Search Results

Search found 8424 results on 337 pages for 'task'.

Page 285/337 | < Previous Page | 281 282 283 284 285 286 287 288 289 290 291 292  | Next Page >

• How do you clear your mind after 8-10 hours per day of coding?

  - by Bryan

  Related Question- Ways to prepare your mind before coding?. I'm having a hard time taking my mind off of work projects in my personal time. It's not that I have a stressful job or tight deadlines; I love my job. I find that after spending the whole day writing code & trying to solve problems, I have an extremely hard time getting it out of my mind. I'm constantly thinking about the current project/problem/task all the time. It's keeping me from relaxing, and in the long run it just builds stress. Personal projects help to some extent, but mostly just to distract me. I still have source code bouncing around my head 16 hours a day. I'm still relatively new to the workforce. Have you struggled with this, perhaps as a young developer? How did you overcome it? Can anyone offer general advice on winding down after a long programming session?

  Read the article

• python os.mkfifo() for Windows

  - by user302099

  Hello. Short version (if you can answer the short version it does the job for me, the rest is mainly for the benefit of other people with a similar task): In python in Windows, I want to create 2 file objects, attached to the same file (it doesn't have to be an actual file on the hard-drive), one for reading and one for writing, such that if the reading end tries to read it will never get EOF (it will just block until something is written). I think in linux os.mkfifo() would do the job, but in Windows it doesn't exist. What can be done? (I must use file-objects). Some extra details: I have a python module (not written by me) that plays a certain game through stdin and stdout (using raw_input() and print). I also have a Windows executable playing the same game, through stdin and stdout as well. I want to make them play one against the other, and log all their communication. Here's the code I can write (the get_fifo() function is not implemented, because that's what I don't know to do it Windows): class Pusher(Thread): def __init__(self, source, dest, p1, name): Thread.__init__(self) self.source = source self.dest = dest self.name = name self.p1 = p1 def run(self): while (self.p1.poll()==None) and\ (not self.source.closed) and (not self.source.closed): line = self.source.readline() logging.info('%s: %s' % (self.name, line[:-1])) self.dest.write(line) self.dest.flush() exe_to_pythonmodule_reader, exe_to_pythonmodule_writer =\ get_fifo() pythonmodule_to_exe_reader, pythonmodule_to_exe_writer =\ get_fifo() p1 = subprocess.Popen(exe, shell=False, stdin=subprocess.PIPE, stdout=subprocess.PIPE) old_stdin = sys.stdin old_stdout = sys.stdout sys.stdin = exe_to_pythonmodule_reader sys.stdout = pythonmodule_to_exe_writer push1 = Pusher(p1.stdout, exe_to_pythonmodule_writer, p1, '1') push2 = Pusher(pythonmodule_to_exe_reader, p1.stdin, p1, '2') push1.start() push2.start() ret = pythonmodule.play() sys.stdin = old_stdin sys.stdout = old_stdout

  Read the article

• Should I pass a SqlDataReader by reference or not when passing it out to multiple threads.

  - by deroby

  Hi all, being new to c# I've run into this 'conundrum' when passing around a SqlDataReader between different threads. Without going into too much detail, the idea is to have a main thread fetching data from the database (a large recordset) and then have a helper-task run through this record by record and doing some stuff based upon the contents of this. There is no feedback to the recordset, it simply wades through until no records are left. This works fine, but given the nature of the job at hand it should be possible to have this job spread over different threads (CPUs) to maximize throughput (the order of execution is of no significance). The question then becomes, when I pass this recordset in a SqlDataReader, do I have to use ref or not ? It kind of boils down to the question : if I pass the object around without specifying ref, won't it create new copies in memory and have records processed n times ? Or, don't I risk having the record-position being moved forward while not all fields have been fully read yet ? The latter seems more like a 'data racing' issue and probably is covered by the lock()ing mechanism (or not?). My initial take on the problem was that it doesn't really hurt passing the variable using ref, yet as a colleague put it : "you only need ref when you're doing something wrong" =) Additionally using ref restricts me from applying a Using() construction too which isn't very nice either. I thus create a "basic" project that tackles the same approach but without the ref notation. Tests so far show that it works flawlessly on a Core2Duo (2cpu) using any number of threads, yet I'm still a bit wary... What do you experts think about this ? Use ref or not ? You can find the test-project here as it seems I can't upload it to this question directly ?!? ps: it's just a test-project and I'm new to c#, so please be gentle on me when breaking down the code =P

  Read the article

• Hundreds of custom UserControls create thousands of USER Objects

  - by Andy Blackman

  I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

  Read the article

• MACRO compilation PROBLEM

  - by wildfly

  i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

  Read the article

• how to let the parser print help message rather than error and exit

  - by fluter

  Hi, I am using argparse to handle cmd args, I wanna if there is no args specified, then print the help message, but now the parse will output a error, and then exit. my code is: def main(): print "in abing/start/main" parser = argparse.ArgumentParser(prog="abing")#, usage="%(prog)s <command> [args] [--help]") parser.add_argument("-v", "--verbose", action="store_true", default=False, help="show verbose output") subparsers = parser.add_subparsers(title="commands") bkr_subparser = subparsers.add_parser("beaker", help="beaker inspection") bkr_subparser.set_defaults(command=beaker_command) bkr_subparser.add_argument("-m", "--max", action="store", default=3, type=int, help="max resubmit count") bkr_subparser.add_argument("-g", "--grain", action="store", default="J", choices=["J", "RS", "R", "T", "job", "recipeset", "recipe", "task"], type=str, help="resubmit selection granularity") bkr_subparser.add_argument("job_ids", nargs=1, action="store", help="list of job id to be monitored") et_subparser = subparsers.add_parser("errata", help="errata inspection") et_subparser.set_defaults(command=errata_command) et_subparser.add_argument("-w", "--workflows", action="store_true", help="generate workflows for the erratum") et_subparser.add_argument("-r", "--run", action="store_true", help="generate workflows, and run for the erratum") et_subparser.add_argument("-s", "--start-monitor", action="store_true", help="start monitor the errata system") et_subparser.add_argument("-d", "--daemon", action="store_true", help="run monitor into daemon mode") et_subparser.add_argument("erratum", action="store", nargs=1, metavar="ERRATUM", help="erratum id") if len(sys.argv) == 1: parser.print_help() return args = parser.parse_args() args.command(args) return how can I do that? thanks.

  Read the article

• how to filter files from the root "classes" and "test-classes" folders in Eclipse?

  - by Kidburla

  I am using ClearCase in my application which generates a whole load of ".copyarea.db" files (one in every folder). These cause conflicts when publishing to Tomcat as Eclipse will bundle the "classes" and "test-classes" folders into one JAR (not sure why it does this - as there is no need to have test classes available on the application server). Any folders with the same names will have a separate .copyarea.db in the classes and test-classes branches. I managed to get around this problem in general by adding ".copyarea.db" to the Filtered resources on the Java->Compiler->Building->Output Folder preference page. This stops the file appearing in source output (package/class folders), the vast majority of cases. However there remains the problem of the root folder, i.e. "target/classes/.copyarea.db" and "target/test-classes/.copyarea.db". These files are not filtered as they are not part of the compile task. Just deleting the files manually doesn't help either, as Eclipse expects to find them and doesn't. How can I exclude these ".copyarea.db" files from the root "classes" and "test-classes" folders?

  Read the article

• Efficient way to maintain a sorted list of access counts in Python

  - by David

  Let's say I have a list of objects. (All together now: "I have a list of objects.") In the web application I'm writing, each time a request comes in, I pick out up to one of these objects according to unspecified criteria and use it to handle the request. Basically like this: def handle_request(req): for h in handlers: if h.handles(req): return h return None Assuming the order of the objects in the list is unimportant, I can cut down on unnecessary iterations by keeping the list sorted such that the most frequently used (or perhaps most recently used) objects are at the front. I know this isn't something to be concerned about - it'll make only a miniscule, undetectable difference in the app's execution time - but debugging the rest of the code is driving me crazy and I need a distraction :) so I'm asking out of curiosity: what is the most efficient way to maintain the list in sorted order, descending, by the number of times each handler is chosen? The obvious solution is to make handlers a list of (count, handler) pairs, and each time a handler is chosen, increment the count and resort the list. def handle_request(req): for h in handlers[:]: if h[1].handles(req): h[0] += 1 handlers.sort(reverse=True) return h[1] return None But since there's only ever going to be at most one element out of order, and I know which one it is, it seems like some sort of optimization should be possible. Is there something in the standard library, perhaps, that is especially well-suited to this task? Or some other data structure? (Even if it's not implemented in Python) Or should/could I be doing something completely different?

  Read the article

• Create a real time web application using .net framework and azure - very confused

  - by test

  Let us say I would like a simple (yet complex) web application where there is continuous READING AND WRITING to the sql azure database. Let us say I am tracking a location, and I would like it to be updated very frequently (lets take the worst case: 1 second). From the little knowledge I have, I think that this involves the use of the database to continuously write the location to the database, and continuously read from the database to update another person through a website. Do you please have any suggestion which technologies can I use? Is there a simple way? I heard about node.js, signalR. I have no idea how to use them, if they are really what I need. the last tutorial I checked out simply uses a while(true) loop..but I don't think that that's something good to keep a thread continuously busy... Do I have to create some background task? Do I have to create some web service? This is a school project and I wish not to go for the most difficult option, but if there is some sort of solution, challenge accepted :) Can you please help me? Since I have asked many questions here and yet I have no solution in mind

  Read the article

• Truncating a string while storing it in an array in c

  - by Nick

  I am trying to create an array of 20 character strings with a maximum of 17 characters that are obtained from a file named "words.dat". After that the program should truncate the string only showing the first 17 characters and completely ignore the rest of that string. However My question is: I am not quite sure how to accomplish this, can anyone give me some insight on how to accomplish this task? Here is my current code as is: #include <stdio.h> #include <stdlib.h> #define WORDS 20 #define LENGTH 18 char function1(char[WORDS][LENGTH]); int main( void ) { char word_array [WORDS] [LENGTH]; function1(word_array); return ( 0 ) ; } char function1(char word_array[WORDS][LENGTH]) { FILE *wordsfile = fopen("words.dat", "r"); int i = 0; if (wordsfile == NULL) printf("\nwords.dat was not properly opened.\n"); else { for (i = 0; i < WORDS; i++) { fscanf(wordsfile, "%17s", word_array[i]); printf ("%s \n", word_array[i]); } fclose(wordsfile); } return (word_array[WORDS][LENGTH]); } words.dat file: Ninja DragonsFury failninja dragonsrage leagueoflegendssurfgthyjnu white black red green yellow green leagueoflegendssughjkuj dragonsfury Sword sodas tiger snakes Swords Snakes sage Sample output: blahblah@fang:~>a.out Ninja DragonsFury failninja dragonsrage leagueoflegendssu rfgthyjnu white black red green yellow green leagueoflegendssu ghjkuj dragonsfury Sword sodas tiger snakes Swords blahblah@fang:~> What will be accomplished afterwards with this program is: After function1 works properly I will then create a second function name "function2" that will look throughout the array for matching pairs of words that match "EXACTLY" including case . After I will create a third function that displays the 20 character strings from the words.dat file that I previously created and the matching words.

  Read the article

• How to handle Win+Shift+LEft/Right on Win7 with custom WM_GETMINMAXINFO logic?

  - by Steven Robbins

  I have a custom windows implementation in a WPF app that hooks WM_GETMINMAXINFO as follows: private void MaximiseWithTaskbar(System.IntPtr hwnd, System.IntPtr lParam) { MINMAXINFO mmi = (MINMAXINFO)Marshal.PtrToStructure(lParam, typeof(MINMAXINFO)); System.IntPtr monitor = MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST); if (monitor != System.IntPtr.Zero) { MONITORINFO monitorInfo = new MONITORINFO(); GetMonitorInfo(monitor, monitorInfo); RECT rcWorkArea = monitorInfo.rcWork; RECT rcMonitorArea = monitorInfo.rcMonitor; mmi.ptMaxPosition.x = Math.Abs(rcWorkArea.left - rcMonitorArea.left); mmi.ptMaxPosition.y = Math.Abs(rcWorkArea.top - rcMonitorArea.top); mmi.ptMaxSize.x = Math.Abs(rcWorkArea.right - rcWorkArea.left); mmi.ptMaxSize.y = Math.Abs(rcWorkArea.bottom - rcWorkArea.top); mmi.ptMinTrackSize.x = Convert.ToInt16(this.MinWidth * (desktopDpiX / 96)); mmi.ptMinTrackSize.y = Convert.ToInt16(this.MinHeight * (desktopDpiY / 96)); } Marshal.StructureToPtr(mmi, lParam, true); } It all works a treat and it allows me to have a borderless window maximized without having it sit on to of the task bar, which is great, but it really doesn't like being moved between monitors with the new Win7 keyboard shortcuts. Whenever the app is moved with Win+Shift+Left/Right the WM_GETMINMAXINFO message is received, as I'd expect, but MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST) returns the monitor the application has just been moved FROM, rather than the monitor it is moving TO, so if the monitors are of differing resolutions the window end up the wrong size. I'm not sure if there's something else I can call, other then MonitorFromWindow, or whether there's a "moving monitors" message I can hook prior to WM_GETMINMAXINFO. I'm assuming there is a way to do it because "normal" windows work just fine.

  Read the article

• Why might my PHP log file not entirely be text?

  - by Fletcher Moore

  I'm trying to debug a plugin-bloated Wordpress installation; so I've added a very simple homebrew logger that records all the callbacks, which are basically listed in a single, ultimately 250+ row multidimensional array in Wordpress (I can't use print_r() because I need to catch them right before they are called). My logger line is $logger->log("\t" . $callback . "\n"); The logger produces a dandy text file in normal situations, but at two points during this particular task it is adding something which causes my log file to no longer be encoded properly. Gedit (I'm on Ubuntu) won't open the file, claiming to not understand the encoding. In vim, the culprit corrupt callback (which I could not find in the debugger, looking at the array) is about in the middle and printed as ^@lambda_546 and at the end of file there's this cute guy ^M. The ^M and ^@ are blue in my vim, which has no color theme set for .txt files. I don't know what it means. I tried adding an is_string($callback) condition, but I get the same results. Any ideas?

  Read the article

• What is the best way to find a processed memory allocations in terms of C# objects

  - by Shantaram

  I have written various C# console based applications, some of them long running some not, which can over time have a large memory foot print. When looking at the windows perofrmance monitor via the task manager, the same question keeps cropping up in my mind; how do I get a break down of the number objects by type that are contributing to this footprint; and which of those are f-reachable and those which aren't and hence can be collected. On numerous occasions I've performed a code inspection to ensure that I am not unnecessarily holding on objects longer than required and disposing of objects with the using construct. I have also recently looked at employing the CG.Collect method when I have released a large number of objects (for example held in a collection which has just been cleared). However, I am not so sure that this made that much difference, so I threw that code away. I am guessing that there are tools in sysinternals suite than can help to resolve these memory type quiestions but I am not sure which and how to use them. The alternative would be to pay for a third party profiling tool such as JetBrains dotTrace; but I need to make sure that I've explored the free options first before going cap in hand to my manager.

  Read the article

• Can one connection get details of another? Or, how can I get the most detailed pending transaction

  - by bob-the-destroyer

  Is there a Mysql statement which provides full details of any other open connection or user? For this particular case, on myisam tables specifically. Looking at Mysql's SHOW TABLE STATUS documentation, it's missing some very important information for my purpose. For example: remote odbc connection one is inserting several thousand records, which due to a slow connection speed can take up to an hour. Tcp connection two, using PHP on the server's localhost, is running select queries with aggregate functions on that data. Before allowing connection two to run those queries, I'd like connection two to first check to make sure there's no pending inserts on any other connection on those specific tables so it can instead wait until all data is available. If the table is currently being written to, I'd like to spit back to the user of connection two an approximation of how much longer to wait based on the number of pending inserts. Ideally by table, I'd like to get back using a query the timestamp when connection one began the write, total inserts left to be done, and total inserts already completed. Instead of insert counts, even knowing number of bytes written and left to write would work just fine here. Obviously since connection two is a tcp connection via a PHP script, all I can really use in that script is some sort of query. I suppose if I have to, since it is on localhost, I can exec() it if the only way is by a mysql command line option that outputs this info, but I'd rather not. I suppose I could simply update a custom-made transaction log before and after this massive insert task which the PHP script can check, but hopefully there's already a built-in Mysql feature I can take advantage of.

  Read the article

• Best way to migrate export/import from SQL Server to oracle

  - by matao

  Hi guys! I'm faced with needing access for reporting to some data that lives in Oracle and other data that lives in a SQL Server 2000 database. For various reasons these live on different sides of a firewall. Now we're looking at doing an export/import from sql server to oracle and I'd like some advice on the best way to go about it... The procedure will need to be fully automated and run nightly, so that excludes using the SQL developer tools. I also can't make a live link between databases from our (oracle) side as the firewall is in the way. The data needs to be transformed in the process from a star schema to a de-normalised table ready for reporting. What I'm thinking about is writing a monster query for SQL Server (which I mostly have already) that will denormalise and read out the data from SQL Server into a flat file using the sql server equivalent of sqlplus as a scheduled task, dump into a Well Known Location, then on the oracle side have a cron job that copies down the file and loads it with sql loader and rebuilds indexes etc. This is all doable, but very manual. Is there one or a combination of FOSS or standard oracle/SQL Server tools that could automate this for me? the Irreducible complexity is the query on one side and building indexes on the other, but I would love to not have to write the CSV dumping detail or the SQL loader script, just say dump this view out to CSV on one side, and on the other truncate and insert into this table from CSV and not worry about mapping column names and all other arcane sqlldr voodoo... best practices? thoughts? comments? edit: I have about 50+ columns all of varying types and lengths in my dataset, which is why I'd prefer to not have to write out how to generate and map each single column...

  Read the article

• Supersede users need to press enter after inputting a string in python 3.0

  - by Cimex

  I've been attempting to create a simple Rock, Paper, Scissors game in python 3.0 -- very standard task for anybody learning programming. But, as I finish up to a point, I think,"wow, that'd be awesome", or,"it'd be cool to do this!" So anyways, I keep building upon the project... I've developed a menu, a single player game vs the computer, and just finished the multiplayer game. But, I've realized, that the multiplayer game isn't very effective. It just dosen't work like the analog version of the game. Currently, it'll ask for player1's input, then player2's input, compare them, and spit out the result and the current score. What I'd rather have happen is that the program asks for both players input at the same time and both players input their choice at the same time. I understand that I can easily do that by just grabbing the index of the first and second answer and compare the 2 inputs -- easy. But what I'd rather have happen is that after both players enter their one character answers at the same time (r for rock, p for paper, or s for scissors), then the program will auto enter the input. Not needing someone to press enter. The input would be dictated by the fact that 2 characters have been entered. I guess my question is: Is there any way to dictate what can be used as an input for 'enter'?

  Read the article

• Cocoa - calling a VIEW method from the CONTROLLER

  - by eemerge

  Hello everyone, Got a little problem i asked about it before but maybe i didnt ask properly. I have a cocoa application, which amongst other things, must do the following task: - load some images from the disk, store them in an array and display them in a custom view. In the Interface Builder i have a CustomView and an OBJECT that points to TexturesController.h The custom view is a custom class, TextureBrowser. Below is the code for the controller and view: TexturesController #import <Cocoa/Cocoa.h> @class TextureBrowser; @interface TexturesController : NSObject { IBOutlet NSTextField *logWindow; IBOutlet TextureBrowser *textureView; NSMutableArray *textureList; } @property textureView; -(IBAction)loadTextures:(id)sender; -(IBAction)showTexturesInfo:(id)sender; @end TextureBrowser @interface TextureBrowser : NSView { NSMutableArray *textures; } @property NSMutableArray *textures; -(void)loadTextureList:(NSMutableArray *)source; @end These are just the headers. Now , what i need to do is: when loadTextures from the TexturesController is called, after i load the images i want to send this data to the view (TextureBrowser), for example, store it in the NSMutableArray *textures. I tried using the -(void)loadTextureList:(NSMutableArray*)source method from the view, but in the TextureController.m i get a warning : No -loadTextureList method found This is how i call the method : [textureView loadTextureList: textureList]; And even if i run it with the warning left there, the array in the view class doesnt get initialised. Maybe im missing something...maybe someone can give a simple example of what i need to do and how to do it (code). Thanks in advance.

  Read the article

• What's the correct place to share application logic in CakePHP?

  - by Pichan

  I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

  Read the article

• How to exclude tags folder from triggering build in Teamcity?

  - by Jaya mareedu

  Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

  Read the article

• Cross-platform general purpose C++ RPC library

  - by iUm

  Here's the task: Imagine, we have an applications and a plug-in for it (dynamic library). Interface between the application and the plug-in is completely defined. Now I need to run the application and the plug-in on different computers. I wrote a stub for the plug-in on a computer where the real applications is running. And the application loads it and calls its functions like if it were a native plug-in. On the other computer there's a stub instead of the real application, which loads the native plug-in. Now I need to organize RPCs between my stubs over the network, regardless the very transport. Usually, it's not difficult. But there're some restrictions: Application-plug-in interaction can be reenterable (e.g. application calls f1() from plug-in, in f1() plug-in calls g1() from application, in g1() application calls f2() from plug-in and so on...) Any such reenteration should be executed exactly by the same thread, which started the sequence Where can I find a cross-platform C++ RPC library with such features?

  Read the article

• Findbugs and comparing

  - by Rob Goodwin

  I recently started using the findbugs static analysis tool in a java build I was doing. The first report came back with loads of High Priority warnings. Being the obsessive type of person, I was ready to go knock them all out. However, I must be missing something. I get most of the warnings when comparing things. Such as the following code: public void setSpacesPerLevel(int value) { if( value >= 0) { ... produces a high priority warning at the if statement that reads. File: Indenter.java, Line: 60, Type: BIT_AND_ZZ, Priority: High, Category: CORRECTNESS Check to see if ((...) & 0) == 0 in sample.Indenter.setSpacesPerLevel(int) I am comparing an int to an int, seems like a common thing. I get quite a few of that type of error with similar simple comparisons. I have alot of other high priority warnings on what appears to be simple code blocks. Am I missing something here? I realize that static analysis can produce false positives, but the errors I am seeing seem too trivial of a case to be a false positive. This one has me scratching my head as well. for(int spaces = 0;spaces < spacesPerLevel;spaces++){... Which gives the following findbugs warning: File: Indenter.java, Line: 160, Type: IL_INFINITE_LOOP, Priority: High, Category: CORRECTNESS There is an apparent infinite loop in sample.Indenter.indent() This loop doesn't seem to have a way to terminate (other than by perhaps throwing an exception). Any ideas? So basically I have a handful of files and 50-60 high priority warnings similar to the ones above. I am using findbugs 1.3.9 and calling it from the findbugs ant task

  Read the article

• is it possible to write a program which prints its own source code utilizing a "sequence-generating-

  - by guest

  is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

  Read the article

• SQL problem - select accross multiple tables (user groups)

  - by morpheous

  I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

  Read the article

• What's the most efficient way to load data from a file to a collection on-demand?

  - by Dan

  I'm working on a java project that will allows users to parse multiple files with potentially thousands of lines. The information parsed will be stored in different objects, which then will be added to a collection. Since the GUI won't require to load ALL these objects at once and keep them in memory, I'm looking for an efficient way to load/unload data from files, so that data is only loaded into the collection when a user requests it. I'm just evaluation options right now. I've also thought of the case where, after loading a subset of the data into the collection, and presenting it on the GUI, the best way to reload the previously observed data. Re-run the parser/Populate collection/Populate GUI? or probably find a way to keep the collection into memory, or serialize/deserialize the collection itself? I know that loading/unloading subsets of data can get tricky if some sort of data filtering is performed. Let's say that I filter on ID, so my new subset will contain data from two previous analyzed subsets. This would be no problem is I keep a master copy of the whole data in memory. I've read that google-collections are good and efficient when handling big amounts of data, and offer methods that simplify lots of things so this might offer an alternative to allow me to keep the collection in memory. This is just general talking. The question on what collection to use is a separate and complex thing. Do you know what's the general recommendation on this type of task? I'd like to hear what you've done with similar scenarios. I can provide more specifics if needed.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

< Previous Page | 281 282 283 284 285 286 287 288 289 290 291 292  | Next Page >