Search Results

Search found 15811 results on 633 pages for 'path manipulation'.

Page 296/633 | < Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >

  • Django: How can I identify the calling view from a template?

    - by bryan
    Short version: Is there a simple, built-in way to identify the calling view in a Django template, without passing extra context variables? Long (original) version: One of my Django apps has several different views, each with its own named URL pattern, that all render the same template. There's a very small amount of template code that needs to change depending on the called view, too small to be worth the overhead of setting up separate templates for each view, so ideally I need to find a way to identify the calling view in the template. I've tried setting up the views to pass in extra context variables (e.g. "view_name") to identify the calling view, and I've also tried using {% ifequal request.path "/some/path/" %} comparisons, but neither of these solutions seems particularly elegant. Is there a better way to identify the calling view from the template? Is there a way to access to the view's name, or the name of the URL pattern? Update 1: Regarding the comment that this is simply a case of me misunderstanding MVC, I understand MVC, but Django's not really an MVC framework. I believe the way my app is set up is consistent with Django's take on MVC: the views describe which data is presented, and the templates describe how the data is presented. It just happens that I have a number of views that prepare different data, but that all use the same template because the data is presented the same way for all the views. I'm just looking for a simple way to identify the calling view from the template, if this exists. Update 2: Thanks for all the answers. I think the question is being overthought -- as mentioned in my original question, I've already considered and tried all of the suggested solutions -- so I've distilled it down to a "short version" now at the top of the question. And right now it seems that if someone were to simply post "No", it'd be the most correct answer :) Update 3: Carl Meyer posted "No" :) Thanks again, everyone.

    Read the article

  • I have a WPF/Silverlight ListView whose height is unpredictable and too high. How do I control it be

    - by Rob Perkins
    I have a ListView element with a DataTemplate for each ListViewItem defined as follows. When run, the ListView's height is not collapsed onto the items in the view, which is undesirable behavior: <DataTemplate x:Key="LicenseItemTemplate"> <Grid> <Grid.RowDefinitions> <RowDefinition Height="Auto" /> <RowDefinition Height="Auto" /> </Grid.RowDefinitions> <TextBlock Grid.Row="0" Text="{Binding company}"></TextBlock> <Grid Grid.Row="1" Style="{StaticResource HiddenWhenNotSelectedStyle}"> <Grid.RowDefinitions> <RowDefinition /> </Grid.RowDefinitions> <Button Grid.Row="0">ClickIt</Button> </Grid> </Grid> </DataTemplate> The second row of the outer grid has a style applied which looks like this. The purpose of the style is to : <Style TargetType="{x:Type Grid}" x:Key="HiddenWhenNotSelectedStyle" > <Style.Triggers> <DataTrigger Binding="{Binding Path=IsSelected, RelativeSource={ RelativeSource Mode=FindAncestor, AncestorType={x:Type ListViewItem} } }" Value="False"> <Setter Property="Grid.Visibility" Value="Collapsed" /> </DataTrigger> <DataTrigger Binding="{Binding Path=IsSelected, RelativeSource={ RelativeSource Mode=FindAncestor, AncestorType={x:Type ListViewItem} } }" Value="True"> <Setter Property="Grid.Visibility" Value="Visible" /> </DataTrigger> </Style.Triggers> </Style> The ListView renders like this: The desired appearance is this, when none of the elements are selected: ...with, of course, the ListView's height adjusting to accommodate the additional content when the second grid is made visible by selection. What can I do to get the desired behavior?

    Read the article

  • wsgi django not working

    - by MaKo
    im installing django, the test for wsgi is ok, but when i point my default file to the django test, it doesnt work, this is the test that works fine: default: /etc/apache2/sites-available/default <VirtualHost *:80> ServerName www.example.com ServerAlias example.com ServerAdmin [email protected] DocumentRoot /var/www <Directory /var/www/documents> Order allow,deny Allow from all </Directory> WSGIScriptAlias / /home/ubuntu/djangoProj/micopiloto/application.wsgi <Directory /home/ubuntu/djangoProj/mysitio/wsgi_handler.py> Order allow,deny Allow from all </Directory> </VirtualHost> application.wsgi:: ~/djangoProj/micopiloto import os import sys sys.path.append('/srv/www/cucus/application') os.environ['PYTHON_EGG_CACHE'] = '/srv/www/cucus/.python-egg' def application(environ, start_response): status = '200 OK' output = 'Hello World!MK SS9 tkt kkk' response_headers = [('Content-type', 'text/plain'), ('Content-Length', str(len(output)))] start_response(status, response_headers) return [output] but if I change the default to point to application_sa.wsgi the django test, it doesnt work :( application_sa.wsgi import os, sys sys.path.append('/home/ubuntu/djangoProj/micopiloto') os.environ['DJANGO_SETTINGS_MODULE'] = 'micopiloto.settings' import django.core.handlers.wsgi application = django.core.handlers.wsgi.WSGIHandler() I restart the apache server every time i change the wsgi to test, so what im i missing? thanks a lot!

    Read the article

  • xcode project-/target-settings-syntax for linker flag force_load on iPhone

    - by Kaiserludi
    Hi all. I am confronted with the double bind, that on the one hand for one of the 3rd party static libraries, my iPhone application uses, the linker flag -all_load has to be set in the application project- or target settings, otherwise the app crashes at runtime not finding some symbols, called internally from the lib, on the other hand for another 3rd party static lib -all_load must not be set on application level, or the app won't build thanks to a "duplicate symbols"-linker error. To solve this issue I now want to use force_load instant of load_all, as it due to documentation it does the same like all_load, but only for the passed path or lib-file, instead of all libs. The problem with force_load is, I do not have a clue, how to pass a path or file as parameter with it, when passing it via xcode project- or target-settings. All syntax-possibilities coming to my mind either lead into xcode thinking its another linker flag instead of a parameter to the previous one, or the linker is throwing syntax related errors or the flag simply does nothing at all in comparison to not being set. I also opened the .pbxproj-file in a text-editor to edit it to the correct command line syntax manually, but when reloading the project with xcode, it auto changes the syntax into interpreting the parameter to force_load as a separate flag. Anyone having an idea on this issue? Thx, Kaiserludi.

    Read the article

  • CSS style refresh in IE after dynamic removal of style link

    - by rybz
    Hi! I've got a problem with the dynamic style manipulation in IE7 (IE8 is fine). Using javascript I need to add and remove the < link / node with the definition of css file. Adding and removing the node as a child of < head / works fine under Firefox. Unfortunately, after removing it in the IE, although The tag is removed properly, the page style does not refresh. In the example below a simple css (makes background green) is appended and removed. After the removal in FF the background turns default, but in IE stays green. index.html <html> <head> </head> <script language="javascript" type="text/javascript"> var node; function append(){ var headID = document.getElementsByTagName("head")[0]; node = document.createElement('link'); node.type = 'text/css'; node.rel = 'stylesheet'; node.href = "s.css"; node.media = 'screen'; headID.appendChild(node); } function remove(){ var headID = document.getElementsByTagName("head")[0]; headID.removeChild(node); } </script> <body> <div onClick="append();"> add </div> <div onClick="remove();"> remove </div> </body> </html> And the style sheet: s.css body { background-color:#00CC33 } Here is the live example: http://rlab.pl/dynamic-style/ Is there a way to get it working?

    Read the article

  • Learning libraries without books or tutorials

    - by Kawili-wili
    While many ask questions about where to find good books or tutorials, I'd like to take the opposite tack. I consider myself to be an entry-level programmer ready to move up to mid-level. I have written code in c, c++, c#, perl, python, clojure, vb, and java, so I'm not completely clueless. Where I see a problem in moving to the next level is learning to make better use of the literally hundreds upon hundreds of libraries available out there. I seem paralyzed unless there is a specific example in a book or tutorial to hand-hold me, yet I often read in various forums where another programmer attempts to assist with a question. He/she will look through the docs or scan the available classes/methods in their favorite IDE and seem to grok what's going on in a relatively short period of time, even if they had no previous experience with that specific library or function. I yearn to break the umbilical chord of constantly spending hour upon hour searching and reading, searching and reading, searching and reading. Many times there is no book or tutorial, or if there is, the discussion glosses over my specific needs or the examples shown are too far off the path for the usage I had in mind or the information is outdated and makes use of deprecated components or the library itself has fallen out of mainstream, yet is still perfectly usable (but no docs, books, or tutorials to hand-hold). My question is: In the absence of books or tutorials, what is the best way to grok new or unfamiliar libraries? I yearn to slicken the grok path so I can get down to the business of doing what I love most -- coding.

    Read the article

  • Master Detail same View binding controls

    - by pipelinecache
    Hi everyone, say I have a List View with ItemControls. And a Details part that shows the selected Item from List View. Both are in the same xaml page. I tried everything to accomplish it, but what do I miss? <!-- // List --> <ItemsControl ItemsSource="{Binding Path=Model, ElementName=SomeListViewControl, Mode=Default}" SnapsToDevicePixels="True" Focusable="False" IsTabStop="False"> <ItemsControl.ItemTemplate> <DataTemplate> <SomeListView:SomeListItemControl x:Name=listItem/> </DataTemplate> </ItemsControl.ItemTemplate> </ItemsControl> <!-- // Details --> <Label Content="Begindatum" FontSize="16" VerticalAlignment="Center" Grid.Row="1" Margin="2,0,0,0"/> <TextBox x:Name="Begindatum" Grid.Column="1" Grid.Row="1" Text="{Binding Path=BeginDate, ElementName=listItem,Converter={StaticResource DateTimeConverter}, ConverterParameter=dd-MM-yyyy}" IsEnabled="False" Style="{DynamicResource TextBoxStyle}" MaxLength="30"/> public event EventHandler<DataEventArgs<SomeEntity>> OnOpenSomething; public ObservableCollection<SomeEntity> Model { get { return (ObservableCollection<SomeEntity>)GetValue(ModelProperty); } set { Model.CollectionChanged -= new NotifyCollectionChangedEventHandler(Model_CollectionChanged); SetValue(ModelProperty, value); Model.CollectionChanged += new NotifyCollectionChangedEventHandler(Model_CollectionChanged); UpdateVisualState(); } } public static readonly DependencyProperty ModelProperty = DependencyProperty.Register("Model", typeof(ObservableCollection<SomeEntity>), typeof(SomeListView), new UIPropertyMetadata(new ObservableCollection<SomeEntity>(), new PropertyChangedCallback(ChangedModel))); private static void ChangedModel(DependencyObject source, DependencyPropertyChangedEventArgs e) { SomeListView someListView = source as SomeListView; if (someListView.Model == null) { return; } CollectionView cv = (CollectionView)CollectionViewSource.GetDefaultView(someListView.Model); } private void Model_CollectionChanged(object sender, NotifyCollectionChangedEventArgs e) { if (Model == null) { return; } }

    Read the article

  • Program repeats each time a character is scanned .. How to stop it ?

    - by ZaZu
    Hello there, I have a program that has this code : #include<stdio.h> main(){ int input; char g; do{ printf("Choose a numeric value"); printf(">"); scanf("\n%c",&input); g=input-'0'; }while((g>=-16 && g<=-1)||(g>=10 && g<=42)||(g>=43 && g<=79)); } It basically uses ASCII manipulation to allow the program to accept numbers only .. '0' is given the value 48 by default...the ASCII value - 48 gives a ranges of numbers above (in the while statement) Anyway, whenever a user inputs numbers AND alphabets, such as : abr39293afakvmienb23 The program ignores : a,b,r .. But takes '3' as the first input. For a b and r, the code under the do loop repeats. So for the above example, I get : Choose a numeric value >Choose a numeric value> Choose a numeric value >3 Is there a way I can stop this ??? I tried using \n%c to scan the character and account for whitespace, but that didnt work :( Please help thank you very much !

    Read the article

  • How to use dirent.h correctly.

    - by Nick
    Hello, I am new to C++ and I am experimenting with the dirent.h header to manipulate directory entries. The following little app compiles but pukes after you supple a directory name. Can someone give me a hint? The int quit is there to provide a while loop. I removed the loop in an attempt to isolate my problem. thanks! #include <iostream> #include <dirent.h> using namespace std; int main() { char *dirname = 0; DIR *pd = 0; struct dirent *pdirent = 0; int quit = 1; cout<< "Enter a directory path to open (leave blank to quit):\n"; cin >> dirname; if(dirname == NULL) { quit = 0; } pd = opendir(dirname); if(pd == NULL) { cout << "ERROR: Please provide a valid directory path.\n"; } return 0; }

    Read the article

  • PHP OOP singleton doesn't return object

    - by Misiur
    Weird trouble. I've used singleton multiple times but this particular case just doesn't want to work. Dump says that instance is null. define('ROOT', "/"); define('INC', 'includes/'); define('CLS', 'classes/'); require_once(CLS.'Core/Core.class.php'); $core = Core::getInstance(); var_dump($core->instance); $core->settings(INC.'config.php'); $core->go(); Core class class Core { static $instance; public $db; public $created = false; private function __construct() { $this->created = true; } static function getInstance() { if(!self::$instance) { self::$instance = new Core(); } else { return self::$instance; } } public function settings($path = null) { ... } public function go() { ... } } Error code Fatal error: Call to a member function settings() on a non-object in path It's possibly some stupid typo, but I don't have any errors in my editor. Thanks for the fast responses as always.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Calling Python app/script from C#

    - by Maxim Z.
    I'm building an ASP.NET MVC (C#) site where I want to implement STV (Single Transferable Vote) voting. I've used OpenSTV for voting scenarios before, with great success, but I've never used it programmatically. The OpenSTV Google Code project offers a Python script that allows usage of OpenSTV from other applications: import sys sys.path.append("path to openstv package") from openstv.ballots import Ballots from openstv.ReportPlugins.TextReport import TextReport from openstv.plugins import getMethodPlugins (ballotFname, method, reportFname) = sys.argv[1:] methods = getMethodPlugins("byName") f = open(reportFname, "w") try: b = Ballots() b.loadUnknown(ballotFname) except Exception, msg: print >> f, ("Unable to read ballots from %s" % ballotFname) print >> f, msg sys.exit(-1) try: e = methods[method](b) e.runElection() except Exception, msg: print >> f, ("Unable to count votes using %s" % method) print >> f, msg sys.exit(-1) try: r = TextReport(e, outputFile=f) r.generateReport(); except Exception, msg: print >> f, "Unable to write report" print >> f, msg sys.exit(-1) f.close() Is there a way for me to make such a Python call from my C# ASP.NET MVC site? If so, how? Thanks in advance!

    Read the article

  • PHP: Join two separate mysql queries into the same json data object

    - by Dan
    I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

    Read the article

  • JumpLists Not Working in C# App

    - by Josh M.
    Hi, I'm trying to use the Recent and Frequent JumpLists in my C# app. I'm using the Windows API Codepack v1.1 (http://code.msdn.microsoft.com/WindowsAPICodePack). I initialize the JumpLists every time the app starts and I AddRecent() to the JumpList every time I open a project in the app. Something is missing becuase the JumpLists are simply not showing up when you right click the app's icon in the Taskbar. I got one file to show up once but that's it! Initialization: private void InitializeJumpLists() { if (TaskbarManager.IsPlatformSupported) { JumpList recentJumpList = null; JumpList frequentJumpList = null; TaskbarManager.Instance.ApplicationId = Application.ProductName; recentJumpList = JumpList.CreateJumpList(); recentJumpList.KnownCategoryToDisplay = JumpListKnownCategoryType.Recent; recentJumpList.Refresh(); frequentJumpList = JumpList.CreateJumpList(); frequentJumpList.KnownCategoryToDisplay = JumpListKnownCategoryType.Frequent; frequentJumpList.Refresh(); } } Opening the Project: private void OpenProject(string path, bool isFromRecentFilesList) { DialogResult result = ConfirmProjectClosing(); if (result == DialogResult.Yes) Save(); else if (result == DialogResult.Cancel) return; using (new Wait()) { //Code here opens the project, etc. //Try to add the file to the Jump List. if (TaskbarManager.IsPlatformSupported) JumpList.AddToRecent(path); //Code here finished up. } } What am I missing?

    Read the article

  • Algorithm for assigning a unique series of bits for each user?

    - by Mark
    The problem seems simple at first: just assign an id and represent that in binary. The issue arises because the user is capable of changing as many 0 bits to a 1 bit. To clarify, the hash could go from 0011 to 0111 or 1111 but never 1010. Each bit has an equal chance of being changed and is independent of other changes. What would you have to store in order to go from hash - user assuming a low percentage of bit tampering by the user? I also assume failure in some cases so the correct solution should have an acceptable error rate. I would an estimate the maximum number of bits tampered with would be about 30% of the total set. I guess the acceptable error rate would depend on the number of hashes needed and the number of bits being set per hash. I'm worried with enough manipulation the id can not be reconstructed from the hash. The question I am asking I guess is what safe guards or unique positioning systems can I use to ensure this happens.

    Read the article

  • Is it a good idea to use an integer column for storing US ZIP codes in a database?

    - by Yadyn
    From first glance, it would appear I have two basic choices for storing ZIP codes in a database table: Text (probably most common), i.e. char(5) or varchar(9) to support +4 extension Numeric, i.e. 32-bit integer Both would satisfy the requirements of the data, if we assume that there are no international concerns. In the past we've generally just gone the text route, but I was wondering if anyone does the opposite? Just from brief comparison it looks like the integer method has two clear advantages: It is, by means of its nature, automatically limited to numerics only (whereas without validation the text style could store letters and such which are not, to my knowledge, ever valid in a ZIP code). This doesn't mean we could/would/should forgo validating user input as normal, though! It takes less space, being 4 bytes (which should be plenty even for 9-digit ZIP codes) instead of 5 or 9 bytes. Also, it seems like it wouldn't hurt display output much. It is trivial to slap a ToString() on a numeric value, use simple string manipulation to insert a hyphen or space or whatever for the +4 extension, and use string formatting to restore leading zeroes. Is there anything that would discourage using int as a datatype for US-only ZIP codes?

    Read the article

  • Render only a portion of a PDF on iPhone/iPad

    - by Infinity
    Hello guys! I am rendering my pdf in an UIView's drawRect method. Here's my code: - (void)drawRect:(CGRect)rect2 { NSString *filename = @"lol.pdf"; CFStringRef path = CFStringCreateWithCString (NULL, [filename UTF8String], kCFStringEncodingUTF8); CFURLRef url = CFURLCreateWithFileSystemPath (NULL, path, kCFURLPOSIXPathStyle, 0); CGPDFDocumentRef pdf = CGPDFDocumentCreateWithURL(url); CGPDFPageRef page = CGPDFDocumentGetPage (pdf, 1); CGAffineTransform m; CGContextRef context = UIGraphicsGetCurrentContext(); CGRect aRect = CGRectMake(0, 0, 768, 1024); CGContextTranslateCTM(context, 0.0, aRect.size.height); CGContextScaleCTM(context, 1.0, -1.0); m = CGPDFPageGetDrawingTransform (page, kCGPDFMediaBox, aRect, 0, YES); CGContextSaveGState (context); CGContextConcatCTM (context, m); CGContextClipToRect (context,CGPDFPageGetBoxRect (page, kCGPDFCropBox)); CGContextDrawPDFPage (context, page); CGContextRestoreGState (context); } It renders the whole pdf. How can I render only a part from it? Can you help me with it?

    Read the article

  • Bug with DataBinding in WPF Host in Winforms?

    - by Tigraine
    Hi Guys, I've spent far too much time with this and can't find the mistake. Maybe I'm missing something very obvious or I may have just found a bug in the WPF Element Host for Winforms. I am binding a ListView to a ObeservableList that lives on my ProductListViewModel. I'm trying to implement searching for the ListView with the general Idea to just change the ObservableList with a new list that is filtered. Anyway, the ListView Binding code looks like this: <ListView ItemsSource="{Binding Path=Products}" SelectedItem="{Binding Path=SelectedItem}" SelectionMode="Single"> <ListView.ItemContainerStyle> <Style TargetType="{x:Type ListViewItem}"> <Setter Property="IsSelected" Value="{Binding IsSelected, Mode=TwoWay}"></Setter> </Style> </ListView.ItemContainerStyle> <ListView.ItemTemplate> <DataTemplate> <TextBlock Text="{Binding Name}"></TextBlock> </DataTemplate> </ListView.ItemTemplate> </ListView> And the ViewModel code is as vanilla as it can get: private ObservableCollection<ProductViewModel> products; public ObservableCollection<ProductViewModel> Products { get { return products; } private set { if (products != value) { products = value; OnPropertyChanged("Products"); } } } Now the problem here: Once I debug into my OnPropertyChanged method, I can see that there are no subscribers to the PropertyChanged event (it's null), so nothing happens on the UI.. I already tried Mode=TwoWay and other Binding modes, it seems I can't get the ListView to subscribe to the ItemsSource... Can anyone help me with this? I'm just about to forget about the ElemenHost and just do it in Winforms greetings Daniel

    Read the article

  • PHP post request to retrieve JSON

    - by Brian
    I'm trying to write some simple php code that will make a post request and then retrieve a JSON result from the server. It seemed simple to me, but the below code simply doesn't open a connection. $port = 2057; $path = "/validate/"; $request = "value1=somevalue&value2=somevalue&value3=somevalue"; $http_request = "POST $path HTTP/1.0\r\n"; $http_request .= "Host: $server\r\n"; $http_request .= "Content-Type: application/x-www-form-urlencoded;\r\n"; $http_request .= "Content-Length: " . strlen($request) . "\r\n"; $http_request .= "\r\n"; $http_request .= $request; $response = ''; if( false == ( $fs = @fsockopen($server, $port) ) ) { die ('Could not open socket'); } fwrite($fs, $http_request); while ( !feof($fs) ) { $response .= fgets($fs, 1160); } fclose($fs); In addition I've tried a more simple approach with: $handle = fopen('http://localhost:2057/validate/?'.$request, "r"); or $response = file_get_contents('http://localhost:2057/validate/' . $request); but both of these approaches just time out. I'm trying to connect to a development server I'm running in Visual Studio, so I'm not sure if that has anything to do with the timeout/connection issues. Open to any suggestions here as long as they are built in PHP.

    Read the article

  • Clicking inside a polygon in Google Maps

    - by amarsh-anand
    The included JavaScript snippet is supposed to do the following: As the user clicks on the map, initialize headMarker and draw a circle (polygon) around it As the user clicks inside the circle, initialize tailMarker and draw the path between these two markers 1 is happening as expected. But as the user clicks inside the circle, in the function(overlay,point), overlay is non-null while point is null. Because of this, the code fails to initialize tailMarker. Can someone tell me a way out. GEvent.addListener(map, "click", function(overlay,point) { if (isCreateHeadPoint) { // add the head marker headMarker = new GMarker(point,{icon:redIcon,title:'0'}); map.addOverlay(headMarker); isCreateHeadPoint = false; // draw the circle drawMapCircle(point.lat(),point.lng(),1,'#cc0000',2,0.8,'#0',0.1); } else { // add the tail marker tailMarker = new GMarker(point,{icon:greenIcon,title:''}); map.addOverlay(tailMarker); isCreateHeadPoint = true; // load thes path from head to tail direction.load("from:" + headMarker.getPoint().lat()+ ", " + headMarker.getPoint().lng()+ " " + "to:" + tailMarker.getPoint().lat() + "," + tailMarker.getPoint().lng(), {getPolyline:true}); } });

    Read the article

  • trying to append a list, but something breaks

    - by romunov
    I'm trying to create an empty list which will have as many elements as there are num.of.walkers. I then try to append, to each created element, a new sub-list (length of new sub-list corresponds to a value in a. When I fiddle around in R everything goes smooth: list.of.dist[[1]] <- vector("list", a[1]) list.of.dist[[2]] <- vector("list", a[2]) list.of.dist[[3]] <- vector("list", a[3]) list.of.dist[[4]] <- vector("list", a[4]) I then try to write a function. Here is my feeble attempt that results in an error. Can someone chip in what am I doing wrong? countNumberOfWalks <- function(walk.df) { list.of.walkers <- sort(unique(walk.df$label)) num.of.walkers <- length(unique(walk.df$label)) #Pre-allocate objects for further manipulation list.of.dist <- vector("list", num.of.walkers) a <- c() # Count the number of walks per walker. for (i in list.of.walkers) { a[i] <- nrow(walk.df[walk.df$label == i,]) } a <- as.vector(a) # Add a sublist (length = number of walks) for each walker. for (i in i:num.of.walkers) { list.of.dist[[i]] <- vector("list", a[i]) } return(list.of.dist) } > num.of.walks.per.walker <- countNumberOfWalks(walk.df) Error in vector("list", a[i]) : vector size cannot be NA

    Read the article

  • UIButton stops responding after going into landscape mode - iPhone

    - by casey
    I've been trying different things the last few days and I've run out of ideas so I'm looking for help. The situation is that I'm displaying my in-app purchasing store view after the user clicks a button. Button pressed, view is displayed. The store shows fine. Inside this view, I have a few labels with descriptions of the product, and then below them I have the price and a Buy button which triggers the in-app purchase. Problem is when I rotate the phone to landscape, that Buy button no longer responds, weird. Works fine in portrait. The behavior in landscape when the I touch the button is nothing. It doesn't appear to press down and be selected or anything, just not responding to my touches. But then when I rotate back to portrait or even upside down portrait, it works fine. Here is the rough structure of my view in IB, all the rotating and layout is setup in IB. I set the autoresizing in IB so that everything looks ok in landscape and the Buy button expands horizontally a little bit. The only layout manipulation I do in my code is after loading, I set the content size of the scroll view. File Owner with view set to the scrollView / scrollView ----/ view --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ uibutton (Buy) After orientation changes I printed out the userInteractionEnabled property of the scrollView and the button, and they were both TRUE at all orientations. Ideas? Or maybe some other way of displaying a buy button that won't be nonfunctional? I've already begun a branch that plays with a toolbar and placing the buy button there, but I can't seem to get the bar to stay in place while scrolling.

    Read the article

  • How can I eliminate latency in quicktime streamed video

    - by JJFeiler
    I'm prototyping a client that displays streaming video from a HaiVision Barracuda through a quicktime client. I've been unable to reduce the buffer size below 3.0 seconds... for this application, we need as low a latency as the network allows, and prefer video dropouts to delay. I'm doing the following: - (void)applicationDidFinishLaunching:(NSNotification *)aNotification { NSString *path = [[NSBundle mainBundle] pathForResource:@"haivision" ofType:@"sdp"]; NSError *error = nil; QTMovie *qtmovie = [QTMovie movieWithFile:path error:&error]; if( error != nil ) { NSLog(@"error: %@", [error localizedDescription]); } Movie movie = [qtmovie quickTimeMovie]; long trackCount = GetMovieTrackCount(movie); Track theTrack = GetMovieTrack(movie,1); Media theMedia = GetTrackMedia(theTrack); MediaHandler theMediaHandler = GetMediaHandler(theMedia); QTSMediaPresentationParams myPres; ComponentResult c = QTSMediaGetIndStreamInfo(theMediaHandler, 1,kQTSMediaPresentationInfo, &myPres); Fixed shortdelay = 1<<15; OSErr theErr = QTSPresSetInfo (myPres.presentationID, kQTSAllStreams, kQTSTargetBufferDurationInfo, &shortdelay ); NSLog(@"OSErr %d", theErr); [movieView setMovie:qtmovie]; [movieView play:self]; } I seem to be getting valid objects/structures all the way down to the QTSPres, though the ComponentResult and OSErr are both returning -50. The streaming video plays fine, but the buffer is still 3.0seconds. Any help/insight appreciated. J

    Read the article

  • Sizing issues while adding a .Net UserControl to a TabPage

    - by TJ_Fischer
    I have a complex Windows Forms GUI program that has a lot of automated control generation and manipulation. One thing that I need to be able to do is add a custom UserControl to a newly instatiated TabPage. However, when my code does this I get automatic resizing events that cause the formatting to get ugly. Without detailing all of the different Containers that could possibly be involved, the basic issue is this: At a certain point in the code I create a new tab page: TabPage tempTabPage = new TabPage("A New Tab Page"); Then I set it to a certain size that I want it to maintain: tempTabPage.Width = 1008; tempTabPage.Height = 621; Then I add it to a TabControl: tabControl.TabPages.Add(tempTabPage); Then I create a user control that I want to appear in the newly added TabPage: CustomView customView = new CustomView("A new custom control"); Here is where the problem comes in. At this point both the tempTabPage and the customView are the same size with no padding or margin and they are the size I want them to be. I now try to add this new custom UserControl to the tab page like this: tempTabPage.Controls.Add(customView); When making this call the customView and it's children controls get resized to be larger and so parts of the customView are hidden. Can anyone give me any direction on what to look for or what could be causing this kind of issue? Thanks ahead of time.

    Read the article

  • Why rails app is redirecting unexpectedly instead of matching the route?

    - by ruevaughn
    I asked this question earlier and thought it was fixed, but it's not. Previous question here My problem is I am trying to set my routes so that when I type in localhost:3000/sites/admin It should redirect to localhost:3000/en/sites/admin here is my routes.rb file scope ":locale", locale: /#{I18n.available_locales.join("|")}/ do get "log_out" => "sessions#destroy", as: "log_out" get "log_in" => "sessions#new", as: "log_in" resources :sites, except: [:new, :edit, :index, :show, :update, :destroy, :create] do collection do get :home get :about_us get :faq get :discounts get :services get :contact_us get :admin get :posts end end resources :users resources :abouts resources :sessions resources :coupons resources :monthly_posts resources :reviews resources :categories do collection { post :sort } resources :children, :controller => :categories, :only => [:index, :new, :create, :new_subcategory] end resources :products do member do put :move_up put :move_down end end resources :faqs do collection { post :sort } end root :to => 'sites#home' match "/savesort" => 'sites#savesort' end match '', to: redirect("/#{I18n.default_locale}") match '*path', to: redirect("/#{I18n.default_locale}/%{path}") But as of right now, it redirects to /en/en/en/en/en/en/en/en/en/en/sites/admin (adds en until browser complains). Any thoughts why it keeps adding /en?

    Read the article

< Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >