Search Results

Search found 8258 results on 331 pages for 'sequence points'.

Page 25/331 | < Previous Page | 21 22 23 24 25 26 27 28 29 30 31 32  | Next Page >

  • 3D points to quaternions

    - by Hubrus
    For the simplicity, we'll consider two 3D points, that moves one relatively to other, in time. Let's say: at moment t0, we have P1(0,0,0) and P2(0,2,0) at moment t1, P1 is still (0,0,0) but P2 changed to (0,2,2). From what I've understood reading about quaternions, is that, at moment t0, Q1 (representing P1) and Q2 (representing P2) will be both (0, 0, 0, 0). But at the moment t1, Q2 will become something else (w, x, y, z). How do I calculate the Q2 at t1 moment? I've googled a lot on this subject, but I was able to find only rotation between quaternions. I will appreciate any guidance. Thanks!

    Read the article

  • Help me validate these points regarding Ruby

    - by Bragaadeesh
    Hi, I have started learning Ruby for the past 2,3 weeks and I have come up with some findings on the language. Can someone please validate these points. Implemented in many other high level languages such as C, Java, .Net etc., Is slow for the obvious reason that it cannot beat any of the already known high level languages. Should never be compared with any other high level language. Not suitable for large applications. Completely open source and is in a budding state. Has a framework called Rails which claims that it would be good for Agile development Community out there is getting better day by day and finding help immediately should not be a problem as time goes by. Has significant changes between releases which many developers wont welcome right away. Running time cannot be comprehensively estimated since the language has several underlying implementation in several languages. Books are always outdated by the time when you finish them. Thanks.

    Read the article

  • A 3-D grid of regularly spaced points

    - by Jack
    I want to create a list containing the 3-D coords of a grid of regularly spaced points, each as a 3-element tuple. I'm looking for advice on the most efficient way to do this. In C++ for instance, I simply loop over three nested loops, one for each coordinate. In Matlab, I would probably use the meshgrid function (which would do it in one command). I've read about meshgrid and mgrid in Python, and I've also read that using numpy's broadcasting rules is more efficient. It seems to me that using the zip function in combination with the numpy broadcast rules might be the most efficient way, but zip doesn't seem to be overloaded in numpy.

    Read the article

  • How to skew/resize/distort an image given points within that image (iPhone)

    - by user544082
    I want to take an image in which there will be a quadrilateral, and skew or otherwise distort the entire image such that the object that was a quadrilateral is now a square or rectangle. I realize this will distort the image, and that is okay. I know how to skew or manipulate an image, but I can't conceptualize how this would be done given information regarding the coordinates of the four points that define the corners of a quadrilateral within the image itself. I can safely find those coordinates every time, so that part is a given. This is for an experimental iPhone app. Any help would be much appreciated.

    Read the article

  • JQuery: How to find what is between two text points

    - by Sarfraz
    Hello, Let's say I have this: <div id="wrapper"> <pre class="highlight"> $(function(){ // hide all links except for the first $('ul.child:not(:first)').hide(); $("a.slide:first").css("background-color","#FF9900"); /* The comment goes here. */ </pre> </div> With Jquery, I want to find what is in between: /* The comment goes here. */ Including those comment signs. So it should return: /* The comment goes here. */ How to do that, how to find text between two points? Thanks

    Read the article

  • Help me vaildate these points regarding Ruby

    - by Bragaadeesh
    Hi, I have started learning Ruby for the past 2,3 weeks and I have come up with some findings on the language. Can someone please validate these points. Implemented in many other high level languages such as C, Java, .Net etc., Is slow for the obvious reason that it cannot beat any of the already known high level languages. Should never be compared with any other high level language. Not suitable for large applications. Completely open source and is in a budding state. Has a framework called Rails which claims that it would be good for Agile development Community out there is getting better day by day and finding help immediately should not be a problem as time goes by. Has significant changes between releases which many developers wont welcome right away. Running time cannot be comprehensively estimated since the language has several underlying implementation in several languages. Books are always outdated by the time when you finish them. Thanks.

    Read the article

  • how to visualize (value, count) dataset with thousands data points

    - by user510040
    I have a file with 2 numeric columns: value and count. File may have 5000 rows. I do plot(value, count) to find the shape of distribution. But because there are too many data points the picture is not very clear. Do you know better visualization approach? Probably histograms or barplot with grouping close values on x axis will be the better way to look on data? I cannot figure out the syntax of using histogram or barplot for my case.

    Read the article

  • JGoodies HashMap

    - by JohnMcClane
    Hi, I'm trying to build a chart program using presentation model. Using JGoodies for data binding was relatively easy for simple types like strings or numbers. But I can't figure out how to use it on a hashmap. I'll try to explain how the chart works and what my problem is: A chart consists of DataSeries, a DataSeries consists of DataPoints. I want to have a data model and to be able to use different views on the same model (e.g. bar chart, pie chart,...). Each of them consists of three classes. For example: DataPointModel: holds the data model (value, label, category) DataPointViewModel: extends JGoodies PresentationModel. wraps around DataPointModel and holds view properties like font and color. DataPoint: abstract class, extends JComponent. Different Views must subclass and implement their own ui. Binding and creating the data model was easy, but i don't know how to bind my data series model. package at.onscreen.chart; import java.beans.PropertyChangeListener; import java.beans.PropertyChangeSupport; import java.beans.PropertyVetoException; import java.util.Collection; import java.util.HashMap; import java.util.Iterator; public class DataSeriesModel { public static String PROPERTY_DATAPOINT = "dataPoint"; public static String PROPERTY_DATAPOINTS = "dataPoints"; public static String PROPERTY_LABEL = "label"; public static String PROPERTY_MAXVALUE = "maxValue"; /** * holds the data points */ private HashMap dataPoints; /** * the label for the data series */ private String label; /** * the maximum data point value */ private Double maxValue; /** * the model supports property change notification */ private PropertyChangeSupport propertyChangeSupport; /** * default constructor */ public DataSeriesModel() { this.maxValue = Double.valueOf(0); this.dataPoints = new HashMap(); this.propertyChangeSupport = new PropertyChangeSupport(this); } /** * constructor * @param label - the series label */ public DataSeriesModel(String label) { this.dataPoints = new HashMap(); this.maxValue = Double.valueOf(0); this.label = label; this.propertyChangeSupport = new PropertyChangeSupport(this); } /** * full constructor * @param label - the series label * @param dataPoints - an array of data points */ public DataSeriesModel(String label, DataPoint[] dataPoints) { this.dataPoints = new HashMap(); this.propertyChangeSupport = new PropertyChangeSupport(this); this.maxValue = Double.valueOf(0); this.label = label; for (int i = 0; i < dataPoints.length; i++) { this.addDataPoint(dataPoints[i]); } } /** * full constructor * @param label - the series label * @param dataPoints - a collection of data points */ public DataSeriesModel(String label, Collection dataPoints) { this.dataPoints = new HashMap(); this.propertyChangeSupport = new PropertyChangeSupport(this); this.maxValue = Double.valueOf(0); this.label = label; for (Iterator it = dataPoints.iterator(); it.hasNext();) { this.addDataPoint(it.next()); } } /** * adds a new data point to the series. if the series contains a data point with same id, it will be replaced by the new one. * @param dataPoint - the data point */ public void addDataPoint(DataPoint dataPoint) { String category = dataPoint.getCategory(); DataPoint oldDataPoint = this.getDataPoint(category); this.dataPoints.put(category, dataPoint); this.setMaxValue(Math.max(this.maxValue, dataPoint.getValue())); this.propertyChangeSupport.firePropertyChange(PROPERTY_DATAPOINT, oldDataPoint, dataPoint); } /** * returns the data point with given id or null if not found * @param uid - the id of the data point * @return the data point or null if there is no such point in the table */ public DataPoint getDataPoint(String category) { return this.dataPoints.get(category); } /** * removes the data point with given id from the series, if present * @param category - the data point to remove */ public void removeDataPoint(String category) { DataPoint dataPoint = this.getDataPoint(category); this.dataPoints.remove(category); if (dataPoint != null) { if (dataPoint.getValue() == this.getMaxValue()) { Double maxValue = Double.valueOf(0); for (Iterator it = this.iterator(); it.hasNext();) { DataPoint itDataPoint = it.next(); maxValue = Math.max(itDataPoint.getValue(), maxValue); } this.setMaxValue(maxValue); } } this.propertyChangeSupport.firePropertyChange(PROPERTY_DATAPOINT, dataPoint, null); } /** * removes all data points from the series * @throws PropertyVetoException */ public void removeAll() { this.setMaxValue(Double.valueOf(0)); this.dataPoints.clear(); this.propertyChangeSupport.firePropertyChange(PROPERTY_DATAPOINTS, this.getDataPoints(), null); } /** * returns the maximum of all data point values * @return the maximum of all data points */ public Double getMaxValue() { return this.maxValue; } /** * sets the max value * @param maxValue - the max value */ protected void setMaxValue(Double maxValue) { Double oldMaxValue = this.getMaxValue(); this.maxValue = maxValue; this.propertyChangeSupport.firePropertyChange(PROPERTY_MAXVALUE, oldMaxValue, maxValue); } /** * returns true if there is a data point with given category * @param category - the data point category * @return true if there is a data point with given category, otherwise false */ public boolean contains(String category) { return this.dataPoints.containsKey(category); } /** * returns the label for the series * @return the label for the series */ public String getLabel() { return this.label; } /** * returns an iterator over the data points * @return an iterator over the data points */ public Iterator iterator() { return this.dataPoints.values().iterator(); } /** * returns a collection of the data points. the collection supports removal, but does not support adding of data points. * @return a collection of data points */ public Collection getDataPoints() { return this.dataPoints.values(); } /** * returns the number of data points in the series * @return the number of data points */ public int getSize() { return this.dataPoints.size(); } /** * adds a PropertyChangeListener * @param listener - the listener */ public void addPropertyChangeListener(PropertyChangeListener listener) { this.propertyChangeSupport.addPropertyChangeListener(listener); } /** * removes a PropertyChangeListener * @param listener - the listener */ public void removePropertyChangeListener(PropertyChangeListener listener) { this.propertyChangeSupport.removePropertyChangeListener(listener); } } package at.onscreen.chart; import java.beans.PropertyVetoException; import java.util.Collection; import java.util.Iterator; import com.jgoodies.binding.PresentationModel; public class DataSeriesViewModel extends PresentationModel { /** * default constructor */ public DataSeriesViewModel() { super(new DataSeriesModel()); } /** * constructor * @param label - the series label */ public DataSeriesViewModel(String label) { super(new DataSeriesModel(label)); } /** * full constructor * @param label - the series label * @param dataPoints - an array of data points */ public DataSeriesViewModel(String label, DataPoint[] dataPoints) { super(new DataSeriesModel(label, dataPoints)); } /** * full constructor * @param label - the series label * @param dataPoints - a collection of data points */ public DataSeriesViewModel(String label, Collection dataPoints) { super(new DataSeriesModel(label, dataPoints)); } /** * full constructor * @param model - the data series model */ public DataSeriesViewModel(DataSeriesModel model) { super(model); } /** * adds a data point to the series * @param dataPoint - the data point */ public void addDataPoint(DataPoint dataPoint) { this.getBean().addDataPoint(dataPoint); } /** * returns true if there is a data point with given category * @param category - the data point category * @return true if there is a data point with given category, otherwise false */ public boolean contains(String category) { return this.getBean().contains(category); } /** * returns the data point with given id or null if not found * @param uid - the id of the data point * @return the data point or null if there is no such point in the table */ public DataPoint getDataPoint(String category) { return this.getBean().getDataPoint(category); } /** * returns a collection of the data points. the collection supports removal, but does not support adding of data points. * @return a collection of data points */ public Collection getDataPoints() { return this.getBean().getDataPoints(); } /** * returns the label for the series * @return the label for the series */ public String getLabel() { return this.getBean().getLabel(); } /** * sets the max value * @param maxValue - the max value */ public Double getMaxValue() { return this.getBean().getMaxValue(); } /** * returns the number of data points in the series * @return the number of data points */ public int getSize() { return this.getBean().getSize(); } /** * returns an iterator over the data points * @return an iterator over the data points */ public Iterator iterator() { return this.getBean().iterator(); } /** * removes all data points from the series * @throws PropertyVetoException */ public void removeAll() { this.getBean().removeAll(); } /** * removes the data point with given id from the series, if present * @param category - the data point to remove */ public void removeDataPoint(String category) { this.getBean().removeDataPoint(category); } } package at.onscreen.chart; import java.beans.PropertyChangeEvent; import java.beans.PropertyChangeListener; import java.beans.PropertyVetoException; import java.util.Collection; import java.util.Iterator; import javax.swing.JComponent; public abstract class DataSeries extends JComponent implements PropertyChangeListener { /** * the model */ private DataSeriesViewModel model; /** * default constructor */ public DataSeries() { this.model = new DataSeriesViewModel(); this.model.addPropertyChangeListener(this); this.createComponents(); } /** * constructor * @param label - the series label */ public DataSeries(String label) { this.model = new DataSeriesViewModel(label); this.model.addPropertyChangeListener(this); this.createComponents(); } /** * full constructor * @param label - the series label * @param dataPoints - an array of data points */ public DataSeries(String label, DataPoint[] dataPoints) { this.model = new DataSeriesViewModel(label, dataPoints); this.model.addPropertyChangeListener(this); this.createComponents(); } /** * full constructor * @param label - the series label * @param dataPoints - a collection of data points */ public DataSeries(String label, Collection dataPoints) { this.model = new DataSeriesViewModel(label, dataPoints); this.model.addPropertyChangeListener(this); this.createComponents(); } /** * full constructor * @param model - the model */ public DataSeries(DataSeriesViewModel model) { this.model = model; this.model.addPropertyChangeListener(this); this.createComponents(); } /** * creates, binds and configures UI components. * data point properties can be created here as components or be painted in paintComponent. */ protected abstract void createComponents(); @Override public void propertyChange(PropertyChangeEvent evt) { this.repaint(); } /** * adds a data point to the series * @param dataPoint - the data point */ public void addDataPoint(DataPoint dataPoint) { this.model.addDataPoint(dataPoint); } /** * returns true if there is a data point with given category * @param category - the data point category * @return true if there is a data point with given category, otherwise false */ public boolean contains(String category) { return this.model.contains(category); } /** * returns the data point with given id or null if not found * @param uid - the id of the data point * @return the data point or null if there is no such point in the table */ public DataPoint getDataPoint(String category) { return this.model.getDataPoint(category); } /** * returns a collection of the data points. the collection supports removal, but does not support adding of data points. * @return a collection of data points */ public Collection getDataPoints() { return this.model.getDataPoints(); } /** * returns the label for the series * @return the label for the series */ public String getLabel() { return this.model.getLabel(); } /** * sets the max value * @param maxValue - the max value */ public Double getMaxValue() { return this.model.getMaxValue(); } /** * returns the number of data points in the series * @return the number of data points */ public int getDataPointCount() { return this.model.getSize(); } /** * returns an iterator over the data points * @return an iterator over the data points */ public Iterator iterator() { return this.model.iterator(); } /** * removes all data points from the series * @throws PropertyVetoException */ public void removeAll() { this.model.removeAll(); } /** * removes the data point with given id from the series, if present * @param category - the data point to remove */ public void removeDataPoint(String category) { this.model.removeDataPoint(category); } /** * returns the data series view model * @return - the data series view model */ public DataSeriesViewModel getViewModel() { return this.model; } /** * returns the data series model * @return - the data series model */ public DataSeriesModel getModel() { return this.model.getBean(); } } package at.onscreen.chart.builder; import java.util.Collection; import net.miginfocom.swing.MigLayout; import at.onscreen.chart.DataPoint; import at.onscreen.chart.DataSeries; import at.onscreen.chart.DataSeriesViewModel; public class BuilderDataSeries extends DataSeries { /** * default constructor */ public BuilderDataSeries() { super(); } /** * constructor * @param label - the series label */ public BuilderDataSeries(String label) { super(label); } /** * full constructor * @param label - the series label * @param dataPoints - an array of data points */ public BuilderDataSeries(String label, DataPoint[] dataPoints) { super(label, dataPoints); } /** * full constructor * @param label - the series label * @param dataPoints - a collection of data points */ public BuilderDataSeries(String label, Collection dataPoints) { super(label, dataPoints); } /** * full constructor * @param model - the model */ public BuilderDataSeries(DataSeriesViewModel model) { super(model); } @Override protected void createComponents() { this.setLayout(new MigLayout()); /* * * I want to add a new BuilderDataPoint for each data point in the model. * I want the BuilderDataPoints to be synchronized with the model. * e.g. when a data point is removed from the model, the BuilderDataPoint shall be removed * from the BuilderDataSeries * */ } } package at.onscreen.chart.builder; import javax.swing.JFormattedTextField; import javax.swing.JTextField; import at.onscreen.chart.DataPoint; import at.onscreen.chart.DataPointModel; import at.onscreen.chart.DataPointViewModel; import at.onscreen.chart.ValueFormat; import com.jgoodies.binding.adapter.BasicComponentFactory; import com.jgoodies.binding.beans.BeanAdapter; public class BuilderDataPoint extends DataPoint { /** * default constructor */ public BuilderDataPoint() { super(); } /** * constructor * @param category - the category */ public BuilderDataPoint(String category) { super(category); } /** * constructor * @param value - the value * @param label - the label * @param category - the category */ public BuilderDataPoint(Double value, String label, String category) { super(value, label, category); } /** * full constructor * @param model - the model */ public BuilderDataPoint(DataPointViewModel model) { super(model); } @Override protected void createComponents() { BeanAdapter beanAdapter = new BeanAdapter(this.getModel(), true); ValueFormat format = new ValueFormat(); JFormattedTextField value = BasicComponentFactory.createFormattedTextField(beanAdapter.getValueModel(DataPointModel.PROPERTY_VALUE), format); this.add(value, "w 80, growx, wrap"); JTextField label = BasicComponentFactory.createTextField(beanAdapter.getValueModel(DataPointModel.PROPERTY_LABEL)); this.add(label, "growx, wrap"); JTextField category = BasicComponentFactory.createTextField(beanAdapter.getValueModel(DataPointModel.PROPERTY_CATEGORY)); this.add(category, "growx, wrap"); } } To sum it up: I need to know how to bind a hash map property to JComponent.components property. JGoodies is in my opinion not very well documented, I spent a long time searching through the internet, but I did not find any solution to my problem. Hope you can help me.

    Read the article

  • Unescape _xHHHH_ XML escape sequences using Python

    - by John Machin
    I'm using Python 2.x [not negotiable] to read XML documents [created by others] that allow the content of many elements to contain characters that are not valid XML characters by escaping them using the _xHHHH_ convention e.g. ASCII BEL aka U+0007 is represented by the 7-character sequence u"_x0007_". Neither the functionality that allows representation of any old character in the document nor the manner of escaping is negotiable. I'm parsing the documents using cElementTree or lxml [semi-negotiable]. Here is my best attempt at unescapeing the parser output as efficiently as possible: import re def unescape(s, subber=re.compile(r'_x[0-9A-Fa-f]{4,4}_').sub, repl=lambda mobj: unichr(int(mobj.group(0)[2:6], 16)), ): if "_" in s: return subber(repl, s) return s The above is biassed by observing a very low frequency of "_" in typical text and a better-than-doubling of speed by avoiding the regex apparatus where possible. The question: Any better ideas out there?

    Read the article

  • Font not showing bullet points

    - by Hanpan
    I have embedded my font using the embed meta tag, along which the entire range of Unicode characters... here is my CustomTextField class: [Embed(source='../assets/fonts/Arial.ttf',fontName='CustomFont',fontWeight='regular', unicodeRange='U+0020-U+0040,U+0041-U+005A,U+005B-U+0060,U+0061-U+007A,U+007B-U+007E,U+0080-U+00FF,U+0100-U+017F,U+0400-U+04FF,U+0370-U+03FF,U+1E00-U+1EFF', mimeType='application/x-font-truetype' )] public static var MY_FONT:Class; [Embed(source='../assets/fonts/Arial Bold.ttf',fontName='CustomFont',fontWeight='bold', unicodeRange='U+0020-U+0040,U+0041-U+005A,U+005B-U+0060,U+0061-U+007A,U+007B-U+007E,U+0080-U+00FF,U+0100-U+017F,U+0400-U+04FF,U+0370-U+03FF,U+1E00-U+1EFF', mimeType='application/x-font-truetype' )] public static var MY_FONT_BOLD:Class; public static const DEFAULT_FONT:String = "CustomFont"; public static const DEFAULT_TEXT_COLOUR:int = 0x000000; public static const DEFAULT_TEXT_SIZE:int = 14; private var _tf:TextFormat = new TextFormat(DEFAULT_FONT, DEFAULT_TEXT_SIZE, DEFAULT_TEXT_COLOUR); public function CustomTextField():void { Font.registerFont(CustomTextField.MY_FONT); Font.registerFont(CustomTextField.MY_FONT_BOLD); _tf.size = 16; antiAliasType = AntiAliasType.ADVANCED; sharpness = 0; defaultTextFormat = _tf; autoSize = TextFieldAutoSize.LEFT; embedFonts = true; } public override function set htmlText(value:String):void { super.htmlText = value; setTextFormat(_tf); } For some reason, using tags intends the text perfectly, but I am not seeing any bullet points. The font is just standard Arial, so it isn't a case of the font missing the bullet character. Does anyone have any idea as to why Flex is not showing the bullet point characters?

    Read the article

  • How to draw a circle in java with a radius and points around the edge

    - by windopal
    Hi, I'm really stuck on how to go about programming this. I need to draw a circle within a JFrame with a radius and points around the circumference. i can mathematically calculate how to find the coordinates of the point around the edge but i cant seem to be able to program the circle. I am currently using a Ellipse2D method but that doesn't seem to work and doesn't return a radius, as under my understanding, it doesn't draw the circle from the center rather from a starting coordinate using a height and width. My current code is on a separate frame but i need to add it to my existing frame. import java.awt.*; import javax.swing.*; import java.awt.geom.*; public class circle extends JFrame { public circle() { super("circle"); setSize(410, 435); setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); Panel sp = new Panel(); Container content = getContentPane(); content.add(sp); setContentPane(content); setVisible(true); } public static void main (String args[]){ circle sign = new circle(); } } class Panel extends JPanel { public void paintComponent(Graphics comp) { super.paintComponent(comp); Graphics2D comp2D = (Graphics2D) comp; comp2D.setColor(Color.red); Ellipse2D.Float sign1 = new Ellipse2D.Float(0F, 0F, 350F, 350F); comp2D.fill(sign1); } }

    Read the article

  • Aligning decimal points in HTML

    - by ijw
    I have a table containing decimal numbers in one column. I'm looking to align them in a manner similar to a word processor's "decimal tab" feature, so that all the points sit on a vertical line. I have two possible solutions at the moment but I'm hoping for something better... Solution 1: Split the numbers within the HTML, e.g. <td><div>1234</div><div class='dp'>.5</div></td> with .dp { width: 3em; } (Yes, this solution doesn't quite work as-is. The concept is, however, valid.) Solution 2: I found mention of <COL ALIGN="CHAR" CHAR="."> This is part of HTML4 according to the reference page, but it doesn't work in FF3.5, Safari 4 or IE7, which are the browsers I have to hand. It also has the problem that you can't pull out the numeric formatting to CSS (although, since it's affecting a whole column, I suppose that's not too surprising). Thus, anyone have a better idea?

    Read the article

  • Conditionally colour data points outside of confidence bands in R

    - by D W
    I need to colour datapoints that are outside of the the confidence bands on the plot below differently from those within the bands. Should I add a separate column to my dataset to record whether the data points are within the confidence bands? Can you provide an example please? Example dataset: ## Dataset from http://www.apsnet.org/education/advancedplantpath/topics/RModules/doc1/04_Linear_regression.html ## Disease severity as a function of temperature # Response variable, disease severity diseasesev<-c(1.9,3.1,3.3,4.8,5.3,6.1,6.4,7.6,9.8,12.4) # Predictor variable, (Centigrade) temperature<-c(2,1,5,5,20,20,23,10,30,25) ## For convenience, the data may be formatted into a dataframe severity <- as.data.frame(cbind(diseasesev,temperature)) ## Fit a linear model for the data and summarize the output from function lm() severity.lm <- lm(diseasesev~temperature,data=severity) jpeg('~/Desktop/test1.jpg') # Take a look at the data plot( diseasesev~temperature, data=severity, xlab="Temperature", ylab="% Disease Severity", pch=16, pty="s", xlim=c(0,30), ylim=c(0,30) ) title(main="Graph of % Disease Severity vs Temperature") par(new=TRUE) # don't start a new plot ## Get datapoints predicted by best fit line and confidence bands ## at every 0.01 interval xRange=data.frame(temperature=seq(min(temperature),max(temperature),0.01)) pred4plot <- predict( lm(diseasesev~temperature), xRange, level=0.95, interval="confidence" ) ## Plot lines derrived from best fit line and confidence band datapoints matplot( xRange, pred4plot, lty=c(1,2,2), #vector of line types and widths type="l", #type of plot for each column of y xlim=c(0,30), ylim=c(0,30), xlab="", ylab="" )

    Read the article

  • Clojure: seq (cons) vs. list (conj)

    - by dbyrne
    I know that cons returns a seq and conj returns a collection. I also know that conj "adds" the item to the optimal end of the collection, and cons always "adds" the item to the front. This example illustrates both of these points: user=> (conj [1 2 3] 4) //returns a collection [1 2 3 4] user=> (cons 4 [1 2 3]) //returns a seq (4 1 2 3) For vectors, maps, and sets these differences make sense to me. However, for lists they seem identical. user=> (conj '(3 2 1) 4) (4 3 2 1) user=> (cons 4 '(3 2 1)) (4 3 2 1) Are there any examples using lists where conj vs. cons exhibit different behaviors, or are they truly interchangeable? Phrased differently, is there an example where a list and a seq cannot be used equivalently?

    Read the article

  • MATLAB plot moving data points in seperate subplots simutaneously

    - by Nate B.
    I wish to visualize the movement of a data point throughout space across a period of time within MATLAB. However, the way I want my figure to display is such that only a single instant is plotted at any given time. That was easy, I simply created a for loop to update my 3D plot display for every set of coordinates (x,y,z) in my data. However, I wish to display 4 different viewing angles of this plot at all times. I am well aware of how to setup subplots within MATLAB, that is not the issue. My issue is getting all 4 of these subplots to execute simultaneously so that all 4 subplots are always displaying the same point in time. I would appreciate if anyone could suggest how to handle this issue. As requested, my code for a figure with a single plot is shown below: datan = DATA; %data in form of x,y,z,a,b,c by column for row# of time points tib=zeros(size(datan,1),12); tib(:,1:3) = datan(:,1:3); tib_ref=tib(1,1:3); for i=1:size(datan,1) tib(i,1:3)=tib(i,1:3)-tib_ref; end angle_to_dircos close all figure('Name','Directions (Individual Cycles)','NumberTitle','off') for cc=1:2 hold off for bb=1:10:size(tib,1); scatter3(tib(bb,1),tib(bb,2),tib(bb,3),'green','filled'); %z and y axes are flipped in polhemus system hold on p0 = [tib(bb,1),tib(bb,2),tib(bb,3)]; p1 = [tib(bb,1)+10*tib(bb,4),tib(bb,2)+10*tib(bb,5),tib(bb,3)+10*tib(bb,6)]; p2 = [tib(bb,1)+10*tib(bb,7),tib(bb,2)+10*tib(bb,8),tib(bb,3)+10*tib(bb,9)]; p3 = [-(tib(bb,1)+100*tib(bb,10)),-(tib(bb,2)+100*tib(bb,11)),-(tib(bb,3)+100*tib(bb,12))]; vectarrow(p0,p1,1,0,0) hold on vectarrow(p0,p2,0,1,0) hold on vectarrow(p0,p3,0,0,1) hold on az = 90; el = 0; view(az, el); xlim([-50,50]); ylim([-50,50]); zlim([-50,50]); xlabel('distance from center in X'); ylabel('distance from center in Y'); zlabel('distance from center in Z'); title('XYZ Scatter Plots of Tracker Position'); hold on plot3(0,0,0,'sk','markerfacecolor',[0,0,0]); p0 = [0,0,0]; p1 = [10,0,0]; p2 = [0,10,0]; p3 = [0,0,100]; vectarrow(p0,p1,1,0,0) hold on vectarrow(p0,p2,0,1,0) hold on vectarrow(p0,p3,1,0,1) drawnow; end end

    Read the article

  • XY-Scatter Chart In SSRS Won't Display Points

    - by Dalin Seivewright
    I'm a bit confused with this one. I have a Dataset with a BackupDate and a BackupTime as well as a BackupType. The BackupDate is comprised of 12 characters from the left of a datetime string within a table. The BackupTime is comprised of 8 characters from the right of that same datetime string. So for example: BackupDate would be 'December 12 2008' and the BackupTime would be '12:53PM.' I have added an XY-scatter chart to the report. I've added a 'series' value for the BackupType (so one can distinguish between a Full/Incr/Log backup). I've added a category value of BackupDate and set the Scale for the X-axis from the Min of BackupDate to the Max of BackupDate. I've then added an item to the Values with the Y variable set to BackupTime and the X variable set to BackupDate. The interval for the Y-axis is 12:00AM to 11:59PM and the formatting for the labels is 'hh:mmtt'. The BackupTime matches the format of the Y-axis. The BackupDate matches the format of the X-axis. 10 entries are retrieved by my Dataset and the Legend is properly populated by the BackupType field. No points are being plotted on the graph and no markers/pointers are shown if they are enabled. There should be a point on the graph for every point in time of each day there is a backup of a specific type. Am I missing something? Does anyone know of a good tutorial dealing specifically with XY-scatter graphs and using them in a way I intend? I am using the 2005 version of SSRS rather than the 2008 version. Screenshot of what my chart currently looks like: In case it could be dataset related: SELECT TOP (10) backup_type, LTRIM(RTRIM(LEFT(backup_finish_date, 12))) AS BackupDate, LTRIM(RTRIM(RIGHT(backup_finish_date, 8))) AS BackupTime FROM DBARepository.Backup_History As requested, here are the results of this query. There is a Where clause to constrain the results to a specific database of a specific server that was not included in the above SQL Query. Log Dec 26 2008 12:00PM Log Dec 27 2008 4:00AM Log Dec 27 2008 8:00AM Log Dec 27 2008 12:00PM Log Dec 27 2008 4:00PM Log Dec 27 2008 8:00PM Database Dec 27 2008 10:01PM Log Dec 28 2008 12:00AM Log Dec 28 2008 4:00AM Log Dec 28 2008 8:00AM

    Read the article

  • Calculating all distances between one point and a group of points efficiently in R

    - by dbarbosa
    Hi, First of all, I am new to R (I started yesterday). I have two groups of points, data and centers, the first one of size n and the second of size K (for instance, n = 3823 and K = 10), and for each i in the first set, I need to find j in the second with the minimum distance. My idea is simple: for each i, let dist[j] be the distance between i and j, I only need to use which.min(dist) to find what I am looking for. Each point is an array of 64 doubles, so > dim(data) [1] 3823 64 > dim(centers) [1] 10 64 I have tried with for (i in 1:n) { for (j in 1:K) { d[j] <- sqrt(sum((centers[j,] - data[i,])^2)) } S[i] <- which.min(d) } which is extremely slow (with n = 200, it takes more than 40s!!). The fastest solution that I wrote is distance <- function(point, group) { return(dist(t(array(c(point, t(group)), dim=c(ncol(group), 1+nrow(group)))))[1:nrow(group)]) } for (i in 1:n) { d <- distance(data[i,], centers) which.min(d) } Even if it does a lot of computation that I don't use (because dist(m) computes the distance between all rows of m), it is way more faster than the other one (can anyone explain why?), but it is not fast enough for what I need, because it will not be used only once. And also, the distance code is very ugly. I tried to replace it with distance <- function(point, group) { return (dist(rbind(point,group))[1:nrow(group)]) } but this seems to be twice slower. I also tried to use dist for each pair, but it is also slower. I don't know what to do now. It seems like I am doing something very wrong. Any idea on how to do this more efficiently? ps: I need this to implement k-means by hand (and I need to do it, it is part of an assignment). I believe I will only need Euclidian distance, but I am not yet sure, so I will prefer to have some code where the distance computation can be replaced easily. stats::kmeans do all computation in less than one second.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Replacing unversioned files in WiX major upgrade.

    - by Joshua
    I am still having this problem. This is the closest I have come to a solution that works, and yet it doesn't quite work. Here is (most of) the code: <Product Id='$(var.ProductCode)' UpgradeCode='$(var.UpgradeCode)' Name="Pathways" Version='$(var.ProductVersion)' Manufacturer='$(var.Manufacturer)' Language='1033'> Maximum="$(var.ProductVersion)" IncludeMaximum="no" Language="1033" Property="OLDAPPFOUND" / -- -- -- There is a later version of this program installed. The problem I am having is that I need the two files in the Database component to replace the previous copies. Since these files are unversioned, I have attempted to use the CompanionFile tag set to the PathwaysExe since that is the main executable of the application, and it IS being updated, even if the log says it isn't! The strangest thing about this is that the PathwaysLdf file IS BEING UPDATED CORRECTLY, and the PathwaysMdf file IS NOT. The log seems to indicate that the "Existing file is of an equal version (Checked using version of companion)". This is very strange because that file is being replaced just fine. The only idea I have left is that this problem has to do with the install sequence, and I'm not sure how to proceed! I have the InstallExecuteSequence set like I do because of the SettingsXml file, and my need to NOT overwrite that file, which is actually working now, so whatever solution works for the database files can't break the working settings file! ;) The full log is located at: http://pastebin.com/HFiGKuKN PLEASE AND THANK YOU!

    Read the article

  • rake test not copying development postgres db with sequences

    - by Robert Crida
    I am trying to develop a rails application on postgresql using a sequence to increment a field instead of a default ruby approach based on validates_uniqueness_of. This has proved challenging for a number of reasons: 1. This is a migration of an existing table, not a new table or column 2. Using parameter :default = "nextval('seq')" didn't work because it tries to set it in parenthesis 3. Eventually got migration working in 2 steps: change_column :work_commencement_orders, :wco_number_suffix, :integer, :null => false#, :options => "set default nextval('wco_number_suffix_seq')" execute %{ ALTER TABLE work_commencement_orders ALTER COLUMN wco_number_suffix SET DEFAULT nextval('wco_number_suffix_seq'); } Now this would appear to have done the correct thing in the development database and the schema looks like: wco_number_suffix | integer | not null default nextval('wco_number_suffix_seq'::regclass) However, the tests are failing with PGError: ERROR: null value in column "wco_number_suffix" violates not-null constraint : INSERT INTO "work_commencement_orders" ("expense_account_id", "created_at", "process_id", "vo2_issued_on", "wco_template", "updated_at", "notes", "process_type", "vo_number", "vo_issued_on", "vo2_number", "wco_type_id", "created_by", "contractor_id", "old_wco_type", "master_wco_number", "deadline", "updated_by", "detail", "elective_id", "authorization_batch_id", "delivery_lat", "delivery_long", "operational", "state", "issued_on", "delivery_detail") VALUES(226, '2010-05-31 07:02:16.764215', 728, NULL, E'Default', '2010-05-31 07:02:16.764215', NULL, E'Procurement::Process', NULL, NULL, NULL, 226, NULL, 276, NULL, E'MWCO-213', '2010-06-14 07:02:16.756952', NULL, E'Name 4597', 220, NULL, NULL, NULL, 'f', E'pending', NULL, E'728 Test Road; Test Town; 1234; Test Land') RETURNING "id" The explanation can be found when you inspect the schema of the test database: wco_number_suffix | integer | not null So what happened to the default? I tried adding task: template: smmt_ops_development to the database.yml file which has the effect of issuing create database smmt_ops_test template = "smmt_ops_development" encoding = 'utf8' I have verified that if I issue this then it does in fact copy the default nextval. So clearly rails is doing something after that to suppress it again. Any suggestions as to how to fix this? Thanks Robert

    Read the article

  • Best suited tool to document message processing done in C written program

    - by user3494614
    I am relatively new to UML and it's seems to be very vast I have a small program which basically receives messages on socket and then depending upon message ID embedded as first byte of message it processes the buffer. There are around 5 different message ID which it processes and communicates on another socket and has around 8 major functions. So program in short is like this. I am not pasting entire .c file or main function but just giving some bits and pieces of it so that to get idea of program flow. int main(int argc, char** argv) { register_shared_mem(); listen(); while(get_next_message(buffer)) { switch((msg)(buffer)->id) { case TYPE1: process1(); answer(); ..... } } } I want to document this is pictorial way like for Message type 1 it calls this function which calls another and which calls another. Please let me know any open source tool which will allow me to quickly draw such kind of UML or sequence diagram and will also allow me to write brief description of what each function does? Thanks In Advance

    Read the article

  • Blend Interaction Behaviour gives "points to immutable instance" error

    - by kennethkryger
    I have a UserControl that is a base class for other user controls, that are shown in "modal view". I want to have all user controls fading in, when shown and fading out when closed. I also want a behavior, so that the user can move the controls around.My contructor looks like this: var tg = new TransformGroup(); tg.Children.Add(new ScaleTransform()); RenderTransform = tg; var behaviors = Interaction.GetBehaviors(this); behaviors.Add(new TranslateZoomRotateBehavior()); Loaded += ModalDialogBase_Loaded; And the ModalDialogBase_Loaded method looks like this: private void ModalDialogBase_Loaded(object sender, RoutedEventArgs e) { var fadeInStoryboard = (Storyboard)TryFindResource("modalDialogFadeIn"); fadeInStoryboard.Begin(this); } When I press a Close-button on the control this method is called: protected virtual void Close() { var fadeOutStoryboard = (Storyboard)TryFindResource("modalDialogFadeOut"); fadeOutStoryboard = fadeOutStoryboard.Clone(); fadeOutStoryboard.Completed += delegate { RaiseEvent(new RoutedEventArgs(ClosedEvent)); }; fadeOutStoryboard.Begin(this); } The storyboard for fading out look like this: <Storyboard x:Key="modalDialogFadeOut"> <DoubleAnimationUsingKeyFrames Storyboard.TargetProperty="(UIElement.RenderTransform).(TransformGroup.Children)[0].(ScaleTransform.ScaleX)" Storyboard.TargetName="{x:Null}"> <EasingDoubleKeyFrame KeyTime="0" Value="1"> <EasingDoubleKeyFrame.EasingFunction> <BackEase EasingMode="EaseIn" Amplitude="0.3" /> </EasingDoubleKeyFrame.EasingFunction> </EasingDoubleKeyFrame> <EasingDoubleKeyFrame KeyTime="0:0:0.4" Value="0"> <EasingDoubleKeyFrame.EasingFunction> <BackEase EasingMode="EaseIn" Amplitude="0.3" /> </EasingDoubleKeyFrame.EasingFunction> </EasingDoubleKeyFrame> </DoubleAnimationUsingKeyFrames> <DoubleAnimationUsingKeyFrames Storyboard.TargetProperty="(UIElement.RenderTransform).(TransformGroup.Children)[0].(ScaleTransform.ScaleY)" Storyboard.TargetName="{x:Null}"> <EasingDoubleKeyFrame KeyTime="0" Value="1"> <EasingDoubleKeyFrame.EasingFunction> <BackEase EasingMode="EaseIn" Amplitude="0.3" /> </EasingDoubleKeyFrame.EasingFunction> </EasingDoubleKeyFrame> <EasingDoubleKeyFrame KeyTime="0:0:0.4" Value="0"> <EasingDoubleKeyFrame.EasingFunction> <BackEase EasingMode="EaseIn" Amplitude="0.3" /> </EasingDoubleKeyFrame.EasingFunction> </EasingDoubleKeyFrame> </DoubleAnimationUsingKeyFrames> <DoubleAnimationUsingKeyFrames Storyboard.TargetProperty="(UIElement.Opacity)" Storyboard.TargetName="{x:Null}"> <EasingDoubleKeyFrame KeyTime="0" Value="1" /> <EasingDoubleKeyFrame KeyTime="0:0:0.3" Value="0" /> <EasingDoubleKeyFrame KeyTime="0:0:0.4" Value="0" /> </DoubleAnimationUsingKeyFrames> </Storyboard> If the user control is show, and the user does NOT move it around on the screen, everything works fine. However, if the user DOES move the control around, I get the following error when the modalDialogFadeOut storyboard is started: 'Children' property value in the path '(0).(1)[0].(2)' points to immutable instance of 'System.Windows.Media.TransformCollection'. How can fix this?

    Read the article

  • DLL entry point

    - by Whyamistilltyping
    The standard DLL entry point is called DllMain. The second param is DWORD ul_reason_for_call. I have looked up on the MSDN to find all the values this can have, the following are obvious: DLL_PROCESS_ATTACH: DLL_THREAD_ATTACH: DLL_THREAD_DETACH: DLL_PROCESS_DETACH: But what about : DLL_PROCESS_VERIFIER When will the entry point be called with this flag and should I worry about it during 'normal' operation of the DLL?

    Read the article

  • Is there a single query that can update a "sequence number" across multiple groups?

    - by Drarok
    Given a table like below, is there a single-query way to update the table from this: | id | type_id | created_at | sequence | |----|---------|------------|----------| | 1 | 1 | 2010-04-26 | NULL | | 2 | 1 | 2010-04-27 | NULL | | 3 | 2 | 2010-04-28 | NULL | | 4 | 3 | 2010-04-28 | NULL | To this (note that created_at is used for ordering, and sequence is "grouped" by type_id): | id | type_id | created_at | sequence | |----|---------|------------|----------| | 1 | 1 | 2010-04-26 | 1 | | 2 | 1 | 2010-04-27 | 2 | | 3 | 2 | 2010-04-28 | 1 | | 4 | 3 | 2010-04-28 | 1 | I've seen some code before that used an @ variable like the following, that I thought might work: SET @seq = 0; UPDATE `log` SET `sequence` = @seq := @seq + 1 ORDER BY `created_at`; But that obviously doesn't reset the sequence to 1 for each type_id. If there's no single-query way to do this, what's the most efficient way? Data in this table may be deleted, so I'm planning to run a stored procedure after the user is done editing to re-sequence the table.

    Read the article

< Previous Page | 21 22 23 24 25 26 27 28 29 30 31 32  | Next Page >