Search Results

Search found 59194 results on 2368 pages for 'depth first search'.

Page 283/2368 | < Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >

• Find records IN BETWEEN Date Range

  - by Muhammad Kashif Nadeem

  Please see attached image I have a table which have FromDate and ToDate. FromDate is start of some event and ToDate is end of taht event. I need to find a record if search criteria is in between range of dates. e.g. If a record has FromDate 2010/15/5 and ToDate 2010/15/25 and my criteria is FromDate 2010/5/18 and ToDate is 2010/5/21 then this record should be in search results becasue this is in the range of 15 to 25. Following is my search query (chunk of) SELECT m.EventId FROM MajorEvents WHERE ( (m.LocationID = @locationID OR @locationID IS NULL) OR M.LocationID IS NULL) AND ( CONVERT(VARCHAR(10),M.EventDateFrom,23) BETWEEN CONVERT(VARCHAR(10),@DateTimeFrom,23) AND CONVERT(VARCHAR(10),@DateTimeTo,23) OR CONVERT(VARCHAR(10),M.EventDateTo,23) BETWEEN CONVERT(VARCHAR(10),@DateTimeFrom,23) AND CONVERT(VARCHAR(10),@DateTimeTo,23) ) If Search Criteria is equal to FromDate or ToDate then results are ok e.g. If search criterai is DateFrom = 2010/5/15 AND DateTo = 2010/5/18 then this record will return becasue Date From is exactly what is DateFrom in db. OR If search criterai is DateFrom = 2010/5/22 AND DateTo = 2010/5/25 then this record will return becasue Date To is exactly what is DateTo in db But if anything in between this range it does not work Thanks for the help.

  Read the article

• CTE to build a list of departments and managers (hierarchical)

  - by Milky Joe

  I need to generate a list of users that are managers, or managers of managers, for company departments. I have two tables; one details the departments and one contains the manager hierarchy (simplified): CREATE TABLE [dbo].[Manager]( [ManagerId] [int], [ParentManagerId] [int]) CREATE TABLE [dbo].[Department]( [DepartmentId] [int], [ManagerId] [int]) Basically, I'm trying to build a CTE that will give me a list of DepartmentIds, together with all ManagerIds that are in the manager hierarchy for that department. So... Say Manager 1 is the Manager for Department 1, and Manager 2 is Manager 1's Manager, and Manager 3 is Manager 2's Manager, I'd like to see: DepartmentId, ManagerId 1, 1 1, 2 1, 3 Basically, managers are able to deal with all of their sub-manager's departments. Building the CTE to return the Manager hierarchy was fairly simple, but I'm struggling to inject the Departments in there: WITH DepartmentManagers AS ( SELECT ManagerId, ParentManagerId, 0 AS Depth From Manager UNION ALL SELECT Manager.ManagerId, Manager.ParentManagerId, DepartmentManagers.Depth + 1 AS Depth FROM Manager INNER JOIN DepartmentManagers ON DepartmentManagers.ManagerId = Manager.ParentManagerId ) Can anyone help?

  Read the article

• Jquery load DIV inside another DIV at same page

  - by Sergio

  HTML: <div class="someclass" rel="first">text 1</div> <div class="someclass" rel="second">text 2</div></div></div> <div class="info_ly">here is some text</div> <div class="first" > the first DIV </div> <div class="second" > the second DIV </div> CSS: .first{ display:none} .second{ display:none} Jquery: $(".someclass").click(function() { $(".info_ly").html($(this).attr('rel')); }); I want to call and load the "rel" DIV inside "info_ly" DIV. With this Jquery code I get only text "first" or "second" inside "info_ly" DIV. How can I load the DIV with the class "first" or DIV with the class "second" inside "info_ly" DIV?

  Read the article

• IE "Microsoft JScript runtime error: Object expected"

  - by Stephen Borg

  Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Why has my computer started to make noises when I turn it on after I put it into sleep mode for the first time a week ago?

  - by Acid2

  I would usually have my pc on all day and fully shut it down at night time before I went to bed. I decided to put it into sleep mode instead the other day and everything was fine but when I woke it from sleep, I was presented with the blue screen of death and it started with some weird noise that sounded like some spinning part was off balance or possibly hitting something periodically. Sounds like it could be a fan or maybe the HDD. I'm not sure why sleep mode would mess up the hardware. Anyway, now sometimes, randomly, when I turn my computer on from a previous shut down, I still get to hear the noise but the start-up is normal. Sometimes I don't hear anything for the entire duration while I have it on and sometimes it goes away after a few minutes and sometimes it doesn't and I have to restart, like it isn't going away right now. I can hear the noise as I type this. Anyone got possible solutions? I don't want to open the system and mess up other stuff. I'm also not sure if I should take it somewhere to have it fixed - it might not make the noise then and work like normal and nothing would seem like needing to be fixed. Add: I'm running Windows 7, if that's of any relevance.

  Read the article

• Help with this reg. exp. in PHP

  - by Jonathan

  Hi, i don't know about regular expressions, I asked here for one that: gets either anything up to the first parenthesis/colon or the first word inside the first parenthesis. This was the answer: preg_match('/(?:^[^(:]+|(?<=^\\()[^\\s)]+)/', $var, $match); I need an improvement, I need to get either anything up to the first parenthesis/colon/quotation marks or the first word inside the first parenthesis. So if I have something like: $var = 'story "The Town in Hell"s Backyard'; // I get this: $match = 'story'; $var = "screenplay (based on)"; // I get this: $match = 'screenplay'; $var = "(play)"; // I get this: $match = 'play'; $var = "original screen"; // I get this: $match = 'original screen'; Thanks!

  Read the article

• X11 and ARGB visuals: does DefaultDepth() never return 32?

  - by Andy

  Hi, I'm establishing a connection to the X server like this: display = XOpenDisplay(NULL); screen = DefaultScreen(display); depth = DefaultDepth(display, screen); I'm wondering now why "depth" is always set to 24. I would expect that it is only 24 when compositing is turned off, but in fact, it is still 24 even when I turn on compositing. So in order to get a 32-bit ARGB visual I need to call XGetVisualInfo() first with depth set explicitly to 32. Now to my question: Will DefaultDepth() generally never return more than 24 or is it just on my system? (my graphics board is somewhat dated...). I know that it could return 15, 16 or even 8 for a CLUT display but can it return 32? Or do I always have to use XGetVisualInfo() first to get a ARGB 32-bit visual? Thanks, Andy

  Read the article

• DOM class injection in PHP

  - by Adam Kiss

  idea Via jQuery, I was able to mark all :first-child and :last-child elements in document (well, almost all :)) with class first which could I later style (i.e. first li in ul#navigation would be easily adressable as ul#navigation .first). I used following code: var $f = $('*:first-child') $f.addClass('first'); var $l = $('body *:last-child') $l.addClass('last'); question Now, my question is if it's possible to do the same via php, so non-JS users/gadgets could have the same effects and additional styling and also it would be less overkill on browser. So, is it possible to capture output, parse it as html and inject this class easily in php?

  Read the article

• Excel file reading with 2007 office connection string.

  - by p-vasuu

  Actually in my system having 2007 office then i am reading the 2003 .xls file with using the 2007 connection string string ConnectionString = "Provider=Microsoft.ACE.OLEDB.12.0;Data Source=" + Filename + ";Extended Properties=\"Excel 8.0;HDR=YES;\""; data is not reading. But if the first row first column data length is lessthen 255 then the following first columns data is cutting up to 255 character. If the First row first column is morethan the 255 character then the following first columns data is reading fine. Is there any back word computability is there?

  Read the article

• PHP: Is there an elegant way to foreach through multiple items (groups) at a time?

  - by acheong87

  Given an array of N items: $arr = array('a', 'b', 'c', 'd', 'e', 'f'); What's the most elegant way to loop through in groups of M items (assuming N is divisible by M)? I tried foreach (array_chunk($arr, 2) as list($first, $second)) { // do stuff with $first and $second } but this resulted in a syntax error. In other words, I want to emulate what in Tcl would look like this: set arr [a b c d e f] foreach {first second} $arr { // do stuff with $first and $second } For now I've resorted to the obvious measure: foreach (array_chunk($arr, 2) as $group) { $first = $group[0]; $second = $group[1]; // do stuff with $first and $second } But I'm hoping someone has a more elegant method...

  Read the article

• How do I construct a 3D model of a room from 2 stereo cameras? What is the determining factor to an

  - by yasumi

  Currently, I have extracted depth points to construct a 3D model from 2 stereo cameras. The methods I have used are openCV graphCut method and a software from http://sourceforge.net/projects/reconststereo/. However, the generated 3D models are not very accurate, which leads me to question: 1) What is the problem with pixel-based method? 2) Should I change my pixel-based method to feature-based or object-recognition-based method? Is there a best method? 3) Are there any other ways to do such reconstruction? Additionally, the depth extracted comes only from 2 images. What if I am turning the camera 360 degrees to obtain a video? Looking forward to suggestion on how to combine this depth information. Thank you very much :)

  Read the article

• How to change image on locale base in magento?

  - by Nil

  I want to change search image in magento. On search in magento the image name is btn_search.gif. Right now it take image from skin/frontend/default/default/images. And the file is /app/design/frontend/default/default/template/catalogsearch/form.mini.phtml where mention this tag as <input id="search-button" type="image" src="<?php echo $this->getSkinUrl('images/btn_search.gif') ?>" alt="<?php echo $this->__('Search') ?>" /> I check the code and i found that we can pass locale as _type in this as <input id="search-button" type="image" src="<?php echo $this->getSkinUrl('images/btn_search.gif', array('_type'=>'local')) ?>" alt="<?php echo $this->__('Search') ?>" /> But when i check the code this will just check in locale directory that this file exist in that locale or not. If this exist then it will take skin image. I want to use that locale image instead of that skin image. So when i click on french store i get the image which is i set in /app/design/frontend/default/default/locale/fr_FR/images/btn_search.gif I check the code for getSkinUrl in /app/code/core/Mage/Core/Model/Design/Package.php. And i found that he check locale for file but it return skin url. Is there any method which return locale url ?

  Read the article

• Post parameters to a frame of new window

  - by st.stoqnov

  I have to modify an existing web search page. There is a page, where all the search filters are (form with name "searchform"). When the search button is pressed, results are shown in new window. Because the search takes up to 30 seconds, and while searching the window stays blank, I have to add a label "Searching. Please wait..." at the new created window with the results. So the search window is created, and I set it's location to a frameset. First frame will show the label, and the second will show the results. But i can't manage to update the second frame with the results. Result windows is created as: var left = (screen.width/2) - 750/2; var top = (screen.height/2) - 600/2-100; var styleStr = 'toolbar=no,location=no,directories=no,status=no,menubar=no,scrollbars=yes,resizable=yes,copyhistory=yes,width=750,height=600,left='+left+',top='+top+',screenX='+left+',screenY='+top; var msgWindow = window.open('ex_search_frameset.php', 'results_exi', styleStr); msgWindow.focus(); Than the search is requested: f = document.searchform; f.action = 'ex_search_results.php'; f.target = msgWindow.document.res_frame; // here i can't figure out what the target must be // or how to post the params from "f" to the second frame "res_frame" f.submit(); Here is the frameset. <frameset rows="200,*" border="1" name="SearchFrame"> <frame name="wait_frame" src="ex_search_wait.php" target="right"> <frame name="res_frame" src="ex_search_results.php" target="_self"> </frameset> Any idea how to do this?

  Read the article

• recursively reverse linked list.

  - by Amanda

  I am implementing a function to recursively reverse a linked-list, but getting seg-fault. typedef struct _node { int data; struct _node *next; } Node, *NodeP; NodeP recursiveReverseList(NodeP first){ if(first == NULL) return NULL; if(first->next == NULL) return head; NodeP rest = recursiveReverseList(head->next); rest->next = first; first->next = NULL; return first; } Can you please help. P.S. The iterative version is working fine though. Its not homework. Just practicing C.

  Read the article

• How do i implement tag searching with lucene?

  - by acidzombie24

  I havent used lucene. Last time i ask (many months ago, maybe a year) people suggested lucene. As am example say there are 3 items tag like this apples carrots apples carrots apple banana if a user search apples i dont care if there is any preference from 1,2 and 4. However i seen many forums do this which i hated is when a user search apple carrots 2 and 3 are get high results while 1 is hard to find even though it matches my search more closely. I HATED this in forums. Also i would like the ability to do search carrots -apples which will only get me 3. I am not sure what should happen if i search carrots banana but anyways as long as more 2 and 3 results are lower priority then 1 when i search apples carrots i'll be happy. Can lucene do this? and where do i start? i see a lot of classes and many of them talk about docs. What should i use for tagging?

  Read the article

• In Javascript, what's better than try/catch for exiting an outer scope?

  - by gruseom

  In Javascript, I sometimes want to return a value from a scope that isn't the current function. It might be a block of code within the function, or it might be an enclosing function as in the following example, which uses a local function to recursively search for something. As soon as it finds a solution, the search is done and the whole thing should just return. Unfortunately, I can't think of a simpler way to do this than by hacking try/catch for the purpose: function solve(searchSpace) { var search = function (stuff) { solution = isItSolved(stuff); if (solution) { throw solution; } else { search(narrowThisWay(stuff)); search(narrowThatWay(stuff)); }; }; try { return search(searchSpace); } catch (solution) { return solution; }; }; I realize one could assign the solution to a local variable and then check it before making another recursive call, but my question is specifically about transfer of control. Is there a better way than the above? Perhaps involving label/break?

  Read the article

• C++ : Swapping template class elements of different types?

  - by metamemetics

  template< class T1, class T2 > class Pair { T1 first; T2 second; }; I'm being asked to write a swap() method so that the first element becomes the second and the second the first. I have: Pair<T2,T1> swap() { return Pair<T2,T1>(second, first); } But this returns a new object rather than swapping, where I think it needs to be a void method that changes its own data members. Is this possible to do since T1 and T2 are potentially different class types? In other words I can't simply set temp=first, first=second, second=temp because it would try to convert them to different types. I'm not sure why you would potentially want to have a template object that changes order of its types as it seems that would cause confusion but that appears to be what I'm being asked to do.

  Read the article

• Sending variable data from one of two text boxes to javascript

  - by Enyalius

  Greetings, all! I am fairly new to JS (my background is in C++, enterprise languages like assembly and COBOL, and some light .NET), so I was wondering if I could get some advice regarding how to send variable information from one of two text boxes to some javascript and then have the JS do some basic checks and such. Here's the pseudocode for what I am trying to do: <form = webForm> <p> _____________ textboxPeople| searchIcon //a text box to search an online phonebook at my company. ------------- //It has a little "magnifying glass" icon to search //(onClick), but I would also like them to be able to //search by hitting the "enter" key on their keyboards. </p> <p> _____________ texboxIntranet| searchIcon //Same as above search textbox, but this one is used if ------------- //the user wishes to search my corporate intranet site. </form> So ends the front-facing basic form that I would like to use. Now, onClick or onEnter, I would like the form to pass the contents of the text box used as well as an identifier such as "People" or "Intranet," depending on which box is used, to some basic JS on the back end: begin JavaScript: if(identifier = 'People') fire peopleSearch(); else if(identifier = 'Intranet') fire intranetSearch(); function peopleSearch() { http://phonebook.corporate.com/query=submittedValue //This will take the person //that the user submitted in the form and //place it at the end of a URL, after which //it will open said complete URL in the //same window. } function intranetSearch() { http://intranet.corporate.com/query=submittedValue //This will function in the //same way as the people search function. } end JavaScript Any thoughts/suggestions would be greatly appreciated. Thank you all in advance!

  Read the article

• How to check whether iterators form a contiguous memory zone?

  - by Vincent

  I currently have the following function to read an array or a vector of raw data (_readStream is a std::ifstream) : template<typename IteratorType> inline bool MyClass::readRawData( const IteratorType& first, const IteratorType& last, typename std::iterator_traits<IteratorType>::iterator_category* = nullptr ) { _readStream.read(reinterpret_cast<char*>(&*first), (last-first)*sizeof(*first)); return _readStream.good(); } First question : does this function seem ok for you ? As we read directly a block of memory, it will only work if the memory block from first to last is contiguous in memory. How to check that ?

  Read the article

• Facebook Sponsored Results: Is It Getting Results?

  - by Mike Stiles

  Social marketers who like to focus on the paid aspect of the paid/earned hybrid Facebook represents may want to keep themselves aware of how the network’s new Sponsored Results ad product is performing. The ads, which appear when a user conducts a search from the Facebook search bar, have only been around a week or so. But the first statistics coming out of them are not bad. Marketer Nanigans says click-through rates on the Sponsored Results have been nearly 23 times better than regular Facebook ads. Some click-through rates have even gone over 3%. Just to give you some perspective, a TechCrunch article points out that’s the same kind of click-through rates that were being enjoyed during the go-go dot com boom of the 90’s. The average across the Internet in its entirety is now somewhere around .3% on a good day, so a 3% number should be enough to raise an eyebrow. Plus the cost-per-click price is turning up 78% lower than regular Facebook ads, so that should raise the other eyebrow. Marketers have gotten pretty used to being able to buy ads against certain keywords. Most any digital property worth its salt that sells ads offers this, and so does Facebook with its Sponsored Results product. But the unique prize Facebook brings to the table is the ability to also buy based on demographic and interest information gleaned from Facebook user profiles. With almost 950 million logging in, this is exactly the kind of leveraging of those users conventional wisdom says is necessary for Facebook to deliver on its amazing potential. So how does the Facebook user fit into this? Notorious for finding out exactly where sponsored marketing messages are appearing and training their eyeballs to avoid those areas, will the Facebook user reject these Sponsored Results? Well, Facebook may have found an area in addition to the News Feed where paid elements can’t be avoided and will be tolerated. If users want to read their News Feed, and they do, they’re going to see sponsored posts. Likewise, if they want to search for friends or Pages, and they do, they’re going to see Sponsored Results. The paid results are clearly marked as such. As long as their organic search results are not tainted or compromised, they will continue using search. But something more is going on. The early click-through rate numbers say not only do users not mind seeing these Sponsored Results, they’re finding them relevant enough to click on. And once they click, they seem to be liking what they find, with a reported 14% higher install rate than Marketplace Ads. It’s early, and obviously the jury is still out. But this is a new social paid marketing opportunity that’s well worth keeping an eye on, and that may wind up hitting the trifecta of being effective for the platform, the consumer, and the marketer.

  Read the article

• Keeping up with New Releases

  - by Jeremy Smyth

  You can keep up with the latest developments in MySQL software in a number of ways, including various blogs and other channels. However, for the most correct (if somewhat dry and factual) information, you can go directly to the source.  Major Releases  For every major release, the MySQL docs team creates and maintains a "nutshell" page containing the significant changes in that release. For the current GA release (whatever that is) you'll find it at this location: https://dev.mysql.com/doc/mysql/en/mysql-nutshell.html  At the moment, this redirects to the summary notes for MySQL 5.6. The notes for MySQL 5.7 are also available at that website, at the URL http://dev.mysql.com/doc/refman/5.7/en/mysql-nutshell.html, and when eventually that version goes GA, it will become the currently linked notes from the URL shown above. Incremental Releases  For more detail on each incremental release, you can have a look at the release notes for each revision. For MySQL 5.6, the release notes are stored at the following location: http://dev.mysql.com/doc/relnotes/mysql/5.6/en/ At the time I write this, the topmost entry is a link for MySQL 5.6.15. Each linked page shows the changes in that particular version, so if you are currently running 5.6.11 and are interested in what bugs were fixed in versions since then, you can look at each subsequent release and see all changes in glorious detail. One really clever thing you can do with that site is do an advanced Google search to find exactly when a feature was released, and find out its release notes. By using the preceding link in a "site:" directive in Google, you can search only within those pages for an entry. For example, the following Google search shows pages within the release notes that reference the --slow-start-timeout option:     site:http://dev.mysql.com/doc/relnotes/mysql/ "--slow-start-timeout" By running that search, you can see that the option was added in MySQL 5.6.5 and also rolled into MySQL 5.5.20.   White Papers Also, with each major release you can usually find a white paper describing what's new in that release. In MySQL 5.6 there was a "What's new" whitepaper at this location: http://www.mysql.com/why-mysql/white-papers/whats-new-mysql-5-6/ You'll find other white papers at: http://www.mysql.com/why-mysql/white-papers/ Search the page for "5.6" to see any papers dealing specificallly with that version.

  Read the article

• Remove Clutter from the Opera Speed Dial Page

  - by Asian Angel

  Do you want to clean up the Speed Dial page in Opera so that only the thumbnails are visible? Today we show you a couple of tweaks that will make it happen. Speed Dial Page The search bar and text at the bottom take up room and add clutter to the look and feel of Opera’s Speed Dial page. Changing the Settings Two small tweaks to the config settings will clean it all up. To get started type opera:config into the address bar and press enter. Type “speed” into the quick find bar and look for the Speed Dial State entry. Change the 1 to 2 and click save. You will see the following message concerning the changes…click OK. Next type “search” into the quick find bar and look for the Speed Dial Search Type entry. Remove all of the text in the blank and click save. Once again you will see a message about the latest change that you have made. At this point you may need to restart Opera for both changes to take full effect. There will be a noticeable difference in how the Speed Dial page looks afterwards and is much cleaner without the Search bar and text field. You will also still be able to access the right click context menu just like before. Conclusion If you have been looking to get a cleaner and less cluttered Speed Dial page in Opera, then these two little hacks will get the job done! Similar Articles Productive Geek Tips Set the Speed Dial as the Opera Startup PageReplace Google Chrome’s New Tab Page with Speed DialSpeed up Windows Vista Start Menu Search By Limiting ResultsBlank New Tab Quick-Fix for Google ChromeMonitor and Control Memory Usage in Google Chrome TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips VMware Workstation 7 Acronis Online Backup DVDFab 6 Revo Uninstaller Pro Backup Outlook 2010 Daily Motivator (Firefox) FetchMp3 Can Download Videos & Convert Them to Mp3 Use Flixtime To Create Video Slideshows Creating a Password Reset Disk in Windows Bypass Waiting Time On Customer Service Calls With Lucyphone

  Read the article

• Is my work on a developer test being taken advantage of?

  - by CodeWarrior

  I am looking for a job and have applied to a number of positions. One of them responded, I had a pretty lengthy phone interview (perhaps an hour +) and they then set me up with a developer test. I was told that this test is estimated to take between 6 and 8 hours and that, provided it met with their approval, I could be paid for my work on it. That gave me some pause, but I endeavored. The developer test took place on a VM accessed via RDP. The task was to implement a search page in a web project that requests data from the server, displays it on the screen in a table, has a pretty complicated search filtering scheme (there are about 15 statuses and when sending the search to the server you can search by these statuses) in addition to the string/field search. They want some SVG icons to change color on certain data values, they want some data to be represented differently than how it is in the database, etc. Loooong story short, this took one heck of a lot longer than 6-8 hours. Much of it was due to the very poor VM that I was running on (Visual Studio 2013 took 10 minutes to load, and another 15 minutes to open the 3 GB ginormous solution). After completing, I was told to commit my changes to source control... Hmm, OK. I get an email back that they thought that the SVGs could have their color changed differently, they found a bug in this edge-case, there was an occasional problem with this other thing that I never experienced, etc. So I am 13-14 hours into this thing now, and I have to do bug fixes. I do them, and they come back with some more. This is all apparently going into a production application. I noticed some anomalies in the code that was already in there where it looked like other people had coded all of one functionality and not anything else that I could find. Am I just being used for cheap labor? Even if they pay me the promised 50 dollars and hour for 6 hours, I have committed like 18 hours to this thing now. If I bug fix all of the stuff they keep coming up with, I will have worked at least 16 hours for free. I have taken a number of developer tests. I have never taken one where I worked on code that was destined for production. I have never taken one where I implemented a feature that was in the pipeline for development (it was planned for, and I implemented it through the course of the test). And I have never taken one that took 4 rounds and a total of 20+ hours. I get the impression that they are using their developer test to field some of the functionality, that they don't have time for in their normal team, on the cheap. Also, I wouldn't mind a 'devtest' tag.

  Read the article

• How to temporarily save the result of the query, to use in another?

  - by Truth

  I have this problem I think you may help me with. P.S. I'm not sure how to call this, so if anyone finds a more appropriate title, please do edit. Background I'm making this application for searching bus transit lines. Bus lines are a 3 digit number, and is unique and will never change. The requirement is to be able to search for lines from stop A to stop B. The user interface is already successful in hinting the user to only use valid stop names. The requirement is to be able to display if a route has a direct line, and if not, display a 2-line and even 3-line combination. Example: I need to get from point A to point D. The program should show: If there's a direct line A-D. If not, display alternative, 2 line combos, such as A-C, C-D. If there aren't any 2-line combos, search for 3-line combos: A-B, B-C, C-D. Of course, the app should display bus line numbers, as well as when to switch buses. What I have: My database is structured as follows (simplified, actual database includes locations and times and whatnot): +-----------+ | bus_stops | +----+------+ | id | name | +----+------+ +-------------------------------+ | lines_stops_relationship | +-------------+---------+-------+ | bus_line | stop_id | order | +-------------+---------+-------+ Where lines_stops_relationship describe a many-to-many relationship between the bus lines and the stops. Order, signifies the order in which stops appear in a single line. Not all lines go back and forth, and order has meaning (point A with order 2 comes after point B with order 1). The Problem We find out if a line can pass through the route easily enough. Just search for a single line which passes through both points in the correct order. How can I find if there's a 2/3 line combo? I was thinking to search for a line which matches the source stop, and one for the destination stop, and see if I can get a common stop between them, where the user can switch buses. How do I remember that stop? 3 line combo is even trickier, I find a line for the source, and a line for the destination, and then what? Search for a line which has 2 stops I guess, but again, How do I remember the stops? tl;dr How do I remember results from a query to be able to use it again? I'm hoping to achieve this in a single query (for each, a query for 1-line routes, a query for 2, and a query for 3-line combos). Note: I don't mind if someone suggests a completely different approach than what I have, I'm open to any solutions. Will award any assistance with a cookie and an upvote. Thanks in advance!

  Read the article

< Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >