Search Results

Search found 11536 results on 462 pages for 'whole foods market'.

Page 314/462 | < Previous Page | 310 311 312 313 314 315 316 317 318 319 320 321  | Next Page >

• Toolbar disappeared in Visual Studio

  - by j-t-s

  Visual Studio ate my toolbar, I opened a solution for a project I've been working on for a few months, and the toolbar has 135 buttons on it, and while it was loading, the whole toolbar flickered like it was trying to give me a seizure or something, and then it dissappeared. Now when I click Debug, it won't let me do it because all the resources are missing!? I'm using: Visual Studio 2010 C# Express Windows 7 Home Premium 64-bit. I have searched Google and found nothing related. I'm hoping that Visual Studio can also somehow make bowel movements so I can find those missing resources and put everything back together again, but I don't think that's a likely scenario... Has anybody ever experienced this before, and if so, are there any updates/fixes for this?

  Read the article

• How to select first entry of the day grouped by user in SQL

  - by mikepreble

  I've looked around and can't quite grasp the whole answer to this SQL query question needed to extract data from an MS Access 2000 table. Here's an example of what the table [Time Sub] looks like: CLIENT_ID, DATE_ENTERED, CODE, MINUTES 11111, 5/12/2008 3:50:52 PM, M, 38 11111, 5/12/2008 2:55:50 PM, M, 2 11714, 5/13/2008 1:15:32 PM, M, 28 11111, 5/13/2008 6:15:12 PM, W, 11 11112, 5/12/2008 2:50:52 PM, M, 89 11112, 5/12/2008 5:10:52 PM, M, 9 91112, 5/14/2008 1:10:52 PM, L, 96 11112, 5/12/2008 5:11:52 PM, M, 12 I need to select the first entry of each day per client that's NOT code L or W. I know this can be done in a SQL statement, but I just can't figure out how. I can get close, but never come up with the right output. Any help is appreciated. Thanks, Mike

  Read the article

• .NET grouping forms so that pulling up the primary form shows all other forms?

  - by toasteroven

  I have an app that can open up some other forms at the user's request, and they're set to not show in the taskbar. The problem is, if one of the secondary windows becomes hidden by another app, switching to the primary window only brings that form to the forefront. Is there a good way to "group" the forms so that giving any of them focus brings the whole group to the front? I tried calling BringToFront() on each form in the primary form's Activated event, but that also gives the secondary forms focus, making it impossible to interact with the primary form.

  Read the article

• Include multiple jars with classpathentry

  - by ripper234

  I have an eclipse's .classpath file that looks like this: <?xml version="1.0" encoding="UTF-8"?> <classpath> <classpathentry kind="src" path="src"/> <classpathentry kind="src" path="test"/> <classpathentry kind="con" path="org.eclipse.jdt.launching.JRE_CONTAINER"/> <classpathentry kind="output" path="bin"/> <classpathentry kind="lib" path="/libraries/jee/servlet-api.jar"/> <classpathentry kind="lib" path="/libraries/junit/junit-4.6.jar"/> <classpathentry kind="lib" path="/libraries/log4j/log4j-1.2.15.jar"/> </classpath> I'd like to add a whole directory of jars to the classpath - I like eclipse (or more precisely, our ant-based build process that uses .classpath format) to know several jars that reside in a single directory, without specifying them directly. How can I do that?

  Read the article

• MediaWiki : is it possible to add an edit link in a template?

  - by leo

  I have a template on my wiki, kind of a box template. Then, there is this page where I use it several times. Can I add an edit link to each of the boxes so I don't have to edit the whole page in order to modify one of the boxes? The boxes contain only text, not other templates. Thanks! Edit: Actually there's an easier way to ask my question: Let's say I have a page without sections defined (namely without == titles ==): content A content B content C Is there a way to open an edit form only for content B?

  Read the article

• extracting string occurrence in c

  - by David78

  I have a string from a text file that look something like this: long_str = "returns between paragraphs 20102/34.23" - 9203 1232 "test" "basic HTML" Note: Quotes are part of the string. int match(char *long_str){ char * str; if ((str = strchr(long_str, '"')) != NULL) str++; // last " ? else return 1; return 0; } Using strstr I'm trying to get the whole substring between the last two quotes: "basic HTML". I'm just not quite sure what would be a good and efficient way of getting that match. I'm open to any other ideas on how to approach this. Thanks

  Read the article

• Optimal diff between object lists in Java

  - by Philipp

  I have a List of Java objects on my server which is sent to the client through some serialization mechanism. Once in a while the List of objects gets updated on the server, that is, some objects get added, some get deleted and others just change their place in the List. I want to update the List on the client side as well, but send the least possible data. Especially, I don't want to resend Objects which are already available on the client. Is there a library available which will produce some sort of diff from the two lists, so that I can only send the difference and the new Objects accross the wire? I have found several Java implementation of the unix diff command, but this algorithm is unpractical for order changes. ie. [A,B,C] - [C,B,A] could be sent as only place changes [1-3] [3-1], while diff will want to resend the whole A and C objects (as far as I understand).

  Read the article

• Recursively determine average value

  - by theva

  I have to calculate an average value of my simulation. The simulation is ongoing and I want (for each iteration) to print the current average value. How do I do that? I tried the code below (in the loop), but I do not think that the right value is calculated... int average = 0; int newValue; // Continuously updated value. if(average == 0) { average = newValue; } average = (average + newValue)/2; I also taught about store each newValue in an array and for each iteration summarize the whole array and do the calculation. However, I don't think that's a good solution, because the loop is an infinity loop so I can't really determine the size of the array. There is also a possibility that I am thinking too much and that the code above is actually correct, but I don't think so...

  Read the article

• Min-Ordered Bionomial Heap Insertion java

  - by Charodd Richardson

  Im writing a java code to make a min-ordered Binomial Heap and I have to Insert and Remove-min. I'm having a very big problem inserting into the Heap. I have been stuck on this for a couple of days now and it is due tomorrow. Whenever I go to insert, It only prints out the item I insert instead of the whole tree (which is in preorder). Such as if I insert 1 it prints (1) and then I go to insert 2 it prints out (2) instead of (1(2)) It keeps printing out only the number I insert last instead of the whole preordered tree. I would be very grateful if someone could help me with this problem. Thank you so much in advance, Here is my code. public class BHeap { int key; int degree;//The degree(Number of children) BHeap parent, leftmostChild, rightmostChild, rightSibling,root,previous,next; public BHeap(){ key =0; degree=0; parent =null; leftmostChild=null; rightmostChild=null; rightSibling=null; root=null; previous=null; next=null; } public BHeap merge(BHeap x, BHeap y){ BHeap newHeap = new BHeap(); y.rightSibling=x.root; BHeap currentHeap = y; BHeap nextHeap = y.rightSibling; while(currentHeap.rightSibling !=null){ if(currentHeap.degree==nextHeap.degree){ if(currentHeap.key<nextHeap.key){ if(currentHeap.degree ==0){ currentHeap.leftmostChild=nextHeap; currentHeap.rightmostChild=nextHeap; currentHeap.rightSibling=nextHeap.rightSibling; nextHeap.rightSibling=null; nextHeap.parent=currentHeap; currentHeap.degree++; } else{ newHeap = currentHeap; newHeap.rightmostChild.rightSibling=nextHeap; newHeap.rightmostChild=nextHeap; nextHeap.parent=newHeap; newHeap.degree++; nextHeap.rightSibling=null; nextHeap=newHeap.rightSibling; } } else{ if(currentHeap.degree==0){ nextHeap.rightmostChild=currentHeap; nextHeap.rightmostChild.root = nextHeap.rightmostChild;//add nextHeap.leftmostChild=currentHeap; nextHeap.leftmostChild.root = nextHeap.leftmostChild;//add currentHeap.parent=nextHeap; currentHeap.rightSibling=null; currentHeap.root=currentHeap;//add nextHeap.degree++; } else{ newHeap=nextHeap; newHeap.rightmostChild.rightSibling=currentHeap; newHeap.rightmostChild=currentHeap; currentHeap.parent= newHeap; newHeap.degree++; currentHeap=newHeap.rightSibling; currentHeap.rightSibling=null; } } } else{ currentHeap=currentHeap.rightSibling; nextHeap=nextHeap.rightSibling; } } return y; } public void Insert(int x){ /*BHeap newHeap = new BHeap(); newHeap.key=x; if(this.root==null){ this.root=newHeap; return; } else{ this.root=merge(newHeap,this.root); }*/ BHeap newHeap= new BHeap(); newHeap.key=x; if(this.root==null){ this.root=newHeap; } else{ this.root = merge(this,newHeap); }} public void RemoveMin(){ BHeap newHeap = new BHeap(); BHeap child = new BHeap(); newHeap=this; BHeap pos = newHeap.next; while(pos !=null){ if(pos.key<newHeap.key){ newHeap=pos; } pos=pos.rightSibling; } pos=this; BHeap B1 = new BHeap(); if(newHeap.previous!=null){ newHeap.previous.rightSibling=newHeap.rightSibling; B1 =pos.leftmostChild; B1.rightSibling=pos; pos.leftmostChild=pos.rightmostChild.leftmostChild; } else{ newHeap=newHeap.rightSibling; newHeap.previous.rightSibling=newHeap.rightSibling; B1 =pos.leftmostChild; B1.rightSibling=pos; pos.leftmostChild=pos.rightmostChild.leftmostChild; } merge(newHeap,B1); } public void Display(){ System.out.print("("); System.out.print(this.root.key); if(this.leftmostChild != null){ this.leftmostChild.Display(); } System.out.print(")"); if(this.rightSibling!=null){ this.rightSibling.Display(); } } }

  Read the article

• Efficient mapping for a particular finite integer set

  - by R..

  I'm looking for a small, fast (in both directions) bijective mapping between the following list of integers and a subset of the range 0-127: 0x200C, 0x200D, 0x200E, 0x200F, 0x2013, 0x2014, 0x2015, 0x2017, 0x2018, 0x2019, 0x201A, 0x201C, 0x201D, 0x201E, 0x2020, 0x2021, 0x2022, 0x2026, 0x2030, 0x2039, 0x203A, 0x20AA, 0x20AB, 0x20AC, 0x20AF, 0x2116, 0x2122 One obvious solution is: y = x>>2 & 0x40 | x & 0x3f; x = 0x2000 | y<<2 & 0x100 | y & 0x3f; Edit: I was missing some of the values, particularly 0x20Ax, which don't work with the above. Another obvious solution is a lookup table, but without making it unnecessarily large, a lookup table would require some bit rearrangement anyway and I suspect the whole task can be better accomplished with simple bit rearrangement. For the curious, those magic numbers are the only "large" Unicode codepoints that appear in legacy ISO-8859 and Windows codepages.

  Read the article

• TPageControl tab area OnMouseEnter OnMouseLeave events

  - by daemon_x

  Hello, I need to catch the "OnMouseEnter" and "0nMouseLeave" for a certain area of the TPageControl component. With that specific area I mean the whole "tab header" rectangle. The problem is, that the page control doesn't catch the messages (I'm catching internal control messages CM_MOUSEENTER and CM_MOUSELEAVE) in the "empty" space. The aim for me is to draw a small arrow in the right empty side when user hovers in the red framed area (and drawing is just piece of cake) and erase it when leaves this area. And I'm don't care about the overflow of the tabs (which causes to draw scrolling double button) - that will never happen.

  Read the article

• Zend Framework: How to handle exceptions in Ajax requests?

  - by understack

  Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

  Read the article

• Reference to fnc.

  - by atch

  Hi guys, Is there a way in java to do something like this: void fnc(void Reference_to_other_func()); What I'm trying is basically I have number of places where I need to display this same text to the user and the only difference is which method is invoked after this text. So for example instead of writing: System.out.println("Hello"); f1(); //in some other place System.out.println("Hello"); f2(); //etc I would like to define one function: public void f(void Reference_to_other_func()) { System.out.println("Hello"); Reference_to_other_func();//HERE I'M INVOKING } and then instead of repeating this whole code I could write something like this: f(f1); //in some other place f(f2) //etc. Thanks for answers

  Read the article

• .htaccess password and forced login

  - by Boco

  I have password protected website with .htaccess. What I want to do now is to force users to login from the index.html page and not from any other which they can do now. ie. I have index.html (the main page) and I have two other pages 1.html and 2. html also protected with .htaccess password. Users can now type http://www.mypage.com/1.html and they will be asked for login data but I would like to force them (before they are asked for login details) to index.html to login. After they are loggedin they can use any link (ie.1.html or 2.html) as they want. Can this be done by using .htaccess? I would need the whole code. Thank you!

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Jquery, ajax() and each(), how to wait untill all info is really loaded?

  - by Moustard

  Hello, I have a function using $.ajax() to get values from an XML file, when the info is loaded and success event is fired, I use $(xml).find('').each(function(){}); to populate some vars... function getData() { $.ajax({ type: 'GET', url : 'info.xml', dataType: 'xml', success: function(xml) { $(xml).find('DATAS').each(function() { date = new Date($(this).attr('DATE')); alert(date); }) //Here I have a bigger find/each that should take more time }, error: function() { return false; } }); } In this case, when I trigger the function from the document ready function, the alert shows the right data, but If I remove the alert from the function and try this instead, date wont be defined yet: $(document).ready(function() { if(getData() != false) { alert(date); } }); I guess in this case the data is not ready yet? Is there a way to keep control on when the whole each() traversing is finished and ready?

  Read the article

• LibGDX: transform Texture to TextureRegion

  - by FeRo2991

  I am creating a TowerDefence Game in LibGDX and am now trying to replace the old Tile with a new StaticTiledMapTile. But to create a StaticTiledMapTile I need a TextureRegion, not a Texture. Now I'm trying to create a TextureRegion, which contains the whole Texture, but it doesn't seem to work. It always appears distorted. I have tried the following: TextureRegion region = new TextureRegion(new Texture("someImg.png"), 0, 0, 32, 32); StaticTileMapTile tile = new StaticTiledMapTile(region); getLayer().getCell(x,y).setTile(tile); //setting the new tile In my opinion this should work (if the image, as it is, is 32px wide and 32px high).

  Read the article

• Flash Builder 'building' html files...

  - by Frank

  I'm using Flash Builder 3 to edit my Flex app, but I noticed that every time I make a change on the .html files (index.template.html for example), even if it's not in the IDE but with another program, Flash Builder rebuilds the whole project. Is there anyway to stop this? Why would it need to rebuild the workspace everytime a html file changes? If it was too long it wouldn't bother me, but it takes a lot of time (more than 1 minute) every time. For your information the html file is 95 lines of 'code'. Thanks

  Read the article

• how to sort an existing table in greasemonkey ?

  - by user570512

  i'm writing a greasemonkey user.js for a page with a table in it. (table is 100 rows by 18 columns.) now what i want to do is to make it sortable on column. and also have it run in both chrome and firefox. all searches for answers sofar resulted in suggestions to use jquery/dojo or something alike. can i be done without any external code? after all it's just a matter of replacing the row's in a different order, right? or is that a silly thing to say? the thing is that i'm already using dojo for some query needs but since i want it to run in both firefox and chrome, i just copy paste the whole dojo thing in my script.. also, most of the solutions i found sofar seem to be more for use when building a table. not for altering an existing one. any help is appreciated.

  Read the article

• Strange Locking Behaviour in SQL Server 2005

  - by SQL Learner

  Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

  Read the article

• How to change the font size in table cells according to cells content ?

  - by misha-moroshko

  I have an HTML table which has incrementing numbers starting from 0 in its cells (left to right, up to bottom). I fixed in CSS the width and the height of the cells (40px width, 25px height, in my case). When the table becomes larger, the numbers inside it becomes large also (for example, the last number is 1266356). This causes the cells to be wider than I defined in the CSS, which expands the whole table accordingly. Instead, I would like the font of the numbers to be smaller to keep the width of the cell 40px. How can I accomplish this using CSS / Javascript / jQuery ?

  Read the article

• What is the quikest method to see actual color of any hex code #a7a7a7?

  - by metal-gear-solid

  What is the quikest method to see actual color of any hex code #a7a7a7? When i work on other's CSS then if i deal with color codes then i quickly wan to see the color of that particular hex code. suppose if i'm editing css in notepad and i found code #a7a7a7 then how can i know what is the color of this code. If i have a color on my screen then i quickly know what would be hex code for this with the help of some tools ,but i need just opposite of this. i'm not talking about to see whole color chart of site. I want to see color of particular hex code.

  Read the article

• HTML5 drag & drop: The dragged element content is missing in Webkit browsers.

  - by Cibernox

  I'm trying to implement something similar to a cart where you can drop items from a list. This items (<li> elements) has some elements inside (divs, span, and that stuff). The drag and drop itself works great. But the dragged element's image doesn't show its content in Webkit browsers. My list element has a border an a background color. In Firefox, the image is the whole item. In Webkit browsers, only the dragged element without content. I see the background and border, but without text inside. I tried to make a copy of the element and force it to be the image, but doesn't work. var dt = ev.originalEvent.dataTransfer; dt.setDragImage( $(ev.target).clone()[0], 0, 0); I have a simplified example that exhibit the same behavior: http://jsfiddle.net/ksnJf/1/

  Read the article

• Are Domain Specific Languages (DSL) bad for the Common Programmer?

  - by iestyn

  I have lately been delving into F# and the new DSL stuff as in the Microsoft SQL Server Modelling CTP, and have some concerns. Will this new idea that will come about be bad for skilled programmers? Is code going to be dumbed down? I know I sound like a luddite, but this does worry me, after spending years of time practising in my craft, and now might be scuttled by genius from within. I am afraid, very afraid. Will I be now trapped in a job that only programs against a DSL and therefore every job that I work on, I have to learn a whole new DSL based on top of a Framework (.net Java), that I will only be allowed to touch certain parts of. I don't think the world is ready for DSL, but the sales pitch is deafening!

  Read the article

• download authentication?

  - by Sahat

  Hi I am sorry if this question has been asked before but I am looking for some sort of download authentication. In other words if I am going to give the user a link to a file, I want to make sure only that person will get it, and get it only once! Is there a simple solution without setting up the whole database. Even better if it's possible to have an ecrypted web link that will let you download a file from my FTP server just once, after that the link becomes invalid. Thanks.

  Read the article

< Previous Page | 310 311 312 313 314 315 316 317 318 319 320 321  | Next Page >