Search Results

Search found 10106 results on 405 pages for 'fail fast'.

Page 315/405 | < Previous Page | 311 312 313 314 315 316 317 318 319 320 321 322  | Next Page >

  • Parsing Line Breaks in PHP/JavaScript

    - by Matt G
    I have a text area in my PHP application where users can enter notes in a project. Sometimes this is displayed on the page via PHP and sometimes it is displayed via javascript. The problem is, if the note is across multiple lines (i.e. the user presses enter while entering notes in the text area), it causes the JS to fail. It's fine when it's being done by the PHP. The line of code in question is: var editnotes='<textarea class="desc_text" style="width:20em;" id="notes_editor"><?php print $notes; ?></textarea>'; So, if the note is over multiple lines, the PHP builds the pager as: var editnotes='<textarea class="desc_text" style="width:20em;" id="notes_editor">This is a test note over multiple lines </textarea>'; And this obviously causes problems for the js. So my question is, what can I do to prevent this? As the code is being built by PHP before it even gets to the browser, I'm thinking that the best approach may be to parse it in the PHP so that the output is something more like this: var editnotes='<textarea class="desc_text" style="width:20em;" id="notes_editor">This is<br/>a test note<br/>over multiple lines<br/></textarea>'; Will this work? How would I do it? Thanks

    Read the article

  • Is SQLDataReader slower than using the command line utility sqlcmd?

    - by Andrew
    I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

    Read the article

  • Understanding floating point problems

    - by Maxim Gershkovich
    Could someone here please help me understand how to determine when floating point limitations will cause errors in your calculations. For example the following code. CalculateTotalTax = function (TaxRate, TaxFreePrice) { return ((parseFloat(TaxFreePrice) / 100) * parseFloat(TaxRate)).toFixed(4); }; I have been unable to input any two values that have caused for me an incorrect result for this method. If I remove the toFixed(4) I can infact see where the calculations start to lose accuracy (somewhere around the 6th decimal place). Having said that though, my understanding of floats is that even small numbers can sometimes fail to be represented or have I misunderstood and can 4 decimal places (for example) always be represented accurately. MSDN explains floats as such... This means they cannot hold an exact representation of any quantity that is not a binary fraction (of the form k / (2 ^ n) where k and n are integers) Now I assume this applies to all floats (inlcuding those used in javascript). Fundamentally my question boils down to this. How can one determine if any specific method will be vulnerable to errors in floating point operations, at what precision will those errors materialize and what inputs will be required to produce those errors? Hopefully what I am asking makes sense.

    Read the article

  • C++ help with getline function with ifstream

    - by John
    So I am writing a program that deals with reading in and writing out to a file. I use the getline() function because some of the lines in the text file may contain multiple elements. I've never had a problem with getline until now. Here's what I got. The text file looks like this: John Smith // Client name 1234 Hollow Lane, Chicago, IL // Address 123-45-6789 // SSN Walmart // Employer 58000 // Income 2 // Number of accounts the client has 1111 // Account Number 2222 // Account Number ifstream inFile("ClientInfo.txt"); if(inFile.fail()) { cout << "Problem opening file."; } else { string name, address, ssn, employer; double income; int numOfAccount; getline(inFile, name); getline(inFile, address); // I'll stop here because I know this is where it fails. When I debugged this code, I found that name == "John", instead of name == "John Smith", and Address == "Smith" and so on. Am I doing something wrong. Any help would be much appreciated.

    Read the article

  • glitchy stuttery iphone game loop

    - by Adam
    This is a problem I've been trying to solve for a few days now, and I've looked at the various solutions on stackoverflow and nothing has really seemed to work for me. I'm making an iPhone game with OpenGLES graphics and accelerometer input, at this point it's very simple, but the rendering is already pretty bad... it stutters and seems to jump back or forward in time. It doesn't happen a lot, but it happens enough to be a problem. I mean, who wants to play a game where a bullet gets magically transported into the player, and then it's game over? No one. I've tried using NSTimer for the game loop, I've tried using a separate thread (with a frame rate and continuously) I've tried using different frame rates, from 30FPS to 60FPS (It seems to have a max frame rate around 45FPS, but no problems at 30FPS) I've tried using timeIntervalSince1970 and CFGetAbsoluteTime to measure loop time, with no noticeable diffence Anyone have any ideas on what is the best way to get this looking better? One of the posts I've read suggested running the simulation at a fixed frame rate and then just render as fast as possible, does that seem like a good idea?

    Read the article

  • Lua Alien Module - Trouble using WriteProcessMemory function, unsure on types (unit32)

    - by jefferysanders
    require "alien" --the address im trying to edit in the Mahjong game on Win7 local SCOREREF = 0x0744D554 --this should give me full access to the process local ACCESS = 0x001F0FFF --this is my process ID for my open window of Mahjong local PID = 1136 --function to open proc local op = alien.Kernel32.OpenProcess op:types{ ret = "pointer", abi = "stdcall"; "int", "int", "int"} --function to write to proc mem local wm = alien.Kernel32.WriteProcessMemory wm:types{ ret = "long", abi = "stdcall"; "pointer", "pointer", "pointer", "long", "pointer" } local pRef = op(ACCESS, true, PID) local buf = alien.buffer("99") -- ptr,uint32,byte arr (no idea what to make this),int, ptr print( wm( pRef, SCOREREF, buf, 4, nil)) --prints 1 if success, 0 if failed So that is my code. I am not even sure if I have the types set correctly. I am completely lost and need some guidance. I really wish there was more online help/documentation for alien, it confuses my poor brain. What utterly baffles me is that it WriteProcessMemory will sometimes complete successfully (though it does nothing at all, to my knowledge) and will also sometimes fail to complete successfully. As I've stated, my brain hurts. Any help appreciated.

    Read the article

  • Should a Perl constructor return an undef or a "invalid" object?

    - by DVK
    Question: What is considered to be "Best practice" - and why - of handling errors in a constructor?. "Best Practice" can be a quote from Schwartz, or 50% of CPAN modules use it, etc...; but I'm happy with well reasoned opinion from anyone even if it explains why the common best practice is not really the best approach. As far as my own view of the topic (informed by software development in Perl for many years), I have seen three main approaches to error handling in a perl module (listed from best to worst in my opinion): Construct an object, set an invalid flag (usually "is_valid" method). Often coupled with setting error message via your class's error handling. Pros: Allows for standard (compared to other method calls) error handling as it allows to use $obj->errors() type calls after a bad constructor just like after any other method call. Allows for additional info to be passed (e.g. 1 error, warnings, etc...) Allows for lightweight "redo"/"fixme" functionality, In other words, if the object that is constructed is very heavy, with many complex attributes that are 100% always OK, and the only reason it is not valid is because someone entered an incorrect date, you can simply do "$obj->setDate()" instead of the overhead of re-executing entire constructor again. This pattern is not always needed, but can be enormously useful in the right design. Cons: None that I'm aware of. Return "undef". Cons: Can not achieve any of the Pros of the first solution (per-object error messages outside of global variables and lightweight "fixme" capability for heavy objects). Die inside the constructor. Outside of some very narrow edge cases, I personally consider this an awful choice for too many reasons to list on the margins of this question. UPDATE: Just to be clear, I consider the (otherwise very worthy and a great design) solution of having very simple constructor that can't fail at all and a heavy initializer method where all the error checking occurs to be merely a subset of either case #1 (if initializer sets error flags) or case #3 (if initializer dies) for the purposes of this question. Obviously, choosing such a design, you automatically reject option #2.

    Read the article

  • Change NSTimer interval for repeating timer.

    - by user300713
    Hi, I am running a mainLoop in Cocoa using an NSTimer set up like this: mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/fps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; At Program startup I set the timeInterval to 0.0 so that the mainloop runs as fast as possible. Anyways, I would like to provide a function to set the framerate(and thus the time interval of the timer) to a specific value at runtime. Unfortunately as far as I know that means that I have to reinitialize the timer since Cocoa does not provide a function like "setTimerInterval" This is what I tried: - (void)setFrameRate:(float)aFps { NSLog(@"setFrameRate"); [mainLoopTimer invalidate]; mainLoopTimer = nil; mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/aFps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; } but this throws the following error and stops the mainloop: 2010-06-09 11:14:15.868 myTarget[7313:a0f] setFrameRate 2010-06-09 11:14:15.868 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40cd80 of class __NSCFDate autoreleased with no pool in place - just leaking 2010-06-09 11:14:15.869 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40e700 of class NSCFTimer autoreleased with no pool in place - just leaking 0.614628 I also tried to recreate the timer using the "retain" keyword, but that didn't change anything. Any ideas about how to dynamically change the interval of an NSTimer at runtime? Thanks!

    Read the article

  • How can I build something like Amazon S3 in Perl?

    - by Joel G
    I am looking to code a file storage application in perl similar to amazon s3. I already have a amazon s3 clone that I found online called parkplace but its in ruby and is old also isn't built for high loads. I am not really sure what modules and programs I should use so id like some help picking them out. My requirements are listed below (yes I know there are lots but I could start simple then add more once I get it going): Easy API implementation for client side apps. (maybe REST (?) Centralized database server for the USERDB (maybe PostgreSQL (?). Logging of all connections, bandwidth used, well pretty much everything to a centralized server (maybe PostgreSQL again (?). Easy server side configuration (config file(s) stored on the servers). Web based control panel for admin(s) and user(s) to show logs. (could work just running queries from the databases) Fast High Uptime Low memory usage Some sort of load distribution/load balancer (maybe a dns based or pound or perlbal or something else (?). Maybe a cache of some sort (memcached or parlbal or something else (?). Thanks in advance

    Read the article

  • Looking for a .Net ORM

    - by SLaks
    I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

    Read the article

  • string parsing to double fails in C++ (Xcode problem?)

    - by helixed
    Here's a fun one I've been trying to figure out. I have the following program: #include <iostream> #include <string> #include <sstream> using namespace std; int main(int argc, char *argv[]) { string s("5"); istringstream stream(s); double theValue; stream >> theValue; cout << theValue << endl; cout << stream.fail(); } The output is: 0 1 I don't understand why this is failing. Could somebody please tell me what I'm doing wrong? Thanks, helixed EDIT: Okay, sorry to turn this into a double post, but this looks like a problem specific to Xcode. If I compile this in g++, the code works without a problem. Does anybody have an idea why this is happening in Xcode, and how I could possibly fix it? Thanks again, helixed

    Read the article

  • Basic jUnit Questions

    - by Epitaph
    I was testing a String multiplier class with a multiply() method that takes 2 numbers as inputs (as String) and returns the result number (as String) `public String multiply(String num1, String num2); I have done the implementation and created a test class with the following test cases involving the input String parameter as 1) valid numbers 2) characters 3) special symbol 4) empty string 5) Null value 6) 0 7) Negative number 8) float 9) Boundary values 10) Numbers that are valid but their product is out of range 11) numbers will + sign (+23) 1) I'd like to know if "each and every" assertEquals() should be in it's own test method? Or, can I group similar test cases like testInvalidArguments() to contains all asserts involving invalid characters since ALL of them throw the same NumberFormatException ? 2) If testing an input value like character ("a"), do I need to include test cases for ALL scenarios? "a" as the first argument "a" as the second argument "a" and "b" as the 2 arguments 3) As per my understanding, the benefit of these unit tests is to find out the cases where the input from a user might fail and result in an exception. And, then we can give the user with a meaningful message (asking them to provide valid input) instead of an exception. Is that the correct? And, is it the only benefit? 4) Are the 11 test cases mentioned above sufficient? Did I miss something? Did I overdo? When is enough? 5) Following from the above point, have I successfully tested the multiply() method?

    Read the article

  • Far jump in ntdll.dll's internal ZwCreateUserProcess

    - by user49164
    I'm trying to understand how the Windows API creates processes so I can create a program to determine where invalid exes fail. I have a program that calls kernel32.CreateProcessA. Following along in OllyDbg, this calls kernel32.CreateProcessInternalA, which calls kernel32.CreateProcessInternalW, which calls ntdll.ZwCreateUserProcess. This function goes: mov eax, 0xAA xor ecx, ecx lea edx, dword ptr [esp+4] call dword ptr fs:[0xC0] add esp, 4 retn 0x2C So I follow the call to fs:[0xC0], which contains a single instruction: jmp far 0x33:0x74BE271E But when I step this instruction, Olly just comes back to ntdll.ZwCreateUserProcess at the add esp, 4 right after the call (which is not at 0x74BE271E). I put a breakpoint at retn 0x2C, and I find that the new process was somehow created during the execution of add esp, 4. So I'm assuming there's some magic involved in the far jump. I tried to change the CS register to 0x33 and EIP to 0x74BE271E instead of actually executing the far jump, but that just gave me an access violation after a few instructions. What's going on here? I need to be able to delve deeper beyond the abstraction of this ZwCreateUserProcess to figure out how exactly Windows creates processes.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Cross-platform game development: ease of development vs security

    - by alcuadrado
    Hi, I'm a member and contributor of the Argentum Online (AO) community, the first MMORPG from Argentina, which is Free Software; which, although it's not 3D, it's really addictive and has some dozens of thousands of users. Really unluckily AO was developed in Visual Basic (yes, you can laugh) but the former community, so imagine, the code not only sucks, it has zero portability. I'm planning, with some friends to rewrite the client, and as a GNU/Linux frantic, want to do it cross-platform. Some other people is doing the same with the server in Java. So my biggest problem is that we would like to use a rapid development language (like Java, Ruby or Python) but the client would be pretty insecure. Ruby/Python version would have all it's code available, and the Java one would be easily decompilable (yes, we have some crackers in the community) We have consider the option to implement the security module in C/C++ as a dynamic library, but it can be replaced with a custom one, so it's not really secure. We are also considering the option of doing the core application in C++ and the GUI in Ruby/Python. But haven't analysed all it's implications yet. But we really don't want to code the entire game in C/C++ as it doesn't need that much performance (the game is played at 18fps on average) and we want to develop it as fast as possible. So what would you choose in my case? Thank you!

    Read the article

  • Using a handle to collect output from CreateProcess()

    - by Stef
    Hi I am using CreateProcess() to run an external console application in Windows from my GUI application. I would like to somehow gather the output to know whether there were errors. Now I know I have to do something with hStdOutput, but I fail to understand what. I am new to c++ and an inexperienced programmer and I actually don't know what to do with a handle or how to light a pipe. How do I get the output to some kind of variable (or file)? This is what I have a the moment: void email::run(string path,string cmd){ WCHAR * ppath=new(nothrow) WCHAR[path.length()*2]; memset(ppath,' ',path.length()*2); WCHAR * pcmd= new(nothrow) WCHAR[cmd.length()*2]; memset(pcmd,' ',cmd.length()*2); string tempstr; ToWCHAR(path,ppath); //creates WCHAR from my std::string ToWCHAR(cmd,pcmd); STARTUPINFO info={sizeof(info)}; info.dwFlags = STARTF_USESHOWWINDOW; //hide process PROCESS_INFORMATION processInfo; if (CreateProcess(ppath,pcmd, NULL, NULL, FALSE, 0, NULL, NULL, &info, &processInfo)) { ::WaitForSingleObject(processInfo.hProcess, INFINITE); CloseHandle(processInfo.hProcess); CloseHandle(processInfo.hThread); } delete[](ppath); delete[](pcmd); } This code probably makes any decent programmer scream, but (I shouldn't even say it:) It works ;-) The Question: How do I use hStdOutput to read the output to a file (for instance)?

    Read the article

  • Forking in PHP on Windows

    - by Doug Kavendek
    We are running PHP on a Windows server (a source of many problems indeed, but migrating is not an option currently). There are a few points where a user-initiated action will need to kick off a few things that take a while and about which the user doesn't need to know if they succeed or fail, such as sending off an email or making sure some third-party accounts are updated. If I could just fork with pcntl_fork(), this would be very simple, but the PCNTL functions are not available in Windows. It seems the closest I can get is to do something of this nature: exec( 'php-cgi.exe somescript.php' ); However, this would be far more complicated. The actions I need to kick off rely on a lot of context that already will exist in the running process; to use the above example, I'd need to figure out the essential data and supply it to the new script in some way. If I could fork, it'd just be a matter of letting the parent process return early, leaving the child to work on a few more things. I've found a few people talking about their own work in getting various PCNTL functions compiled on Windows, but none seemed to have anything available (broken links, etc). Despite this question having practically the same name as mine, it seems the problem was more execution timeout than needing to fork. So, is my best option to just refactor a bit to deal with calling php-cgi, or are there other options? Edit: It seems exec() won't work for this, at least not without me figuring some other aspect of it, as it waits until the call returns. I figured I could use START, sort of like exec( 'start php-cgi.exe somescript.php' );, but it still waits until the other script finishes.

    Read the article

  • Function syntax puzzler in scalaz

    - by oxbow_lakes
    Following watching Nick Partidge's presentation on deriving scalaz, I got to looking at this example, which is just awesome: import scalaz._ import Scalaz._ def even(x: Int) : Validation[NonEmptyList[String], Int] = if (x % 2 ==0) x.success else "not even: %d".format(x).wrapNel.fail println( even(3) <|*|> even(5) ) //prints: Failure(NonEmptyList(not even: 3, not even: 5)) I was trying to understand what the <|*|> method was doing, here is the source code: def <|*|>[B](b: M[B])(implicit t: Functor[M], a: Apply[M]): M[(A, B)] = <**>(b, (_: A, _: B)) OK, that is fairly confusing (!) - but it references the <**> method, which is declared thus: def <**>[B, C](b: M[B], z: (A, B) => C)(implicit t: Functor[M], a: Apply[M]): M[C] = a(t.fmap(value, z.curried), b) So I have a few questions: How come the method appears to take a monad of one type parameter (M[B]) but can get passed a Validation (which has two type paremeters)? How does the syntax (_: A, _: B) define the function (A, B) => C which the 2nd method expects? It doesn't even define an output via =>

    Read the article

  • So can unique_ptr be used safely in stl collections?

    - by DanDan
    I am confused with unique_ptr and rvalue move philosophy. Let's say we have two collections: std::vector<std::auto_ptr<int>> autoCollection; std::vector<std::unique_ptr<int>> uniqueCollection; Now I would expect the following to fail, as there is no telling what the algorithm is doing internally and maybe making internal pivot copies and the like, thus ripping away ownership from the auto_ptr: std::sort(autoCollection.begin(), autoCollection.end()); I get this. And the compiler rightly disallows this happening. But then I do this: std::sort(uniqueCollection.begin(), uniqueCollection.end()); And this compiles. And I do not understand why. I did not think unique_ptrs could be copied. Does this mean a pivot value cannot be taken, so the sort is less efficient? Or is this pivot actually a move, which in fact is as dangerous as the collection of auto_ptrs, and should be disallowed by the compiler? I think I am missing some crucial piece of information, so I eagerly await someone to supply me with the aha! moment.

    Read the article

  • How to localize an app on Google App Engine?

    - by Petri Pennanen
    What options are there for localizing an app on Google App Engine? How do you do it using Webapp, Django, web2py or [insert framework here]. 1. Readable URLs and entity key names Readable URLs are good for usability and search engine optimization (Stack Overflow is a good example on how to do it). On Google App Engine, key based queries are recommended for performance reasons. It follows that it is good practice to use the entity key name in the URL, so that the entity can be fetched from the datastore as quickly as possible. Currently I use the function below to create key names: import re import unicodedata def urlify(unicode_string): """Translates latin1 unicode strings to url friendly ASCII. Converts accented latin1 characters to their non-accented ASCII counterparts, converts to lowercase, converts spaces to hyphens and removes all characters that are not alphanumeric ASCII. Arguments unicode_string: Unicode encoded string. Returns String consisting of alphanumeric (ASCII) characters and hyphens. """ str = unicodedata.normalize('NFKD', unicode_string).encode('ASCII', 'ignore') str = re.sub('[^\w\s-]', '', str).strip().lower() return re.sub('[-\s]+', '-', str) This works fine for English and Swedish, however it will fail for non-western scripts and remove letters from some western ones (like Norwegian and Danish with their œ and ø). Can anyone suggest a method that works with more languages? 2. Translating templates Does Django internationalization and localization work on Google App Engine? Are there any extra steps that must be performed? Is it possible to use Django i18n and l10n for Django templates while using Webapp? The Jinja2 template language provides integration with Babel. How well does this work, in your experience? What options are avilable for your chosen template language? 3. Translated datastore content When serving content from (or storing it to) the datastore: Is there a better way than getting the *accept_language* parameter from the HTTP request and matching this with a language property that you have set with each entity?

    Read the article

  • Not all TFS Build type files are getting copied

    - by k4k4sh1
    Because I have several builds sharing some assemblies containing common build tasks, I have one TFSBuild.proj for all builds and import different targets depending on the build, like the following: <Project DefaultTargets="DesktopBuild" xmlns="http://schemas.microsoft.com/developer/msbuild/2003" ToolsVersion="3.5"> <Import Project="Build_1.targets" Condition="'$(BuildDefinition)'=='Build_1'" /> <Import Project="Build_2.targets" Condition="'$(BuildDefinition)'=='Build_2'" /> <Import Project="Build_3.targets" Condition="'$(BuildDefinition)'=='Build_3'" /> </Project> Each target for a particular build has your usual content for a build type file, but in my case, I also reference some tasks inside assemblies checked into the same folder as TFSBuild.proj in source control. I wanted to add folders to contain some test build targets, since my folder was getting a bit full and cluttered. The following illustrates what I mean. $(TFS project)\build\ TFSBuild.proj Build_1.targets ... Assembly1.dll Assembly2.dll ... Folder\ Test_target_1.targets .... When I stated my build, however, I found that Test_target_1.targets and other files in Folder were not being copied to the build directory, while TFSBuild.proj and other files in the root level, as it were, of the build type folder were being copied. This caused my test build to not be able to reference files inside Folder, causing my build to immediately fail. I realize the simplest work-around would be to get rid of Folder and move all of its contents up to the build folder, but I would really like to have Folder if at all possible. Thanks for your help in advance.

    Read the article

  • mySQL need to merge fields and get unique rows

    - by jiudev
    i have a database with +1 million rows and the stuktur looks like: CREATE TABLE IF NOT EXISTS `Performance` ( `id` int(11) NOT NULL AUTO_INCREMENT, `CIDs` varchar(100) DEFAULT NULL, `COLOR` varchar(100) DEFAULT NULL, `Name` varchar(255) DEFAULT NULL, `XT` bigint(16) DEFAULT NULL, `MP` varchar(100) DEFAULT NULL, PRIMARY KEY (`id`), KEY `CIDs` (`CIDs`), KEY `COLOR` (`COLOR`), KEY `Name` (`Name`), KEY `XT` (`XT`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8 AUTO_INCREMENT=0 ; insert into `Performance` (`id`, `CIDs`, `COLOR`, `Name`, `XT`, `MP`) VALUES (1, '1253374160', 'test test test test test', 'Load1', '89421331221', ''), (2, '1271672029', NULL, 'Load1', '19421331221', NULL), (3, '1188959688', NULL, 'Load2', '39421331221', NULL), (4, '1271672029', NULL, 'Load3', '49421341221', 'Description'), (5, '1271888888', NULL, 'Load4', '59421331221', 'Description'); The Output should look like: +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ | id | CIDs | COLOR | XT | MP | Name | PIDs | unqName | +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ | 1 | 1253374160 | test test test test test | 89421331221 | | Load1 | 1,2 | Load1 | | 3 | 1188959688 | NULL | 39421331221 | NULL | Load2 | 3 | Load2 | | 4 | 1271672029 | NULL | 49421341221 | Description | Load3 | 4,5 | Load3 | +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ any ideas, how i could do this as fast as possible? I have tried with some group by, but it takes some Minutes :/ Thanks Advance //edit: for the solution with the group by, i needed 4 subquerys :/ //edit2: as requested: select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(Name,id) as unqName from ( select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(MP,id) as unqMP from ( select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(XT,id) as unqXT from ( select id, CIDs, COLOR, XT, MP, Name, GROUP_CONCAT(DISTINCT id) as PIDs, IFNULL(COLOR,id) as unqCOLOR from Performance group by unqCOLOR ) m group by unqXT ) x group by unqMP ) y group by unqName

    Read the article

  • Rails: Ajax: Changes Onload

    - by Jay Godse
    Hi. I have a web layout of a for that looks something like this <html> <head> </head> <body> <div id="posts"> <div id="post1" class="post" > <!--stuff 1--> </div> <div id="post2" class="post" > <!--stuff 1--> </div> <!-- 96 more posts --> <div id="post99" class="post" > <!--stuff 1--> </div> </div> </body> </html> I would like to be able to load and render the page with a blank , and then have a function called when the page is loaded which goes in and load up the posts and updates the page dynamically. In Rails, I tried using "link_to_remote" to update with all of the elements. I also tweaked the posts controller to render the collection of posts if it was an ajax request (request.xhr?). It worked fine and very fast. However the update of the blank div is triggered by clicking the link. I would like the same action to happen when the page is loaded so that I don't have to put in a link. Is there a Rails Ajax helper or RJS function or something in Rails that I could use to trigger the loading of the "posts" after the page has loaded and rendered (without the posts)? (If putsch comes to shove, I will just copy the generated JS code from the link_to_remote call and have it called from the onload handler on the body).

    Read the article

  • In a digital photo, how can I detect if a mountain is obscured by clouds?

    - by Gavin Brock
    The problem I have a collection of digital photos of a mountain in Japan. However the mountain is often obscured by clouds or fog. What techniques can I use to detect that the mountain is visible in the image? I am currently using Perl with the Imager module, but open to alternatives. All the images are taken from the exact same position - these are some samples. My naïve solution I started by taking several horizontal pixel samples of the mountain cone and comparing the brightness values to other samples from the sky. This worked well for differentiating good image 1 and bad image 2. However in the autumn it snowed and the mountain became brighter than the sky, like image 3, and my simple brightness test started to fail. Image 4 is an example of an edge case. I would classify this as a good image since some of the mountain is clearly visible. UPDATE 1 Thank you for the suggestions - I am happy you all vastly over-estimated my competence. Based on the answers, I have started trying the ImageMagick edge-detect transform, which gives me a much simpler image to analyze. convert sample.jpg -edge 1 edge.jpg I assume I should use some kind of masking to get rid of the trees and most of the clouds. Once I have the masked image, what is the best way to compare the similarity to a 'good' image? I guess the "compare" command suited for this job? How do I get a numeric 'similarity' value from this?

    Read the article

  • WCF: How can I send data while gracefully closing a connection?

    - by mafutrct
    I've got a WCF service that offers a Login method. A client is required to call this method (due to it being the only IsInitiating=true). This method should return a string that describes the success of the call in any case. If the login failed, the connection should be closed. The issue is with the timing of the close. I'd like to send the return value, then immediately close the connection. string Login (string name, string pass) { if (name != pass) { OperationContext.Current.Channel.Close (); return "fail"; } else { return "yay"; } } The MSDN states that calling Close on the channel causes an ICommunicationObject to gracefully transition from the Opened state to the Closed state. The Close method allows any unfinished work to be completed before returning. For example, finish sending any buffered messages). This did not work for me (or my understanding is wrong), as the close is executed immediately - WCF does not wait for the Login method to finish executing and return a string but closes the connection earlier. Therefore I assume that calling Close does not wait for the running method to finish. Now, how can I still return a value, then close?

    Read the article

< Previous Page | 311 312 313 314 315 316 317 318 319 320 321 322  | Next Page >