Search Results

Search found 3856 results on 155 pages for 'io'.

Page 26/155 | < Previous Page | 22 23 24 25 26 27 28 29 30 31 32 33  | Next Page >

  • Batch backup a harddrive without modifying access times C#

    - by johnathan-doena
    I'm trying to write a simple program that will backup my flash drive. I want it to work automatically and silently in the background, and I also want it to be as quick as possible. The thing is, resetting all the access times is useless to me, and something I want to avoid. I know I can read the access times and set them back, but I bet it will fail one day in the future. It would be much simpler to read the files without ever changing it. Also, what is the fastest way to do this? What differences would there be between, say, a flash drive and an external hard drive. I am writing this in C#, as it is the simplest way to do it and it will probably last more generations of Windows..

    Read the article

  • Improving File Read Performance (single file, C++, Windows)

    - by david
    I have large (hundreds of MB or more) files that I need to read blocks from using C++ on Windows. Currently the relevant functions are: errorType LargeFile::read( void* data_out, __int64 start_position, __int64 size_bytes ) const { if( !m_open ) { // return error } else { seekPosition( start_position ); DWORD bytes_read; BOOL result = ReadFile( m_file, data_out, DWORD( size_bytes ), &bytes_read, NULL ); if( size_bytes != bytes_read || result != TRUE ) { // return error } } // return no error } void LargeFile::seekPosition( __int64 position ) const { LARGE_INTEGER target; target.QuadPart = LONGLONG( position ); SetFilePointerEx( m_file, target, NULL, FILE_BEGIN ); } The performance of the above does not seem to be very good. Reads are on 4K blocks of the file. Some reads are coherent, most are not. A couple questions: Is there a good way to profile the reads? What things might improve the performance? For example, would sector-aligning the data be useful? I'm relatively new to file i/o optimization, so suggestions or pointers to articles/tutorials would be helpful.

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • Fastest way to read data from a lot of ASCII files

    - by Alsenes
    Hi guys, for a college exercise that I've already submitted I needed to read a .txt file wich contained a lot of names of images(1 in each line). Then I needed to open each image as an ascii file, and read their data(images where in ppm format), and do a series of things with them. The things is, I noticed my program was taking 70% of the time in the reading the data from the file part, instead of in the other calculations that I was doing (finding number of repetitions of each pixel with a hash table, finding diferents pixels beetween 2 images etc..), which I found quite odd to say the least. This is how the ppm format looks like: P3 //This value can be ignored when reading the file, because all image will be correctly formatted 4 4 255 //This value can be also ignored, will be always 255. 0 0 0 0 0 0 0 0 0 15 0 15 0 0 0 0 15 7 0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 0 0 0 15 0 15 0 0 0 0 0 0 0 0 0 This is how I was reading the data from the files: ifstream fdatos; fdatos.open(argv[1]); //Open file with the name of all the images const int size = 128; char file[size]; //Where I'll get the image name Image *img; while (fdatos >> file) { //While there's still images anmes left, continue ifstream fimagen; fimagen.open(file); //Open image file img = new Image(fimagen); //Create new image object with it's data file ……… //Rest of the calculations whith that image ……… delete img; //Delete image object after done fimagen.close(); //Close image file after done } fdatos.close(); And inside the image object read the data like this: const int tallafirma = 100; char firma[tallafirma]; fich_in >> std::setw(100) >> firma; // Read the P3 part, can be ignored int maxvalue, numpixels; fich_in >> height >> width >> maxvalue; // Read the next three values numpixels = height*width; datos = new Pixel[numpixels]; int r,g,b; //Don't need to be ints, max value is 256, so an unsigned char would be ok. for (int i=0; i<numpixels; i++) { fich_in >> r >> g >> b; datos[i] = Pixel( r, g ,b); } //This last part is the slow one, //I thing I should be able to read all this data in one single read //to buffer or something which would be stored in an array of unsigned chars, //and then I'd only need to to do: //buffer[0] -> //Pixel 1 - Red data //buffer[1] -> //Pixel 1 - Green data //buffer[2] -> //Pixel 1 - Blue data So, any Ideas? I think I can improve it quite a bit reading all to an array in one single call, I just don't know how that is done. Also, is it posible to know how many images will be in the "index file"? Is it posiible to know the number of lines a file has?(because there's one file name per line..) Thanks!!

    Read the article

  • What file format can I use to output a formatted text file straight from a program without having the markup be too complicated?

    - by Matt
    Premise: I am parsing a file that is quite nearly XML, but not quite. From this file I would like to extract data and output in a file that a user could open up in some program and read. To make the data reasonable, I would almost certainly need to format the text. In case it matters, I will probably be using Java to write the program. Problem: I cannot find a file format that supports formatting without having terribly complex rules and encoding problems. Attempts: I looked into a basic .txt extension first, but it does not have enough formatting advantage. I then tried a .rtf extension, but the rules for outputting text seem to be terribly complicated. It was then suggested that I used XML, but I do not understand how this file would be viewed. This appears to be probably the best solution, but I don't understand much about it. Perhaps somebody could shed some light here. In Other Words: Could somebody suggest and easy to use file format and/or shed some light on how to use XML for text formatting and viewing?

    Read the article

  • best way to output a full precision double into a text file

    - by flevine100
    Hi, I need to use an existing text file to store some very precise values. When read back in, the numbers essentially need to be exactly equivalent to the ones that were originally written. Now, a normal person would use a binary file... for a number of reasons, that's not possible in this case. So... do any of you have a good way of encoding a double as a string of characters (aside from increasing the precision). My first thought was to cast the double to a char[] and write out the chars. I don't think that's going to work because some of the characters are not visible, produce sounds, and even terminate strings ('\0'... I'm talkin to you!) Thoughts?

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • Read File/Directory properties with java

    - by Pizza
    How can I read the file information (for example size, line count, last modification, etc) from a file in the file-system or the directory content with JAVA? I need it for a linux operating system. Thanks Ps. This is my first question, althought I have user this forum for a while so please be kind :P

    Read the article

  • Cant print contents of a custom file

    - by ZaZu
    Hello, Im trying to scan contents from a random file into an array in a structure. Then I want to print those contents on screen. (NOTE: The following code is from a bigger program, this is just a sample, but all structures and arrays used are needed as declared ) The contents of the file being tested are simply: 5 4 3 2 5 3 4 2 #include<stdio.h> #define first 500 #define sec 500 struct trial{ int f; int r; float what[first][sec]; }; int trialtest(trial *test); int trialdisplay(trial *test); main(){ trial test; trialtest(&test); trialdisplay(&test); } int trialtest(trial *test){ int z,x,i; FILE *inputf; inputf=fopen("randomfile.txt","r"); for(i=0;i<5;i++){ fscanf(inputf,"%f",&(*test).what[z][x]); } fclose(inputf); return 0; } int trialdisplay(trial *test){ int i,z,x; printf("printing\n\n\n"); for (i=0;i<10;i++){ printf("%f",(*test).what[z][x]); } return 0; } The problem is, I get this error whenever I run the code .. I cant really understand whats going on : Any suggestions ? Thanks alot !

    Read the article

  • Add HTML Id's to tags in .aspx file

    - by slandau
    So I'm writing an app that lets the user select a folder, it gets all the .aspx files in that folder, and lets the users check off which ones they want to add HTML ID's to. Then they click start, and this runs private void btnStart_Click(object sender, EventArgs e) { for (int i = 0; i < listFiles.CheckedItems.Count; i++) { } } It loops through all the selected file names. How do I open each of these .aspx files in the background, and go through them and add the id="thisItemId" attribute to each tag that's like a , , , , , etc....

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • iphone file download not working

    - by Anonymous
    Hi, In my app I 'm first connecting to a web service, which in return sends a url for a file. I use the url to download the file and then display it on the new view. I get the correct URL but not able to download file from that location. I have another test app which will download file from the same location and it works like a charm. following is my code for webservice-file download. This is a snippet of the code where i 'm parsing the web service xml and then pass the result to NSData for file download. Any suggestions where am i going wrong -- I 'm referring to the following tutorials. Web Service PDF Viewer if ([elementName isEqualToString:@"PRHPdfResultsResult"]) { NSLog(soapResults); UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"Report downloaded from:" message:soapResults delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; NSData *pdfData = [[NSData alloc] initWithContentsOfURL:[NSURL URLWithString:soapResults]]; //Store the Data locally as PDF File NSString *resourceDocPath = [[NSString alloc] initWithString:[[[[NSBundle mainBundle] resourcePath] stringByDeletingLastPathComponent] stringByAppendingPathComponent:@"Documents"]]; NSString *filePath = [resourceDocPath stringByAppendingPathComponent:@"myPDF.pdf"]; [pdfData writeToFile:filePath atomically:YES]; [alert show]; [alert release]; [soapResults setString:@""]; elementFound = FALSE; }

    Read the article

  • Modifying File while in use using Java

    - by Marquinio
    Hi all, I have this recurrent Java JAR program tasks that tries to modify a file every 60seconds. Problem is that if user is viewing the file than Java program will not be able to modify the file. I get the typical IOException. Anyone knows if there is a way in Java to modify a file currently in use? Or anyone knows what would be the best way to solve this problem? I was thinking of using the File canRead(), canWrite() methods to check if file is in use. If file is in use then I'm thinking of making a backup copy of data that could not be written. Then after 60 seconds add some logic to check if backup file is empty or not. If backup file is not empty then add its contents to main file. If empty then just add new data to main file. Of course, the first thing I will always do is check if file is in use. Thanks for all your ideas.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • removing a line from a text file?

    - by Blackbinary
    Hi all. I am working with a text file, which contains a list of processes under my programs control, along with relevant data. At some point, one of the processes will finish, and thus will need to be removed from the file (as its no longer under control). Here is a sample of the file contents (which has enteries added "randomly"): PID=25729 IDLE=0.200000 BUSY=0.300000 USER=-10.000000 PID=26416 IDLE=0.100000 BUSY=0.800000 USER=-20.000000 PID=26522 IDLE=0.400000 BUSY=0.700000 USER=-30.000000 So for example, if I wanted to remove the line that says PID=26416.... how could I do that, without writing the file over again? I can use external unix commands, however I am not very familiar with them so please if that is your suggestion, give an example. Thanks!

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • Homemade fstat to get file size, always return 0 length.

    - by Fred
    Hello, I am trying to use my own function to get the file size from a file. I'll use this to allocate memory for a data structure to hold the information on the file. The file size function looks like this: long fileSize(FILE *fp){ long start; fflush(fp); rewind(fp); start = ftell(fp); return (fseek(fp, 0L, SEEK_END) - start); } Any ideas what I'm doing wrong here?

    Read the article

  • Java I/O: How to append to an already existing text file.

    - by Joe
    Hi I am having no problem writing to or appending to a file, the only problem is that as soon as I quit the program and then run it again, it creates a new file overwriting my original file. This is a problem, as I am using the text file to keep a running tally. Is there a way to get an already created text file as an object and then append to it? Thanks in advance.

    Read the article

< Previous Page | 22 23 24 25 26 27 28 29 30 31 32 33  | Next Page >