Search Results

Search found 7702 results on 309 pages for 'nested includes'.

Page 279/309 | < Previous Page | 275 276 277 278 279 280 281 282 283 284 285 286  | Next Page >

• remove data layer and put into it's own domain

  - by user334768

  I have a SL4 application that uses EF4 & RIA Services. DB is SQL 2008. All is working well. Now I want to put the Database and web services on one domain (A.com) with the web service exposing the same methods available in my working project. (one listed at top of message) Then put a Silverlight application (same one as above) on domain(B.com) and call the web services on A.com. I thought I had a fair understanding of RIA Services. Enough to get the above application working. Now when I say "working" I do mean on my local dev machine. I have yet to deployed as SL4 & .NET 4 application to my hosting site. But I don't think I understand it well enough. I normally create a new business app, add EF then create the RIA DomainService. Add any [Includes] I need, modify my linq queries and run application. And it works. Now I need to break off my data layer and put it on another hosting site (A.com) And put my UI and business logic on another hosting site (B.com) I think I need to do the following : On the Database & web service site: domain(A.com) create application, create EF4, create RIA Services and deploy. At this time, are the methods exposed available as a "WEB SERVICE" to other applications calling by http:// a.com/serviceName.svc address? I think I need to do the following : On the application site : domain(B.com) create a business application (later will need authentication and navigation). How can I create an EF when I don't have access to the database? (I know I do have access but I want know what happens here when I do not have access to the database, but only data provided by a web service) If I can not create an EF how do I create my RIA Service? I hope any one who takes time to help me understands what I'm asking. Sorry so long.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Unable to get index from jQuery UI slider range

  - by Phil.Wheeler

  I'm having a hell of a time trying to get (what I thought was) a simple index from a collection of multiple sliders. The HTML is as follows: <div id="left-values" class="line"> <span id="l1" style="padding: 0 1.8em;">0</span> <span id="l2" style="padding: 0 1.8em;">0</span> <span id="l3" style="padding: 0 1.8em;">0</span> <span id="l4" style="padding: 0 1.8em;">0</span> <span id="l5" style="padding: 0 1.8em;">0</span> <span id="l6" style="padding: 0 1.8em;">0</span> <span id="l7" style="padding: 0 1.8em;">0</span> <span id="l8" style="padding: 0 1.8em;">0</span> </div> And the jQuery code is: // setup audiometry sliders $("#eq > span").each(function (e) { // read initial values from markup and remove that var value = parseInt($(this).text()); // var index = $(this).index; <- this didn't work. $(this).empty(); $(this).slider({ value: value, slide: function (event, ui) { //console.log($(this).attr('id')); <- neither did this. //console.log(index); $('#left-values span:first').text(ui.value); } }) }); The problem is that jQuery UI - when creating a slider - replaces the existing HTML with its own markup. This includes any ID values and, for whatever reason, I can't get the index for a given slider to surface either. So I'm running out of ideas.

  Read the article

• PHP - JSON Steam API query

  - by Hunter

  First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

  Read the article

• Having trouble doing an Update with a Linq to Sql object

  - by Pure.Krome

  Hi folks, i've got a simple linq to sql object. I grab it from the database and change a field then save. No rows have been updated. :( When I check the full Sql code that is sent over the wire, I notice that it does an update to the row, not via the primary key but on all the fields via the where clause. Is this normal? I would have thought that it would be easy to update the field(s) with the where clause linking on the Primary Key, instead of where'ing (is that a word :P) on each field. here's the code... using (MyDatabase db = new MyDatabase()) { var boardPost = (from bp in db.BoardPosts where bp.BoardPostId == boardPostId select bp).SingleOrDefault(); if (boardPost != null && boardPost.BoardPostId > 0) { boardPost.ListId = listId; // This changes the value from 0 to 'x' db.SubmitChanges(); } } and here's some sample sql.. exec sp_executesql N'UPDATE [dbo].[BoardPost] SET [ListId] = @p6 WHERE ([BoardPostId] = @p0) AND .... <snip the other fields>',N'@p0 int,@p1 int,@p2 nvarchar(9),@p3 nvarchar(10),@p4 int,@p5 datetime,@p6 int',@p0=1276,@p1=212787,@p2=N'ttreterte',@p3=N'ttreterte3',@p4=1,@p5='2009-09-25 12:32:12.7200000',@p6=72 Now, i know there's a datetime field in this update .. and when i checked the DB it's value was/is '2009-09-25 12:32:12.720' (less zero's, than above) .. so i'm not sure if that is messing up the where clause condition... but still! should it do a where clause on the PK's .. if anything .. for speed! Yes / no ? UPDATE After reading nitzmahone's reply, I then tried playing around with the optimistic concurrency on some values, and it still didn't work :( So then I started some new stuff ... with the optimistic concurrency happening, it includes a where clause on the field it's trying to update. When that happens, it doesn't work. so.. in the above sql, the where clause looks like this ... WHERE ([BoardPostId] = @p0) AND ([ListId] IS NULL) AND ... <rest snipped>) This doesn't sound right! the value in the DB is null, before i do the update. but when i add the ListId value to the where clause (or more to the point, when L2S add's it because of the optomistic concurrecy), it fails to find/match the row. wtf?

  Read the article

• Can highlight the current menu item, but can't add the class= to style unhighleted menu items

  - by bradpotts

  <?php $activesidebar[$currentsidebar]="id=isactive";?> <div class="span3"> <div class="well sidebar-nav hidden-phone"> <ul class="nav nav-list"> <li class="nav-header" <?php echo $activesidebar[1] ?>>Marketing Services</li> <li><a href="#">Marketing Technology</a></li> <li><a href="#">Generate More Sales</a></li> <li><a href="#">Direct Email Marketing</a></li> <li class="nav-header" <?php echo $activesidebar[2] ?>>Advertising Services</li> <li><a href="../services-advertising-mass-media-network.php">Traditional Medias</a></li> <li><a href="#">Online & Social Medias</a></li> <li><a href="#">Media Planing & Purchasing</a></li> <li class="nav-header" <?php echo $activesidebar[3] ?>>Technology Services</li> <li><a href="#">Managed Websites</a></li> <li><a href="#">Managed Web Servers</a></li> <li><a href="#">Managed Databases</a></li> <li class="nav-header" <?php echo $activesidebar[4] ?>>About Us</li> <li><a href="../aboutus-contactus.php">Contact Us</a></li> </ul> </div> This is added to the current page I want to add this on. <?php $currentsidebar =2; include('module-sidebar-navigation.php');?> I had programmed this menu individually on each page, but to make my website dynamic I used one file and use php includes to load the file. I can get the menu to highlight on the current page assigning an id="isactive", how can I assign id="notactive" to the other 3 menu items that are not active on that page. Is there an else or elseif I have to include?

  Read the article

• Java code optimization leads to numerical inaccuracies and errors

  - by rano

  I'm trying to implement a version of the Fuzzy C-Means algorithm in Java and I'm trying to do some optimization by computing just once everything that can be computed just once. This is an iterative algorithm and regarding the updating of a matrix, the clusters x pixels membership matrix U, this is the update rule I want to optimize: where the x are the element of a matrix X (pixels x features) and v belongs to the matrix V (clusters x features). And m is a parameter that ranges from 1.1 to infinity. The distance used is the euclidean norm. If I had to implement this formula in a banal way I'd do: for(int i = 0; i < X.length; i++) { int count = 0; for(int j = 0; j < V.length; j++) { double num = D[i][j]; double sumTerms = 0; for(int k = 0; k < V.length; k++) { double thisDistance = D[i][k]; sumTerms += Math.pow(num / thisDistance, (1.0 / (m - 1.0))); } U[i][j] = (float) (1f / sumTerms); } } In this way some optimization is already done, I precomputed all the possible squared distances between X and V and stored them in a matrix D but that is not enough, since I'm cycling througn the elements of V two times resulting in two nested loops. Looking at the formula the numerator of the fraction is independent of the sum so I can compute numerator and denominator independently and the denominator can be computed just once for each pixel. So I came to a solution like this: int nClusters = V.length; double exp = (1.0 / (m - 1.0)); for(int i = 0; i < X.length; i++) { int count = 0; for(int j = 0; j < nClusters; j++) { double distance = D[i][j]; double denominator = D[i][nClusters]; double numerator = Math.pow(distance, exp); U[i][j] = (float) (1f / (numerator * denominator)); } } Where I precomputed the denominator into an additional column of the matrix D while I was computing the distances: for (int i = 0; i < X.length; i++) { for (int j = 0; j < V.length; j++) { double sum = 0; for (int k = 0; k < nDims; k++) { final double d = X[i][k] - V[j][k]; sum += d * d; } D[i][j] = sum; D[i][B.length] += Math.pow(1 / D[i][j], exp); } } By doing so I encounter numerical differences between the 'banal' computation and the second one that leads to different numerical value in U (not in the first iterates but soon enough). I guess that the problem is that exponentiate very small numbers to high values (the elements of U can range from 0.0 to 1.0 and exp , for m = 1.1, is 10) leads to ver y small values, whereas by dividing the numerator and the denominator and THEN exponentiating the result seems to be better numerically. The problem is it involves much more operations. Am I doing something wrong? Is there a possible solution to get both the code optimized and numerically stable? Any suggestion or criticism will be appreciated.

  Read the article

• Linker Issues with boost::thread under linux using Eclipse and CMake

  - by OcularProgrammer

  I'm in the process of attempting to port some code across from PC to Ubuntu, and am having some issues due to limited experience developing under linux. We use CMake to generate all our build stuff. Under windows I'm making VS2010 projects, and under Linux I'm making Eclipse projects. I've managed to get my OpenCV stuff ported across successfully, but am having major headaches trying to port my threaded boost apps. Just so we're clear, the steps I have followed so-far on a clean Ubuntu 12 installation. (I've done 2 clean re-installs to try and fix potential library cock-ups, now I'm just giving up and asking): Install Eclipse and Eclipse CDT using my package manager Install CMake and CMake Gui using my package manager Install libboost-all-dev using my package manager So-far that's all I've done. I can create the eclipse project using CMake with no errors, so CMake is successfully finding my boost install. When I try and build through eclipse is when I get issues; The app I'm attempting to build uses boost::asio for some UDP I/O and boost::thread to create worker threads for the asio I/O services. I can successfully compile each module, but when I come to link I get spammed with errors such as: /usr/bin/c++ CMakeFiles/RE05DevelopmentDemo.dir/main.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/RE05FusionListener/RE05FusionListener.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/NewEye/NewEye.cpp.o -o RE05DevelopmentDemo -rdynamic -Wl,-Bstatic -lboost_system-mt -lboost_date_time-mt -lboost_regex-mt -lboost_thread-mt -Wl,-Bdynamic /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `void boost::call_once<void (*)()>(boost::once_flag&, void (*)()) [clone .constprop.98]': make[2]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' (.text+0xc8): undefined reference to `pthread_key_create' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::interruption_enabled()': (.text+0x540): undefined reference to `pthread_getspecific' make[1]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x570): undefined reference to `pthread_getspecific' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x59f): undefined reference to `pthread_getspecific' Some Gotchas that I have collected from other StackOverflow posts and have already checked: The boost libs are all present at /usr/lib I am not getting any compile errors for inability to find the boost headers, so they must be getting found. I am trying to link statically, but I believe eclipse should be passing the correct arguments to make that happen since my CMakeLists.txt includes SET(Boost_USE_STATIC_LIBS ON) I'm officially out of ideas here, I have tried doing local builds of boost and a bunch of other stuff with no more success. I even re-installed Ubuntu to ensure I haven't completely fracked the libs directories and links with multiple weird versions or anything else. Any help would be muchly appreciated.

  Read the article

• ASP.Net / MySQL : Translating content into several languages

  - by philwilks

  I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

  Read the article

• Please help fix and optimize this query

  - by user607217

  I am working on a system to find potential duplicates in our customers table (SQL 2005). I am using the built-in SOUNDEX value that our software computes when customers are added/updated, but I also implemented the double metaphone algorithm for better matching. This is the most-nested query I have created, and I can't help but think there is a better way to do it and I'd like to learn. In the inner-most query I am joining the customer table to the metaphone table I created, then finding customers that have identical pKey (primary phonetic key). I take that, union that with customers that have matching soundex values, and then proceed to score those matches with various text similarity functions. This is currently working, but I would also like to add a union of customers whose aKey (alternate phonetic key) match. This would be identical to "QUERY A" except to substitute on (c1Akey = c2Akey) for the join. However, when I attempt to include that, I get errors when I try to execute my query. Here is the code: --Create aggregate ranking select c1Name, c2Name, nDiff, c1Addr, c2Addr, aDiff, c1SSN, c2SSN, sDiff, c1DOB, c2DOB, dDiff, nDiff+aDiff+dDiff+sDiff as Score ,(sDiff+dDiff)*1.5 + (nDiff+dDiff)*1.5 + (nDiff+sDiff)*1.5 + aDiff *.5 + nDiff *.5 as [Rank] FROM ( --Create match scores for different fields SELECT c1Name, c2Name, c1Addr, c2Addr, c1SSN, c2SSN, c1LTD, c2LTD, c1DOB, c2DOB, dbo.Jaro(c1name, c2name) AS nDiff, dbo.JaroWinkler(c1addr, c2addr) AS aDiff, CASE WHEN c1dob = '1901-01-01' OR c2dob = '1901-01-01' OR c1dob = '1800-01-01' OR c2dob = '1800-01-01' THEN .5 ELSE dbo.SmithWaterman(c1dob, c2dob) END AS dDiff, CASE WHEN c1ssn = '000-00-0000' OR c2ssn = '000-00-0000' THEN .5 ELSE dbo.Jaro(c1ssn, c2ssn) END AS sDiff FROM -- Generate list of possible matches based on multiple phonetic matching fields ( select * from -- List of similar names from pKey field of ##Metaphone table --QUERY A BEGIN (select customers.custno as c1Custno, name as c1Name, haddr as c1Addr, ssn as c1SSN, lasttripdate as c1LTD, dob as c1DOB, soundex as c1Soundex, pkey as c1Pkey, akey as c1Akey from Customers WITH (nolock) join ##Metaphone on customers.custno = ##Metaphone.custno) as c1 JOIN (select customers.custno as c2Custno, name as c2Name, haddr as c2Addr, ssn as c2SSN, lasttripdate as c2LTD, dob as c2DOB, soundex as c2Soundex, pkey as c2Pkey, akey as c2Akey from Customers with (nolock) join ##Metaphone on customers.custno = ##Metaphone.custno) as c2 on (c1Pkey = c2Pkey) and (c1Custno < c2Custno) WHERE (c1Name <> 'PARENT, GUARDIAN') and c1soundex != c2soundex --QUERY A END union --List of similar names from pregenerated SOUNDEX field (select t1.custno, t1.name, t1.haddr, t1.ssn, t1.lasttripdate, t1.dob, t1.[soundex], 0, 0, t2.custno, t2.name, t2.haddr, t2.ssn, t2.lasttripdate, t2.dob, t2.[soundex], 0, 0 from Customers t1 WITH (nolock) join customers t2 with (nolock) on t1.[soundex] = t2.[soundex] and t1.custno < t2.custno where (t1.name <> 'PARENT, GUARDIAN')) ) as a ) as b where (sDiff+dDiff)*1.5 + (nDiff+dDiff)*1.5 + (nDiff+sDiff)*1.5 + aDiff *.5 + nDiff *.5 >= 7.5 order by [rank] desc, score desc Previously, I was using joins such as on c1.pkey = c2.pkey or c1.akey = c2.akey or c1.soundex = c2.soundex but the performance was horrendous, and using unions seems to be working a lot better. Out of 103K customers, tt is currently generating a list of 8.5M potential matches (based on the phonetic codes) in 2.25 minutes, and then taking another 2 to score, rank and filter those down to about 3000. So I am happy with the performance, I just can't help but think there is a better way to structure this, and I need help adding the extra union condition. Thanks!

  Read the article

• General workflow to allow multiple OpenIDs to be associated with one app account

  - by BobTodd

  I have a (typical?) scenario: that my app's users can use multiple openids mapped to one app account (like stackoverflow). For me the unique thing on the account is the email address, so this binds openids to the profile. Question is, how to allow a user to start using a second openid once one is setup. I am asking as I have read that it is a security hole to allow automatic account openid syncing simply based on the provider-supplied email address as someone could easily spoof someone's email address to create a spoof openid and falsely access the account (how I am not sure) - although this seems to be exactly how stack operates. See options a. and b. below. Problem for me with a. is what happens if the original openid no longer works for whatever reason - how would you set-up a new openid? Would b. be more acceptable if we used email verification? Does anyone have an article detailing a "standard" way (set of user stories) for this - it seems to be an increasingly popular way to authenticate. I have tried to detail this in a rough decision tree... 1. My Site > authentication landing page - user chooses an openid (facebook, google, myopenid etc), redirection > 2. Provider site returns with token (includes user registering a new openid, logging in or is already logged in to Provider site) 3. My Site > use token id to lookup user 3.1 Profile exists? Yes > authenticate. ends. No > 3.1.1 was email address supplied by provider? Yes > lookup user by email address 3.1.1.1 Profile exists? Yes > a. error message - please login with existing openid and associate this openid (from special page) Yes > b. or associate this openid with existing profile automatically. authenticate. ends. No > Register profile. With registration email address follow 3.1.1, except this time where email is unique, we will associate openid. ends

  Read the article

• ZF Autoloader to load ancestor and requested class

  - by Pekka

  I am integrating Zend Framework into an existing application. I want to switch the application over to Zend's autoloading mechanism to replace dozens of include() statements. I have a specific requirement for the autoloading mechanism, though. Allow me to elaborate. The existing application uses a core library (independent from ZF), for example: /Core/Library/authentication.php /Core/Library/translation.php /Core/Library/messages.php this core library is to remain untouched at all times and serves a number of applications. The library contains classes like class ancestor_authentication { ... } class ancestor_translation { ... } class ancestor_messages { ... } in the application, there is also a Library directory: /App/Library/authentication.php /App/Library/translation.php /App/Library/messages.php these includes extend the ancestor classes and are the ones that actually get instantiated in the application. class authentication extends ancestor_authentication { } class translation extends ancestor_translation { } class messages extends ancestor_messages { } usually, these class definitions are empty. They simply extend their ancestors and provide the class name to instantiate. $authentication = new authentication(); The purpose of this solution is to be able to easily customize aspects of the application without having to patch the core libraries. Now, the autoloader I need would have to be aware of this structure. When an object of the class authentication is requested, the autoloader would have to: 1. load /Core/Library/authentication.php 2. load /App/Library/authentication.php My current approach would be creating a custom function, and binding that to Zend_Loader_Autoloader for a specific namespace prefix. Is there already a way to do this in Zend that I am overlooking? The accepted answer in this question kind of implies there is, but that may be just a bad choice of wording. Are there extensions to the Zend Autoloader that do this? Can you - I am new to ZF - think of an elegant way, conforming with the spirit of the framework, of extending the Autoloader with this functionality? I'm not necessary looking for a ready-made implementation, some pointers (This should be an extension to the xyz method that you would call like this...) would already be enough.

  Read the article

• Hacking "Contact Form 7" code to Add A "Referred By" field

  - by Scott B

  I've got about 6 subdomains that have a "contact us" link and I'm sending all these links to a single form that uses "Contact Form 7". I add ?from=site-name to each of the links so that I can set a $referredFrom variable in the contact form. The only two things I'm missing are (1) the ability to insert this referredFrom variable into the email that I get whenever someone submits the form and (2) The ability to redirect the user back to the site they came from (stored in $referredFrom) Any ideas? Here's a bit of code from includes/classes.php that I thought might be part of the email insert but its not doing much... function mail() { global $referrer; $refferedfrom = $referrer; //HERE IS MY CUSTOM CODE $fes = $this->form_scan_shortcode(); foreach ( $fes as $fe ) { $name = $fe['name']; $pipes = $fe['pipes']; if ( empty( $name ) ) continue; $value = $_POST[$name]; if ( WPCF7_USE_PIPE && is_a( $pipes, 'WPCF7_Pipes' ) && ! $pipes->zero() ) { if ( is_array( $value) ) { $new_value = array(); foreach ( $value as $v ) { $new_value[] = $pipes->do_pipe( $v ); } $value = $new_value; } else { $value = $pipes->do_pipe( $value ); } } $this->posted_data[$name] = $value; $this->posted_data[$refferedfrom] = $referrer; //HERE IS MY CUSTOM CODE } I'm also thinking that I could insert the referredFrom code somewhere in this function as well... function compose_and_send_mail( $mail_template ) { $regex = '/\[\s*([a-zA-Z][0-9a-zA-Z:._-]*)\s*\]/'; $callback = array( &$this, 'mail_callback' ); $mail_subject = preg_replace_callback( $regex, $callback, $mail_template['subject'] ); $mail_sender = preg_replace_callback( $regex, $callback, $mail_template['sender'] ); $mail_body = preg_replace_callback( $regex, $callback, $mail_template['body'] ); $mail_recipient = preg_replace_callback( $regex, $callback, $mail_template['recipient'] ); $mail_headers = "From: $mail_sender\n"; if ( $mail_template['use_html'] ) $mail_headers .= "Content-Type: text/html\n"; $mail_additional_headers = preg_replace_callback( $regex, $callback, $mail_template['additional_headers'] ); $mail_headers .= trim( $mail_additional_headers ) . "\n"; if ( $this->uploaded_files ) { $for_this_mail = array(); foreach ( $this->uploaded_files as $name => $path ) { if ( false === strpos( $mail_template['attachments'], "[${name}]" ) ) continue; $for_this_mail[] = $path; } return @wp_mail( $mail_recipient, $mail_subject, $mail_body, $mail_headers, $for_this_mail ); } else { return @wp_mail( $mail_recipient, $mail_subject, $mail_body, $mail_headers ); } }

  Read the article

• How can I fix this touch event / draw loop "deadlock"?

  - by Josh

  Just want to start out by saying this seems like a great site, hope you guys can help! I'm trying to use the structure laid out in LunarLander to create a simple game in which the user can drag some bitmaps around on the screen (the actual game is more complex, but that's not important). I ripped out the irrelevant parts of LanderLander, and set up my own bitmap drawing, something like BoardThread (an inner class of BoardView): run() { while(mRun) { canvas = lockSurfaceHolder... syncronized(mSurfaceHolder) { /* drawStuff using member position fields in BoardView */ } unlockSurfaceHolder } } My drawStuff simply walks through some arrays and throws bitmaps onto the canvas. All that works fine. Then I wanted to start handling touch events so that when the user presses a bitmap, it is selected, when the user unpresses a bitmap, it is deselected, and if a bitmap is selected during a touch move event, the bitmap is dragged. I did this stuff by listening for touch events in the BoardView's parent, BoardActivity, and passing them down into the BoardView. Something like In BoardView handleTouchEvent(MotionEvent e) { synchronized(mSurfaceHolder) { /* Modify shared member fields in BoardView so BoardThread can render the bitmaps */ } } This ALSO works fine. I can drag my tiles around the screen no problem. However, every once in a while, when the app first starts up and I trigger my first touch event, the handleTouchEvent stops executing at the synchronized line (as viewed in DDMS). The drawing loop is active during this time (I can tell because a timer changes onscreen), and it usually takes several seconds or more before a bunch of touch events come through the pipeline and everything is fine again. This doesn't seem like deadlock to me, since the draw loop is constantly going in and out of its syncronized block. Shouldn't this allow the event handling thread to grab a lock on mSurfaceHolder? What's going on here? Anyone have suggestions for improving how I've structured this? Some other info. This "hang" only ever occurs on first touch event after activity start. This includes on orientation change after restoreState has been called. Also, I can remove EVERYTHING within the syncronized block in the event handler, and it will still get hung up at the syncronized call. Thanks!

  Read the article

• How to add fadeIn and fadeOut to idTabs plugin's JS snippet?

  - by iMagdy

  Hi, I am using the jQuery plugin idTabs [ [www.sunsean.com/idTabs][1] ] and it allows me to line tabs and tabs' content via element#id and element href="#id" Ok, so I use this snippet: <script type="text/javascript"> $(document).ready(function() { $("#requestPool").idTabs(); $(".tabs").idTabs(); $(".miniTabs").idTabs(".active"); $(".switchers").idTabs(".activePanel"); }); </script> To run the plugin on two different areas: div#requestPool this has it's own tabs and it's own tab content, Also the div.tabs which is another place and has it's own tabs and it's own tabs content. The div.miniTabs and div.switchers are the divs that includes the tabs links (tabs headers) and I putted them in the snippet to change the default selected tab class from .selected to .active and .activePanel Now, what I would love to add is a nice fadeIn and fadeOut effects to the content of my tabs while browsing through them. Thanks Here is the HTML code for one of the tabbed areas: <div id="requestPool"> <!-- The tabs heads --> <div class="miniTabs"> <a href="#today" class="active">Today</a> <!-- First active tab --> <a href="#tomorrow">Tomorrow</a> <a href="#friday">Friday</a> <a href="#saturday">Saturday</a> <a href="#sunday">Sunday</a> <a href="#monday">Monday</a> <a href="#tuesday">Tuesday</a> </div> <!-- The tabs contents (the ones that I want them to fade in and out while browsing through them using the tabs above) --> <div id="today"class="miniTab"></div> <div id="tomorrow"class="miniTab"></div> <div id="friday"class="miniTab"></div> <div id="saturday"class="miniTab"></div> <div id="sunday"class="miniTab"></div> ...etc the week days </div> Thanks very much (again the tabs are working very fine, but without the fade effect which I want to have).

  Read the article

• Why is FubuMVC new()ing up my view model in PartialForEach?

  - by Jon M

  I'm getting started with FubuMVC and I have a simple Customer - Order relationship I'm trying to display using nested partials. My domain objects are as follows: public class Customer { private readonly IList<Order> orders = new List<Order>(); public string Name { get; set; } public IEnumerable<Order> Orders { get { return orders; } } public void AddOrder(Order order) { orders.Add(order); } } public class Order { public string Reference { get; set; } } I have the following controller classes: public class CustomersController { public IndexViewModel Index(IndexInputModel inputModel) { var customer1 = new Customer { Name = "John Smith" }; customer1.AddOrder(new Order { Reference = "ABC123" }); return new IndexViewModel { Customers = new[] { customer1 } }; } } public class IndexInputModel { } public class IndexViewModel { public IEnumerable<Customer> Customers { get; set; } } public class IndexView : FubuPage<IndexViewModel> { } public class CustomerPartial : FubuControl<Customer> { } public class OrderPartial : FubuControl<Order> { } IndexView.aspx: (standard html stuff trimmed) <div> <%= this.PartialForEach(x => x.Customers).Using<CustomerPartial>() %> </div> CustomerPartial.ascx: <%@ Control Language="C#" Inherits="FubuDemo.Controllers.Customers.CustomerPartial" %> <div> Customer Name: <%= this.DisplayFor(x => x.Name) %> <br /> Orders: (<%= Model.Orders.Count() %>) <br /> <%= this.PartialForEach(x => x.Orders) %> </div> OrderPartial.ascx: <%@ Control Language="C#" Inherits="FubuDemo.Controllers.Customers.OrderPartial" %> <div> Order <br /> Ref: <%= this.DisplayFor(x => x.Reference) %> </div> When I view Customers/Index, I see the following: Customers Customer Name: John Smith Orders: (1) It seems that in CustomerPartial.ascx, doing Model.Orders.Count() correctly picks up that 1 order exists. However PartialForEach(x = x.Orders) does not, as nothing is rendered for the order. If I set a breakpoint on the Order constructor, I see that it initially gets called by the Index method on CustomersController, but then it gets called by FubuMVC.Core.Models.StandardModelBinder.Bind, so it is getting re-instantiated by FubuMVC and losing the content of the Orders collection. This isn't quite what I'd expect, I would think that PartialForEach would just pass the domain object directly into the partial. Am I missing the point somewhere? What is the 'correct' way to achieve this kind of result in Fubu?

  Read the article

• merge 2 php arrays which aren't of the same length by value

  - by Iain Urquhart

  Excuse me if this has indeed been asked before, I couldn't see anything that fitted my needs out of the dozens of similar titled posts out there ;) I'm trying to merge 2 php arrays which aren't of the same length, and merge them on a value that exists from identical key = values within both arrays. My first query produces an array from a nested set: array ( 1 => array ( 'node_id' => 1, 'lft' => 1, 'rgt' => 4, 'moved' => 0, 'label' => 'Home', 'entry_id' => 1, 'template_path' => '', 'custom_url' => '/', 'extra' => '', 'childs' => 1, 'level' => 0, 'lower' => 0, 'upper' => 0 ), 2 => array ( 'node_id' => 2, 'lft' => 2, 'rgt' => 3, 'moved' => 0, 'label' => 'Home', 'entry_id' => NULL, 'template_path' => '', 'custom_url' => 'http://google.com/', 'extra' => '', 'childs' => 0, 'level' => 1, 'lower' => 0, 'upper' => 0 ) ); My second array returns some additional key/values I'd like to insert to the above array: array ( 'entry_id' => 1, 'entry_title' => 'This is my title', ); I want to merge both of the arrays inserting the additional information into those that match on the key 'entry_id', as well as keeping the sub arrays which don't match. So, by combining the two arrays, I'd end up with array ( 1 => array ( 'node_id' => 1, 'lft' => 1, 'rgt' => 4, 'moved' => 0, 'label' => 'Home', 'entry_id' => 1, 'template_path' => '', 'custom_url' => '/', 'extra' => '', 'childs' => 1, 'level' => 0, 'lower' => 0, 'upper' => 0, 'entry_title' => 'This is my title' ), 2 => array ( 'node_id' => 2, 'lft' => 2, 'rgt' => 3, 'moved' => 0, 'label' => 'Home', 'entry_id' => NULL, 'template_path' => '', 'custom_url' => 'http://google.com/', 'extra' => '', 'childs' => 0, 'level' => 1, 'lower' => 0, 'upper' => 0, 'entry_title' => NULL ) ); Actually, writing this out makes me think I should do it via sql... Any help/advice greatly appreciated...

  Read the article

• jQuery question from a person who can't javascript

  - by Evilalan

  So I'm trying to adapt this Dropdown menu on Joomla the styles work great as expected so I'll post the javascript includes on the head of my website: <script type='text/javascript' src='js/jquery.js'></script> <script type='text/javascript' src='js/dropdown.js'></script> <script type='text/javascript'> $(function() { $('.menu').droppy(); }); </script> <script type='text/javascript'> $(function() { $('.menu').droppy({speed: 100}); }); </script> ok I don't know why its is not working I'll post the dropdown.js should I post the jQuery too? it's really big! $.fn.droppy = function(options) { options = $.extend({speed: 250}, options || {}); this.each(function() { var root = this, zIndex = 1000; function getSubnav(ele) { if (ele.nodeName.toLowerCase() == 'li') { var subnav = $('> ul', ele); return subnav.length ? subnav[0] : null; } else { return ele; } } function getActuator(ele) { if (ele.nodeName.toLowerCase() == 'ul') { return $(ele).parents('li')[0]; } else { return ele; } } function hide() { var subnav = getSubnav(this); if (!subnav) return; $.data(subnav, 'cancelHide', false); setTimeout(function() { if (!$.data(subnav, 'cancelHide')) { $(subnav).slideUp(options.speed); } }, 500); } function show() { var subnav = getSubnav(this); if (!subnav) return; $.data(subnav, 'cancelHide', true); $(subnav).css({zIndex: zIndex++}).slideDown(options.speed); if (this.nodeName.toLowerCase() == 'ul') { var li = getActuator(this); $(li).addClass('hover'); $('> a', li).addClass('hover'); } } $('ul, li', this).hover(show, hide); $('li', this).hover( function() { $(this).addClass('hover'); $('> a', this).addClass('hover'); }, function() { $(this).removeClass('hover'); $('> a', this).removeClass('hover'); } ); }); }; My question here is: Why is it not working! I know that this is really complex (I don't anything about JavaScript) but if you help me I'll post a tutorial and edited files that will help a lot of people! By the way I've download jQuery from the original site so I don't think that this can be the problem! Thanks in advance!

  Read the article

• C# slowdown while creating a bitmap - calculating distances from a large List of places for each pixel

  - by user576849

  I'm creating a graphic of the glow of lights above a geographic location based upon Walkers Law: Skyglow=0.01*Population*DistanceFromCenter^-2.5 I have a CSV file of places with 66,000 records using 5 fields (id,name,population,latitude,longitude), parsed on the FormLoad event and stored it in: List<string[]> placeDataList Then I set up nested loops to fill in a bitmap using SetPixel. For each pixel on the bitmap, which represents a coordinate on a map (latitude and longitude), the program loops through placeDataList – calculating the distance from that coordinate (pixel) to each place record. The distance (along with population) is used in a calculation to find how much cumulative sky glow is contributed to the coordinate from each place record. So, for every pixel, 66,000 distance calculations must be made. The problem is, this is predictably EXTREMELY slow – on the order of one line of pixels per 30 seconds or so on a 320 pixel wide image. This is unrelated to SetPixel, which I know is also slow, because the speed is similarly slow when adding the distance calculation results to an array. I don’t actually need to test all 66,000 records for every pixel, only the records within 150 miles (i.e. no skyglow is contributed to a coordinate from a small town 3000 miles away). But to find which records are within 150 miles of my coordinate I would still need to loop through all the records for each pixel. I can't use a smaller number of records because all 66,000 places contribute to skyglow for SOME coordinate in my map as it loops. This seems like a Catch-22, so I know there must be a better method out there. Like I mentioned, the slowdown is related to how many calculations I’m making per pixel, not anything to do with the bitmap. Any suggestions? private void fillPixels(int width) { Color pixelColor; int pixel_w = width; int pixel_h = (int)Math.Floor((width * 0.424088664)); Bitmap bmp = new Bitmap(pixel_w, pixel_h); for (int i = 0; i < pixel_h; i++) for (int j = 0; j < pixel_w; j++) { pixelColor = getPixelColor(i, j); bmp.SetPixel(j, i, pixelColor); } bmp.Save("Nightfall", System.Drawing.Imaging.ImageFormat.Jpeg); pictureBox1.Image = bmp; MessageBox.Show("Done"); } private Color getPixelColor(int height, int width) { int c; double glow,d,cityLat,cityLon,cityPop; double testLat, testLon; int size_h = (int)Math.Floor((size_w * 0.424088664)); ; testLat = (height * (24.443136 / size_h)) + 24.548874; testLon = (width * (57.636853 / size_w)) -124.640767; glow = 0; for (int i = 0; i < placeDataList.Count; i++) { cityPop=Convert.ToDouble(placeDataList[i][2]); cityLat=Convert.ToDouble(placeDataList[i][3]); cityLon=Convert.ToDouble(placeDataList[i][4]); d = distance(testLat, testLon, cityLat, cityLon,"M"); if(d<150) glow = glow+(0.01 * cityPop * Math.Pow(d, -2.5)); } if (glow >= 1) glow=1; c = (int)Math.Ceiling(glow * 255); return Color.FromArgb(c, c, c); }

  Read the article

• php functions within functions.

  - by Adamski

  Hi all, ihave created a simple project to help me get to grips with php and mysql, but have run into a minor issue, i have a working solution but would like to understand why i cannot run this code successfully this way, ill explain: i have a function, function fetch_all_movies(){ global $connection; $query = 'select distinct * FROM `'.TABLE_MOVIE.'` ORDER BY movieName ASC'; $stmt = mysqli_prepare($connection,$query); mysqli_execute($stmt); mysqli_stmt_bind_result($stmt,$id,$name,$genre,$date,$year); while(mysqli_stmt_fetch($stmt)){ $editUrl = "index.php?a=editMovie&movieId=".$id.""; $delUrl = "index.php?a=delMovie&movieId=".$id.""; echo "<tr><td>".$id."</td><td>".$name."</td><td>".$date."</td><td>".get_actors($id)."</td><td><a href=\"".$editUrl."\">Edit</a> | <a href=\"".$delUrl."\">Delete</a></td></tr>"; } } this fetches all the movies in my db, then i wish to get the count of actors for each film, so i pass in the get_actors($id) function which gets the movie id and then gives me the count of how many actors are realted to a film. here is the function for that: function get_actors($movieId){ global $connection; $query = 'SELECT DISTINCT COUNT(*) FROM `'.TABLE_ACTORS.'` WHERE movieId = "'.$movieId.'"'; $result = mysqli_query($connection,$query); $row = mysqli_fetch_array($result); return $row[0]; } the functions both work perfect when called separately, i just would like to understand when i pass the function inside a function i get this warning: Warning: mysqli_fetch_array() expects parameter 1 to be mysqli_result, boolean given in /Applications/MAMP/htdocs/movie_db/includes/functions.inc.php on line 287 could anyone help me understand why? many thanks.

  Read the article

• Facebook Connect from Localhost, doing some weird stuff

  - by Brett

  So maybe the documentation is out of date, or I am just off here. But I have done a slew of FB iframe apps (connect), but I am starting my first FB Connect site. Running it from localhost, and the Connect URL is http:// my_external_IP_address. When I click on the FB login button on my site, it pops up, says waiting for facebook, and it returns my site in that box, with the URL up top with the http:// mysite/?session={session key, user_id, etc.} The user_id is infact my FB id. And so it thinks I am logged in. If I close the popup, I'm not logged in. I'm not sure why the pop up isn't doing the normal fb connect dialog. I'm following these steps. (I added spaces to the http:// as to not be detected as 'spam') html xmlns="http://www.w3.org/1999/xhtml" xmlns:fb="http://www.facebook.com/2008/fbml" right after <body> <script src="http://static.ak.connect.facebook.com/js/api_lib/v0.4/FeatureLoader.js.php" type="text/javascript"> At the end, before the body close tag: script type="text/javascript"> FB.init("fbkey", "http://127.0.0.1/xd_receiver.htm"); I have tried using xd_receiver.htm, /xd_receiver.htm (and other combos), and that brings up a blank page. using the http://127.0.0.1 at least does something. In my config file, which is called before all of those, it checks for a PHP session key to see if they are logged in, if that doesn't exist it looks for a cookie, and if that doesn't exist it does this: require_once('includes/facebook.php'); $facebook = new Facebook($fbkey, $fbsec); $user_id = $facebook->get_loggedin_user(); if($user_id > 0){ $user = $ac->getUserFromFB($user_id); $_SESSION['user_id'] = $user['user_id']; } The user_id is always empty when I echo it out to the screen to test. The session event never occurs as well. So I don't know what it is doing in the popup, but I think Facebook thinks it is logging me in. Not sure. Pretty stumped on this one. Any help would be appreciated. Thanks!

  Read the article

• Effective optimization strategies on modern C++ compilers

  - by user168715

  I'm working on scientific code that is very performance-critical. An initial version of the code has been written and tested, and now, with profiler in hand, it's time to start shaving cycles from the hot spots. It's well-known that some optimizations, e.g. loop unrolling, are handled these days much more effectively by the compiler than by a programmer meddling by hand. Which techniques are still worthwhile? Obviously, I'll run everything I try through a profiler, but if there's conventional wisdom as to what tends to work and what doesn't, it would save me significant time. I know that optimization is very compiler- and architecture- dependent. I'm using Intel's C++ compiler targeting the Core 2 Duo, but I'm also interested in what works well for gcc, or for "any modern compiler." Here are some concrete ideas I'm considering: Is there any benefit to replacing STL containers/algorithms with hand-rolled ones? In particular, my program includes a very large priority queue (currently a std::priority_queue) whose manipulation is taking a lot of total time. Is this something worth looking into, or is the STL implementation already likely the fastest possible? Along similar lines, for std::vectors whose needed sizes are unknown but have a reasonably small upper bound, is it profitable to replace them with statically-allocated arrays? I've found that dynamic memory allocation is often a severe bottleneck, and that eliminating it can lead to significant speedups. As a consequence I'm interesting in the performance tradeoffs of returning large temporary data structures by value vs. returning by pointer vs. passing the result in by reference. Is there a way to reliably determine whether or not the compiler will use RVO for a given method (assuming the caller doesn't need to modify the result, of course)? How cache-aware do compilers tend to be? For example, is it worth looking into reordering nested loops? Given the scientific nature of the program, floating-point numbers are used everywhere. A significant bottleneck in my code used to be conversions from floating point to integers: the compiler would emit code to save the current rounding mode, change it, perform the conversion, then restore the old rounding mode --- even though nothing in the program ever changed the rounding mode! Disabling this behavior significantly sped up my code. Are there any similar floating-point-related gotchas I should be aware of? One consequence of C++ being compiled and linked separately is that the compiler is unable to do what would seem to be very simple optimizations, such as move method calls like strlen() out of the termination conditions of loop. Are there any optimization like this one that I should look out for because they can't be done by the compiler and must be done by hand? On the flip side, are there any techniques I should avoid because they are likely to interfere with the compiler's ability to automatically optimize code? Lastly, to nip certain kinds of answers in the bud: I understand that optimization has a cost in terms of complexity, reliability, and maintainability. For this particular application, increased performance is worth these costs. I understand that the best optimizations are often to improve the high-level algorithms, and this has already been done.

  Read the article

• Is it possible to use .data() as a search criteria?

  - by Andrew

  I have a pretty complex chat application going on, and there are multiple chat panes, chat entries, chat submits, etc. going on in the same window. At first I was going to do something like.... <input type="text" class="chattext" id="chattext-42"> <input type="text" class="chattext" id="chattext-93"> <input type="button" class="chatsubmit" id="chatsubmit-42"> <input type="button" class="chatsubmit" id="chatsubmit-93"> ... etc. (of course this is vastly simplified, they'd be in separate divs, separate visibilities, etc) So, when they clicked on a .chatsubmit, it would then get the id of that and find the last two characters for the chat ID. This presents some problems, as it would require rewrites if IDs changed lengths, and seems just plain inelegant to me. I then remembered the .data() facility in jQuery... I thought, maybe I could do it more like this: <input type="text" class="chattext"> ... and add a .data("id", 42) to this one <input type="button" class="chatsubmit"> ... and add a .data("id", 42) So that when they click chatsubmit, it gets the ID, and then finds the chattext with that ID and processes it. But looking at the documentation, I don't see an easy way to search by this. For example, let's say the event target in this case is the chatsubmit with the data('id') of 42... var ID = $(event.target).data('id'); // Sets it to 42 var chattext = ... And here I run into the trouble. How do I find which DOM element matches a class of chattext and a data('id') of 42? Is there any easy method, or do I have to search every .chattext for the one with an id of 42? Or is there another easy way of doing this? I did consider the possibility of the container div having the ID, which would make it, I think,? slightly easier to get. But if this works, it could be dealing with things in other container divs as well, making that not a long-term solution. Edit: Literally seconds after posting this, I found this: http://james.padolsey.com/javascript/extending-jquerys-selector-capabilities/ which includes information on extending the selector to data. So I'll try that out, and in the meantime, is this a completely foolhardy way of handling this?

  Read the article

• C++ Template const char array to int

  - by Levi Schuck

  So, I'm wishing to be able to have a static const compile time struct that holds some value based on a string by using templates. I only desire up to four characters. I know that the type of 'abcd' is int, and so is 'ab','abc', and although 'a' is of type char, it works out for a template<int v> struct What I wish to do is take sizes of 2,3,4,5 of some const char, "abcd" and have the same functionality as if they used 'abcd'. Note that I do not mean 1,2,3, or 4 because I expect the null terminator. cout << typeid("abcd").name() << endl; tells me that the type for this hard coded string is char const [5], which includes the null terminator on the end. I understand that I will need to twiddle the values as characters, so they are represented as an integer. I cannot use constexpr since VS10 does not support it (VS11 doesn't either..) So, for example with somewhere this template defined, and later the last line template <int v> struct something { static const int value = v; }; //Eventually in some method cout << typeid(something<'abcd'>::value).name() << endl; works just fine. I've tried template<char v[5]> struct something2 { static const int value = v[0]; } template<char const v[5]> struct something2 { static const int value = v[0]; } template<const char v[5]> struct something2 { static const int value = v[0]; } All of them build individually, though when I throw in my test, cout << typeid(something2<"abcd">::value).name() << endl; I get 'something2' : invalid expression as a template argument for 'v' 'something2' : use of class template requires template argument list Is this not feasible or am I misunderstanding something?

  Read the article

• Execution plan issue requires reset on SQL Server 2005, how to determine cause?

  - by Tony Brandner

  We have a web application that delivers training to thousands of corporate students running on top of SQL Server 2005. Recently, we started seeing that a single specific query in the application went from 1 second to about 30 seconds in terms of execution time. The application started throwing timeouts in that area. Our first thought was that we may have incorrect indexes, so we reviewed the tables and indexes. However, similar queries elsewhere in the application also run quickly. Reviewing the indexes showed us that they were configured as expected. We were able to narrow it down to a single query, not a stored procedure. Running this query in SQL Studio also runs quickly. We tried running the application in a different server environment. So a different web server with the same query, parameters and database. The query still ran slow. The query is a fairly large one related to determining a student's current list of training. It includes joins and left joins on a dozen tables and subqueries. A few of the tables are fairly large (hundreds of thousands of rows) and some of the other tables are small lookup tables. The query uses a grouping clause and a few where conditions. A few of the tables are quite active and the contents change often but the volume of added rows doesn't seem extreme. These symptoms led us to consider the execution plan. First off, as soon as we reset the execution plan cache with the SQL command 'DBCC FREEPROCCACHE', the problem went away. Unfortunately, the problem started to reoccur within a few days. The problem has continued to plague us for awhile now. It's usually the same query, but we did appear to see the problem occur in another single query recently. It happens enough to be a nuisance. We're having a heck of a time trying to fix it since we can't reproduce it in any other environment other than production. I have downloaded the High Availability guide from Red Gate and I read up more on execution plans. I hope to run the profiler on the live server, but I'm a bit concerned about impact. I would like to ask - what is the best way to figure out what is triggering this problem? Has anyone else seen this same issue?

  Read the article

< Previous Page | 275 276 277 278 279 280 281 282 283 284 285 286  | Next Page >