 236 237 238 239 240 241 242 243 244 245 246  | Next Page >

  • Free library to generate excel chart in .NET

    - by SchmerZ
    Hi to all. I need a free library (or not too expensive) for .NET to work with the excel document. I need to read data, modify, save and add charts into the document. Or in another way, I need a free library for creating and inserting charts into the excel document (only for charts). I have found FlexCel and SmartXLS, but FlexCel doesn't support the charts (can't create), while SmartXLS has a small functionality. Thanks for any help.

    Read the article

  • are the A+ and MCSE courses worthwhile

    - by billy
    I'm new to this field and would like to acquire the knowledge necessary to work for myself, troubleshooting, repairs, setting up and maintaining networks for small businesses etc. Are the A+ and MCSE courses worth doing? I'm more interested in knowledge than certificates.

    Read the article

  • Summary of changes for each API level?

    - by MisterSquonk
    As the title says, are there any sources (web pages etc) of summarised changes at each API level? I have an app which I've put out to a small group of beta testers and I already fell foul of Environment.getExternalFilesDir(), which I hadn't noticed was introduced in API Level 8, when a couple of the guys tried it on Android v2.1 devices. The majority of my code should be pretty generic but it would be useful if I could find a condensed/summarised list/table or similar that I can quickly glance over.

    Read the article

  • Good TFS Hosting Provider

    - by JonnyD
    I'm looking for a good 3rd party host for Team Foundation Server. Have any of you had good or bad experiences in the past? Will be working on a small .NET project with several other guys in different locations. Are there any performance problems or any other "gotchas" with 3rd party hosting?

    Read the article

  • Excessive use of Inner Join for more than 3 tables

    - by Archangel08
    Good Day, I have 4 tables on my DB (not the actual name but almost similar) which are the ff: employee,education,employment_history,referrence employee_id is the name of the foreign key from employee table. Here's the example (not actual) data: **Employee** ID Name Birthday Gender Email 1 John Smith 08-15-2014 Male [email protected] 2 Jane Doe 00-00-0000 Female [email protected] 3 John Doe 00-00-0000 Male [email protected] **Education** Employee_ID Primary Secondary Vocation 1 Westside School Westshore H.S SouthernBay College 2 Eastside School Eastshore H.S NorthernBay College 3 Northern School SouthernShore H.S WesternBay College **Employment_History** Employee_ID WorkOne StartDate Enddate 1 StarBean Cafe 12-31-2012 01-01-2013 2 Coffebucks Cafe 11-01-2012 11-02-2012 3 Latte Cafe 01-02-2013 04-05-2013 Referrence Employee_ID ReferrenceOne Address Contact 1 Abraham Lincoln Lincoln Memorial 0000000000 2 Frankie N. Stein Thunder St. 0000000000 3 Peter D. Pan Neverland Ave. 0000000000 NOTE: I've only included few columns though the rest are part of the query. And below are the codes I've been working on for 3 consecutive days: $sql=mysql_query("SELECT emp.id,emp.name,emp.birthday,emp.pob,emp.gender,emp.civil,emp.email,emp.contact,emp.address,emp.paddress,emp.citizenship,educ.employee_id,educ.elementary,educ.egrad,educ.highschool,educ.hgrad,educ.vocational,educ.vgrad,ems.employee_id,ems.workOne,ems.estartDate,ems.eendDate,ems.workTwo,ems.wstartDate,ems.wendDate,ems.workThree,ems.hstartDate,ems.hendDate FROM employee AS emp INNER JOIN education AS educ ON educ.employee_id='emp.id' INNER JOIN employment_history AS ems ON ems.employee_id='emp.id' INNER JOIN referrence AS ref ON ref.employee_id='emp.id' WHERE emp.id='$id'"); Is it okay to use INNER JOIN this way? Or should I modify my query to get the results that I wanted? I've also tried to use LEFT JOIN but still it doesn't return anything .I didn't know where did I go wrong. You see, as I have thought, I've been using the INNER JOIN in correct manner, (since it was placed before the WHILE CLAUSE). So I couldn't think of what could've possible went wrong. Do you guys have a suggestion? Thanks in advance.

    Read the article

  • JQuery autocomplete problem

    - by heffaklump
    Im using JQuerys Autocomplete plugin, but it doesn't autocomplete upon entering anything. Any ideas why it doesnt work? The basic example works, but not mine. var ppl = {"ppl":[{"name":"peterpeter", "work":"student"}, {"name":"piotr","work":"student"}]}; var options = { matchContains: true, // So we can search inside string too minChars: 2, // this sets autocomplete to begin from X characters dataType: 'json', parse: function(data) { var parsed = []; data = data.ppl; for (var i = 0; i < data.length; i++) { parsed[parsed.length] = { data: data[i], // the entire JSON entry value: data[i].name, // the default display value result: data[i].name // to populate the input element }; } return parsed; }, // To format the data returned by the autocompleter for display formatItem: function(item) { return item.name; } }; $('#inputplace').autocomplete(ppl, options); Ok. Updated: <input type="text" id="inputplace" /> So, when entering for example "peter" in the input field. No autocomplete suggestions appear. It should give "peterpeter" but nothing happens. And one more thing. Using this example works perfectly. var data = "Core Selectors Attributes Traversing Manipulation CSS Events Effects Ajax Utilities".split(" "); $("#inputplace").autocomplete(data);

    Read the article

  • Seo friendly Accordion menu

    - by strakastroukas
    Hello, currently i use the accordion menu provided by the asp.net toolkit. The problem is that it is not Seo friendly. So what i am looking for is an accordion menu with the following characteristics. 1) Seo friendliness 2) Preserving of the selected index, on post-backs. 3) Small in k bytes 4) Free of charge Do you have anything in mind?

    Read the article

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • Consequences of an infinite loop on Google App Engine?

    - by Axidos
    I am not a Google App Engine user. However, I understand you're billed for CPU time and other resources. What are the consequences if you happen to create an infinite loop? Will Google ever terminate it, or will you have to do it yourself manually somehow? I'm a hobbyist developer worried about a small error that might end up costing hundreds.

    Read the article

  • Why won't the following haskell code compile?

    - by voxcogitatio
    I'm in the process of writing a small lisp interpreter in haskell. In the process i defined this datatype, to get a less typed number; data Number = _Int Integer | _Rational Rational | _Float Double deriving(Eq,Show) Compiling this fails with the following error: ERROR "types.hs":16 - Syntax error in data type declaration (unexpected `|') Line 16 is the line w. the first '|' in the code above.

    Read the article

  • Shopping Cart Suggestions Needed

    - by Maen
    I am building a small web app for a pharmacy to keep track of sales and stocks, so in short, in one page, the pharmacist will enter a bar-code and the item is displayed, pharmacist enters quantity (price will be automatically calculated) then next item and next and so on, I haven't worked with such a problem before so I would appreciate any advices/tips on how to do it, what to use and wither its already done in some tidy neat way I can just import into my page. Am using ASP.net and VB.net, SQL 2008 and all express withing Visual Web Developer (also ExpresS)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Images are not appeared in Firefox

    - by moon
    I create small web app and it works in IE but I tried in firefox many css layouts are unavailable and images are not appeared.To appear image and to work in both browsers,how can I handle.Please tell me the way .Thanks

    Read the article

  • Git is slow on startup

    - by Daniel Mahadi
    Hi, I have a small problem with git in my pc, I create a new folder and i start Git Bash, but it takes so long for it load git, as in it will show the command prompt but it need a while for the git line to show up. Any clue on this? Thanks

    Read the article

  • cannot run java app on mac properly

    - by sneha
    Hello everybody.. I have small problem..I created a java App in windows and my .jar consist of whole app..i copied this jar file to mac and executed it from there it works fine.. Java App consists of bonjour code if i execute .jar on windows it works fine and bonjour starts advertising...But,for mac the app runs fine but doesnot advertise the bonjourservice.. I am not understanding the difference..can anyone explain me y it is so?

    Read the article

  • xml to excel file

    - by Cmptrb
    Hi, I have a xml document holding a small data for my project where I want to convert my xml to an excel file (microsoft office excel 2003 and over) How can I do this? Kind Regards.

    Read the article

  • iPhone team dev, do we all need the same OS?

    - by aruwanwan
    I´m just starting iPhone development with a small team of (really young and naive) colleagues, we all are fairly new to OS X, my question is: If we are planning to develop for every iPod Touch/iPhone out there (not the iPad, I read that thing requires Snow Leopard), what problems will we encounter when sharing code (and making commits) if we all have a combination of Leopard and Snow Leopard systems?

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

  • Video Upload Applet

    - by Eric
    i am working on a small project that i need the ability to let users upload a video to my website or use a webcam to record a video and then upload it. i have seen this done on several sites (youtube,facebook etc) so i know that there is a java or flash applet that supports this. however i have not been able to find one. can anyone recommend a good flash or java based video uploader with these features?

    Read the article

  • App Engine Django Form Uniqueness Validation?

    - by GeekTantra
    Is there a simpler way to use uniqueness validation with Django Forms in AppEngine? I understand that performance would be problem if we keep an uniqueness constraint but since the amount of data being added is very small performance is not a big concern, rather development time is a concern here. Any help is appreciated.

    Read the article

< Previous Page | 235 236 237 238 239 240 241 242 243 244 245 246  | Next Page >