Search Results

Search found 34668 results on 1387 pages for 'return'.

Page 254/1387 | < Previous Page | 250 251 252 253 254 255 256 257 258 259 260 261  | Next Page >

  • send sms in asp.net by gsm modem

    - by danar jabbar
    I devloped an asp.net application to send sms from gsm modem to destination base on URL from the browser I used a library that developed by codeproject http://www.codeproject.com/articles/20420/how-to-send-and-receive-sms-using-gsm-modem but I get problem when I request form two browsers at same time and I want to make the my code detect that the modem is use by another process at the time here is my code: DeviceConnection deviceConnection = new DeviceConnection(); protected void Page_Load(object sender, EventArgs e) { try { if (Request.QueryString["destination"] != null && Request.QueryString["text"] != null) { deviceConnection.setBaudRate(9600); deviceConnection.setPort(12); deviceConnection.setTimeout(200); SendSms sendSms = new SendSms(deviceConnection); if (deviceConnection.getConnectionStatus()) { sendSms.strReciverNo = Request.QueryString["destination"]; sendSms.strTextMessage = Request.QueryString["text"]; if (sendSms.sendSms()) { Response.Write("Mesage successfuly sent to " + Request.QueryString["destination"]); } else { Response.Write("Message was not sent"); } } } } catch (Exception ex) { Console.WriteLine("Index "+ex.StackTrace); } } This is SendSms class: class SendSms { DeviceConnection deviceConnection; public SendSms(DeviceConnection deviceConnection) { this.deviceConnection = deviceConnection; } private string reciverNo; private string textMessage; private delegate void SetTextCallback(string text); public string strReciverNo { set { this.reciverNo = value; } get { return this.reciverNo; } } public string strTextMessage { set { this.textMessage = value; } get { return this.textMessage; } } public bool sendSms() { try { CommSetting.Comm_Port = deviceConnection.getPort();//GsmCommMain.DefaultPortNumber; CommSetting.Comm_BaudRate = deviceConnection.getBaudRate(); CommSetting.Comm_TimeOut = deviceConnection.getTimeout();//GsmCommMain.DefaultTimeout; CommSetting.comm = new GsmCommMain(deviceConnection.getPort() , deviceConnection.getBaudRate(), deviceConnection.getTimeout()); // CommSetting.comm.PhoneConnected += new EventHandler(comm_PhoneConnected); if (!CommSetting.comm.IsOpen()) { CommSetting.comm.Open(); } SmsSubmitPdu smsSubmitPdu = new SmsSubmitPdu(strTextMessage, strReciverNo, ""); smsSubmitPdu.RequestStatusReport = true; CommSetting.comm.SendMessage(smsSubmitPdu); CommSetting.comm.Close(); return true; } catch (Exception exception) { Console.WriteLine("sendSms " + exception.StackTrace); CommSetting.comm.Close(); return false; } } public void recive(object sender, EventArgs e) { Console.WriteLine("Message received successfuly"); } } }

    Read the article

  • How does .NET compiler compare two strings?

    - by Pankaj
    string a="I am comparing 2 string"; string b="I am comparing 2 string"; if(a==b) return true; else return false; How does a .NET compiler compare two strings? Does a string work like a struct(int)? string is class so a=b means we are comparing 2 object, but i want to compare 2 values.

    Read the article

  • F# - Facebook Hacker Cup - Double Squares

    - by Jacob
    I'm working on strengthening my F#-fu and decided to tackle the Facebook Hacker Cup Double Squares problem. I'm having some problems with the run-time and was wondering if anyone could help me figure out why it is so much slower than my C# equivalent. There's a good description from another post; Source: Facebook Hacker Cup Qualification Round 2011 A double-square number is an integer X which can be expressed as the sum of two perfect squares. For example, 10 is a double-square because 10 = 3^2 + 1^2. Given X, how can we determine the number of ways in which it can be written as the sum of two squares? For example, 10 can only be written as 3^2 + 1^2 (we don't count 1^2 + 3^2 as being different). On the other hand, 25 can be written as 5^2 + 0^2 or as 4^2 + 3^2. You need to solve this problem for 0 = X = 2,147,483,647. Examples: 10 = 1 25 = 2 3 = 0 0 = 1 1 = 1 My basic strategy (which I'm open to critique on) is to; Create a dictionary (for memoize) of the input numbers initialzed to 0 Get the largest number (LN) and pass it to count/memo function Get the LN square root as int Calculate squares for all numbers 0 to LN and store in dict Sum squares for non repeat combinations of numbers from 0 to LN If sum is in memo dict, add 1 to memo Finally, output the counts of the original numbers. Here is the F# code (See code changes at bottom) I've written that I believe corresponds to this strategy (Runtime: ~8:10); open System open System.Collections.Generic open System.IO /// Get a sequence of values let rec range min max = seq { for num in [min .. max] do yield num } /// Get a sequence starting from 0 and going to max let rec zeroRange max = range 0 max /// Find the maximum number in a list with a starting accumulator (acc) let rec maxNum acc = function | [] -> acc | p::tail when p > acc -> maxNum p tail | p::tail -> maxNum acc tail /// A helper for finding max that sets the accumulator to 0 let rec findMax nums = maxNum 0 nums /// Build a collection of combinations; ie [1,2,3] = (1,1), (1,2), (1,3), (2,2), (2,3), (3,3) let rec combos range = seq { let count = ref 0 for inner in range do for outer in Seq.skip !count range do yield (inner, outer) count := !count + 1 } let rec squares nums = let dict = new Dictionary<int, int>() for s in nums do dict.[s] <- (s * s) dict /// Counts the number of possible double squares for a given number and keeps track of other counts that are provided in the memo dict. let rec countDoubleSquares (num: int) (memo: Dictionary<int, int>) = // The highest relevent square is the square root because it squared plus 0 squared is the top most possibility let maxSquare = System.Math.Sqrt((float)num) // Our relevant squares are 0 to the highest possible square; note the cast to int which shouldn't hurt. let relSquares = range 0 ((int)maxSquare) // calculate the squares up front; let calcSquares = squares relSquares // Build up our square combinations; ie [1,2,3] = (1,1), (1,2), (1,3), (2,2), (2,3), (3,3) for (sq1, sq2) in combos relSquares do let v = calcSquares.[sq1] + calcSquares.[sq2] // Memoize our relevant results if memo.ContainsKey(v) then memo.[v] <- memo.[v] + 1 // return our count for the num passed in memo.[num] // Read our numbers from file. //let lines = File.ReadAllLines("test2.txt") //let nums = [ for line in Seq.skip 1 lines -> Int32.Parse(line) ] // Optionally, read them from straight array let nums = [1740798996; 1257431873; 2147483643; 602519112; 858320077; 1048039120; 415485223; 874566596; 1022907856; 65; 421330820; 1041493518; 5; 1328649093; 1941554117; 4225; 2082925; 0; 1; 3] // Initialize our memoize dictionary let memo = new Dictionary<int, int>() for num in nums do memo.[num] <- 0 // Get the largest number in our set, all other numbers will be memoized along the way let maxN = findMax nums // Do the memoize let maxCount = countDoubleSquares maxN memo // Output our results. for num in nums do printfn "%i" memo.[num] // Have a little pause for when we debug let line = Console.Read() And here is my version in C# (Runtime: ~1:40: using System; using System.Collections.Generic; using System.Diagnostics; using System.IO; using System.Linq; using System.Text; namespace FBHack_DoubleSquares { public class TestInput { public int NumCases { get; set; } public List<int> Nums { get; set; } public TestInput() { Nums = new List<int>(); } public int MaxNum() { return Nums.Max(); } } class Program { static void Main(string[] args) { // Read input from file. //TestInput input = ReadTestInput("live.txt"); // As example, load straight. TestInput input = new TestInput { NumCases = 20, Nums = new List<int> { 1740798996, 1257431873, 2147483643, 602519112, 858320077, 1048039120, 415485223, 874566596, 1022907856, 65, 421330820, 1041493518, 5, 1328649093, 1941554117, 4225, 2082925, 0, 1, 3, } }; var maxNum = input.MaxNum(); Dictionary<int, int> memo = new Dictionary<int, int>(); foreach (var num in input.Nums) { if (!memo.ContainsKey(num)) memo.Add(num, 0); } DoMemoize(maxNum, memo); StringBuilder sb = new StringBuilder(); foreach (var num in input.Nums) { //Console.WriteLine(memo[num]); sb.AppendLine(memo[num].ToString()); } Console.Write(sb.ToString()); var blah = Console.Read(); //File.WriteAllText("out.txt", sb.ToString()); } private static int DoMemoize(int num, Dictionary<int, int> memo) { var highSquare = (int)Math.Floor(Math.Sqrt(num)); var squares = CreateSquareLookup(highSquare); var relSquares = squares.Keys.ToList(); Debug.WriteLine("Starting - " + num.ToString()); Debug.WriteLine("RelSquares.Count = {0}", relSquares.Count); int sum = 0; var index = 0; foreach (var square in relSquares) { foreach (var inner in relSquares.Skip(index)) { sum = squares[square] + squares[inner]; if (memo.ContainsKey(sum)) memo[sum]++; } index++; } if (memo.ContainsKey(num)) return memo[num]; return 0; } private static TestInput ReadTestInput(string fileName) { var lines = File.ReadAllLines(fileName); var input = new TestInput(); input.NumCases = int.Parse(lines[0]); foreach (var lin in lines.Skip(1)) { input.Nums.Add(int.Parse(lin)); } return input; } public static Dictionary<int, int> CreateSquareLookup(int maxNum) { var dict = new Dictionary<int, int>(); int square; foreach (var num in Enumerable.Range(0, maxNum)) { square = num * num; dict[num] = square; } return dict; } } } Thanks for taking a look. UPDATE Changing the combos function slightly will result in a pretty big performance boost (from 8 min to 3:45): /// Old and Busted... let rec combosOld range = seq { let rangeCache = Seq.cache range let count = ref 0 for inner in rangeCache do for outer in Seq.skip !count rangeCache do yield (inner, outer) count := !count + 1 } /// The New Hotness... let rec combos maxNum = seq { for i in 0..maxNum do for j in i..maxNum do yield i,j }

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Working through exercises in "Cocoa Programming for Mac OS X" - I'm stumped

    - by Zigrivers
    I've been working through the exercises in a book recommended here on stackoverflow, however I've run into a problem and after three days of banging my head on the wall, I think I need some help. I'm working through the "Speakline" exercise where we add a TableView to the interface and the table will display the "voices" that you can choose for the text to speech aspect of the program. I am having two problems that I can't seem to get to the bottom of: I get the following error: * Illegal NSTableView data source (). Must implement numberOfRowsInTableView: and tableView:objectValueForTableColumn:row: The tableView that is supposed to display the voices comes up blank I have a feeling that both of these problems are related. I'm including my interface code here: #import <Cocoa/Cocoa.h> @interface AppController : NSObject <NSSpeechSynthesizerDelegate, NSTableViewDelegate> { IBOutlet NSTextField *textField; NSSpeechSynthesizer *speechSynth; IBOutlet NSButton *stopButton; IBOutlet NSButton *startButton; IBOutlet NSTableView *tableView; NSArray *voiceList; } - (IBAction)sayIt:(id)sender; - (IBAction)stopIt:(id)sender; @end And my implementation code here: #import "AppController.h" @implementation AppController - (id)init { [super init]; //Log to help me understand what is happening NSLog(@"init"); speechSynth = [[NSSpeechSynthesizer alloc] initWithVoice:nil]; [speechSynth setDelegate:self]; voiceList = [[NSSpeechSynthesizer availableVoices] retain]; return self; } - (IBAction)sayIt:(id)sender { NSString *string = [[textField stringValue] stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceCharacterSet]]; //Is the string zero-length? if([string length] == 0) { NSLog(@"String from %@ is a string with a length of %d.", textField, [string length]); [speechSynth startSpeakingString:@"Please enter a phrase first."]; } [speechSynth startSpeakingString:string]; NSLog(@"Started to say: %@", string); [stopButton setEnabled:YES]; [startButton setEnabled:NO]; } - (IBAction)stopIt:(id)sender { NSLog(@"Stopping..."); [speechSynth stopSpeaking]; } - (void) speechSynthesizer:(NSSpeechSynthesizer *)sender didFinishSpeaking:(BOOL)complete { NSLog(@"Complete = %d", complete); [stopButton setEnabled:NO]; [startButton setEnabled:YES]; } - (NSInteger)numberOfRowsInTableView:(NSTableView *)aTableView { return [voiceList count]; } - (id)tableView: (NSTableView *)tv objecValueForTableColumn: (NSTableColumn *)tableColumn row:(NSInteger)row { NSString *v = [voiceList objectAtIndex:row]; NSLog(@"v = %@",v); NSDictionary *dict = [NSSpeechSynthesizer attributesForVoice:v]; return [dict objectForKey:NSVoiceName]; } /* - (BOOL)respondsToSelector:(SEL)aSelector { NSString *methodName = NSStringFromSelector(aSelector); NSLog(@"respondsToSelector: %@", methodName); return [super respondsToSelector:aSelector]; } */ @end Hopefully, you guys can see something obvious that I've missed. Thank you!

    Read the article

  • C# Create Values in Registry Local Machine

    - by Shahmir Javaid
    This is not working for me: public bool createRegistry() { if (!registryExists()) { Microsoft.Win32.Registry.LocalMachine.CreateSubKey("Software\\xelo\\"); Microsoft.Win32.Registry.LocalMachine.OpenSubKey("Software\\xelo").SetValue("hostname", (string)hostname, Microsoft.Win32.RegistryValueKind.String); return true; } else { return updateRegistry(); } } The exception error is to do with Not Authorized to do this. Any Help would be apreaciated Exeption: System.UnauthorizedAccessException | "Cannot write to the registry key"

    Read the article

  • How to properly downcast in C# with a SWIG generated interface?

    - by JG
    I've got a very large and mature C++ code base that I'm trying to use SWIG on to generate a C# interface for. I cannot change the actual C++ code itself but we can use whatever SWIG offers in the way of extending/updating it. I'm facing an issue where a function C++ is written as such: A* SomeClass::next(A*) The caller might do something like: A* acurr = 0; while( (acurr = sc->next(acurr)) != 0 ){ if( acurr isoftype B ){ B* b = (B*)a; ...do some stuff with b.. } elseif( acurr isoftype C ) ... } Essentially, iterating through a container elements that depending on their true type, do something different. The SWIG generated C# layer for the "next" function unfortunately does the following: return new A(); So the calling code in C# land cannot determine if the returned object is actually a derived class or not, it actually appears to always be the base class (which does make sense). I've come across several solutions: Use the %extend SWIG keyword to add a method on an object and ultimately call dynamic_cast. The downside to this approach, as I see it, is that this requires you to know the inheritance hierarchy. In my case it is rather huge and I see this is as a maintenance issue. Use the %factory keyword to supply the method and the derived types and have SWIG automatically generate the dynamic_cast code. This appears to be a better solution that the first, however upon a deeper look it still requires you to hunt down all the methods and all the possible derived types it could return. Again, a huge maintenance issue. I wish I had a doc link for this but I can't find one. I found out about this functionality by looking through the example code that comes with SWIG. Create a C# method to create an instance of the derived object and transfer the cPtr to the new instance. While I consider this clumsy, it does work. See an example below. public static object castTo(object fromObj, Type toType) { object retval = null; BaseClass fromObj2 = fromObj as BaseClass; HandleRef hr = BaseClass.getCPtr(fromObj2); IntPtr cPtr = hr.Handle; object toObj = Activator.CreateInstance(toType, cPtr, false); // make sure it actually is what we think it is if (fromObj.GetType().IsInstanceOfType(toObj)) { return toObj; } return retval; } Are these really the options? And if I'm not willing to dig through all the existing functions and class derivations, then I'm left with #3? Any help would be appreciated.

    Read the article

  • wcf message size causing permission issue

    - by Ferrell Carr
    silverlight 3.0 client wcf 3.0 VS.Net 2005 Web Site Win 2003 Server 50 column observable collection. return observable collection select top 975 * ... no problem return observable collection select * .... Issue On SL client after proxy.Get 50 col OC logon screen from win 2003 server pops up Mever makes it to the completed event.

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • Why can't you call abstract functions from abstract classes in PHP?

    - by incrediman
    I've set up an abstract parent class, and a concrete class which extends it. Why can the parent class not call the abstract function? //foo.php <?php abstract class AbstractFoo{ abstract public static function foo(); public static function getFoo(){ return self::foo();//line 5 } } class ConcreteFoo extends AbstractFoo{ public static function foo(){ return "bar"; } } echo ConcreteFoo::getFoo(); ?> Error: Fatal error: Cannot call abstract method AbstractFoo::foo() in foo.php on line 5

    Read the article

  • jQuery selector not working in IE

    - by CurlyFro
    this method should return a unique array of text from rows with a specific td class. works in ffs and chrome but not in ie8 or safari. can you spot the problem? function getUniqueIds() { var tblLnks = new Array(); $('td.tblLnk').each(function() { tblLnks.push($(this).text().trim()); }); return tblLnks.unique(); }

    Read the article

  • Use hash or case-statement [Ruby]

    - by user94154
    Generally which is better to use?: case n when 'foo' result = 'bar' when 'peanut butter' result = 'jelly' when 'stack' result = 'overflow' return result or map = {'foo' => 'bar', 'peanut butter' => 'jelly', 'stack' => 'overflow'} return map[n] More specifically, when should I use case-statements and when should I simply use a hash?

    Read the article

  • Python datetime to Unix timestamp

    - by Off Rhoden
    I have to create an "Expires" value 5 minutes in the future, but I have to supply it in UNIX Timestamp format. I have this so far, but it seems like a hack. def expires(): '''return a UNIX style timestamp representing 5 minutes from now''' epoch = datetime.datetime(1970, 1, 1) seconds_in_a_day = 60 * 60 * 24 five_minutes = datetime.timedelta(seconds=5*60) five_minutes_from_now = datetime.datetime.now() + five_minutes since_epoch = five_minutes_from_now - epoch return since_epoch.days * seconds_in_a_day + since_epoch.seconds Is there a module or function that does the timestamp conversion for me?

    Read the article

  • javascript function is not getting called onclick of hx:commant button

    - by Sunny Mate
    hi i have method called test() when iu click on the commandButton the method should get called but the method is not getting called my code is as follows method **function test() { alert('ss'); return "true"; }** and method calling is <hx:commandExButton type="submit" value="Search" styleClass="action2" id="searchButton" **onclick="return test();"** action="#{pc_WorkInProgressUserGrid.doSearchButtonAction}" immediate="true </hx:commandExButton> any suggestion would be helpful

    Read the article

  • pandas: complex filter on rows of DataFrame

    - by duckworthd
    I would like to filter rows by a function of each row, e.g. def f(row): return sin(row['velocity'])/np.prod(['masses']) > 5 df = pandas.DataFrame(...) filtered = df[apply_to_all_rows(df, f)] Or for another more complex, contrived example, def g(row): if row['col1'].method1() == 1: val = row['col1'].method2() / row['col1'].method3(row['col3'], row['col4']) else: val = row['col2'].method5(row['col6']) return np.sin(val) df = pandas.DataFrame(...) filtered = df[apply_to_all_rows(df, g)] How can I do so?

    Read the article

  • PHP Detect if any URL variables have been set

    - by zuk1
    Hey guys, it's kind of hard to explain but basically I want to detect if any variables have been set through the URL. So with my IF statement all of the following should return true: http://domain.com/index.php?m=100 http://domain.com/index.php?q=harhar http://domain.com/index.php?variable=poo&crazy=yes and all the following return false: http://domain.com/index.php http://domain.com/test.php http://domain.com/no_variables.php Any ideas?

    Read the article

  • Returning char* in function

    - by Devel
    I have function: char *zap(char *ar) { char pie[100] = "INSERT INTO test (nazwa, liczba) VALUES ('nowy wpis', '"; char dru[] = "' )"; strcat(pie, ar); strcat(pie, dru); return pie; } and in main there is: printf("%s", zap( argv[1] ) ); When compiling I get the warning: test.c: In function ‘zap’: test.c:17: warning: function returns address of local variable How should I return char* propertly?

    Read the article

  • Code to show UIPickerview under clicked UITextField

    - by Chris F
    I thought I'd share a code snippet where I show a UIPickerView when you click a UITextField. The code uses a UIPickerView, but there's no reason to use a different view controller, like a UITableViewController that uses a table instead of a picker. Just create a single-view project with a nib, and add a UITextField to the view and make you connections in IB. // .h file #import @interface MyPickerViewViewController : UIViewController <UIPickerViewDelegate, UIPickerViewDataSource, UITextFieldDelegate> - (IBAction)dismissPickerView:(id)sender; @end // .m file #import "MyPickerViewViewController.h" @interface MyPickerViewViewController () { UIPickerView *_pv; NSArray *_array; IBOutlet __weak UITextField *_tf; BOOL _pickerViewShown; } @end @implementation MyPickerViewViewController - (void)viewDidLoad { [super viewDidLoad]; _pickerViewShown = NO; _array = [NSArray arrayWithObjects:@"One", @"Two", @"Three", @"Four", nil]; _pv = [[UIPickerView alloc] initWithFrame:CGRectZero]; _pv.showsSelectionIndicator = YES; _pv.dataSource = self; _pv.delegate = self; _tf.delegate = self; _tf.inputView = _pv; } - (IBAction)dismissPickerView:(id)sender { [_pv removeFromSuperview]; [_tf.inputView removeFromSuperview]; [_tf resignFirstResponder]; _pickerViewShown = NO; } - (void)didReceiveMemoryWarning { [super didReceiveMemoryWarning]; // Dispose of any resources that can be recreated. } - (BOOL)textFieldShouldBeginEditing:(UITextField *)textField { if (!_pickerViewShown) { [self setRectForPickerViewRelativeToTextField:textField]; [self.view addSubview:_tf.inputView]; _pickerViewShown = YES; } else { [self dismissPickerView:self]; } return NO; } - (void)setRectForPickerViewRelativeToTextField:(UITextField*)textField { CGFloat xPos = textField.frame.origin.x; CGFloat yPos = textField.frame.origin.y; CGFloat width = textField.frame.size.width; CGFloat height = textField.frame.size.height; CGFloat pvHeight = _pv.frame.size.height; CGRect pvRect = CGRectMake(xPos, yPos+height, width, pvHeight); _pv.frame = pvRect; } - (NSString *)pickerView:(UIPickerView *)pickerView titleForRow:(NSInteger)row forComponent:(NSInteger)component { return [_array objectAtIndex:row]; } - (NSInteger)numberOfComponentsInPickerView:(UIPickerView *)pickerView { return 1; } - (NSInteger)pickerView:(UIPickerView *)pickerView numberOfRowsInComponent:(NSInteger)component { return _array.count; } - (void) pickerView:(UIPickerView *)pickerView didSelectRow:(NSInteger)row inComponent:(NSInteger)component { _tf.text = [_array objectAtIndex:row]; [self dismissPickerView:self]; } @end

    Read the article

  • Error in Print Function in Bubble Sort MIPS?

    - by m00nbeam360
    Sorry that this is such a long block of code, but do you see any obvious syntax errors in this? I feel like the problem is that the code isn't printing correctly since the sort and swap methods were from my textbook. Please help if you can! .data save: .word 1,2,4,2,5,6 size: .word 6 .text swap: sll $t1, $a1, 2 #shift bits by 2 add $t1, $a1, $t1 #set $t1 address to v[k] lw $t0, 0($t1) #load v[k] into t1 lw $t2, 4($t1) #load v[k+1] into t1 sw $t2, 0($t1) #swap addresses sw $t0, 4($t1) #swap addresses jr $ra #return sort: addi $sp, $sp, -20 #make enough room on the stack for five registers sw $ra, 16($sp) #save the return address on the stack sw $s3, 12($sp) #save $s3 on the stack sw $s2, 8($sp) #save Ss2 on the stack sw $s1, 4($sp) #save $s1 on the stack sw $s0, 0($sp) #save $s0 on the stack move $s2, $a0 #copy the parameter $a0 into $s2 (save $a0) move $s3, $a1 #copy the parameter $a1 into $s3 (save $a1) move $s0, $zero #start of for loop, i = 0 for1tst: slt $t0, $s0, $s3 #$t0 = 0 if $s0 S $s3 (i S n) beq $t0, $zero, exit1 #go to exit1 if $s0 S $s3 (i S n) addi $s1, $s0, -1 #j - i - 1 for2tst: slti $t0, $s1, 0 #$t0 = 1 if $s1 < 0 (j < 0) bne $t0, $zero, exit2 #$t0 = 1 if $s1 < 0 (j < 0) sll $t1, $s1, 2 #$t1 = j * 4 (shift by 2 bits) add $t2, $s2, $t1 #$t2 = v + (j*4) lw $t3, 0($t2) #$t3 = v[j] lw $t4, 4($t2) #$t4 = v[j+1] slt $t0, $t4, $t3 #$t0 = 0 if $t4 S $t3 beq $t0, $zero, exit2 #go to exit2 if $t4 S $t3 move $a0, $s2 #1st parameter of swap is v(old $a0) move $a1, $s1 #2nd parameter of swap is j jal swap #swap addi $s1, $s1, -1 j for2tst #jump to test of inner loop j print exit2: addi $s0, $s0, 1 #i = i + 1 j for1tst #jump to test of outer loop exit1: lw $s0, 0($sp) #restore $s0 from stack lw $s1, 4($sp) #resture $s1 from stack lw $s2, 8($sp) #restore $s2 from stack lw $s3, 12($sp) #restore $s3 from stack lw $ra, 16($sp) #restore $ra from stack addi $sp, $sp, 20 #restore stack pointer jr $ra #return to calling routine .data space:.asciiz " " # space to insert between numbers head: .asciiz "The sorted numbers are:\n" .text print:add $t0, $zero, $a0 # starting address of array add $t1, $zero, $a1 # initialize loop counter to array size la $a0, head # load address of print heading li $v0, 4 # specify Print String service syscall # print heading out: lw $a0, 0($t0) # load fibonacci number for syscall li $v0, 1 # specify Print Integer service syscall # print fibonacci number la $a0, space # load address of spacer for syscall li $v0, 4 # specify Print String service syscall # output string addi $t0, $t0, 4 # increment address addi $t1, $t1, -1 # decrement loop counter bgtz $t1, out # repeat if not finished jr $ra # return

    Read the article

  • golang closure variable scope

    - by waaadim
    I'm reading 'CreateSpace An Introduction to Programming in Go 2012' and on page 86 I found this evil magic func makeEvenGenerator() func() uint { i := uint(0) return func() (ret uint) { ret = i i += 2 return } } // here's how it's called nextEven := makeEvenGenerator() fmt.Println(nextEven()) fmt.Println(nextEven()) fmt.Println(nextEven()) 1) Why is i not resetting ? 2) is nextEven() returning and uint or is Println so smart that it can work with everything ?

    Read the article

  • Access static class variable of parent class in Python

    - by fuenfundachtzig
    I have someting like this class A: __a = 0 def __init__(self): A.__a = A.__a + 1 def a(self): return A.__a class B(A): def __init__(self): # how can I access / modify A.__a here? A.__a = A.__a + 1 # does not work def a(self): return A.__a Can I access the __astatic variable in B? It's possible writing a instead of __a, is this the only way? (I guess the answer might be rather short: yes :)

    Read the article

  • Django: Summing values

    - by Anry
    I have a two Model - Project and Cost. class Project(models.Model): title = models.CharField(max_length=150) url = models.URLField() manager = models.ForeignKey(User) class Cost(models.Model): project = models.ForeignKey(Project) cost = models.FloatField() date = models.DateField() I must return the sum of costs for each project. view.py: from mypm.costs.models import Project, Cost from django.shortcuts import render_to_response from django.db.models import Avg, Sum def index(request): #... return render_to_response('index.html',... How?

    Read the article

< Previous Page | 250 251 252 253 254 255 256 257 258 259 260 261  | Next Page >