Search Results

Search found 10033 results on 402 pages for 'execution speed'.

Page 324/402 | < Previous Page | 320 321 322 323 324 325 326 327 328 329 330 331  | Next Page >

  • SQL Server CLR stored procedures in data processing tasks - good or evil?

    - by Gart
    In short - is it a good design solution to implement most of the business logic in CLR stored procedures? I have read much about them recently but I can't figure out when they should be used, what are the best practices, are they good enough or not. For example, my business application needs to parse a large fixed-length text file, extract some numbers from each line in the file, according to these numbers apply some complex business rules (involving regex matching, pattern matching against data from many tables in the database and such), and as a result of this calculation update records in the database. There is also a GUI for the user to select the file, view the results, etc. This application seems to be a good candidate to implement the classic 3-tier architecture: the Data Layer, the Logic Layer, and the GUI layer. The Data Layer would access the database The Logic Layer would run as a WCF service and implement the business rules, interacting with the Data Layer The GUI Layer would be a means of communication between the Logic Layer and the User. Now, thinking of this design, I can see that most of the business rules may be implemented in a SQL CLR and stored in SQL Server. I might store all my raw data in the database, run the processing there, and get the results. I see some advantages and disadvantages of this solution: Pros: The business logic runs close to the data, meaning less network traffic. Process all data at once, possibly utilizing parallelizm and optimal execution plan. Cons: Scattering of the business logic: some part is here, some part is there. Questionable design solution, may encounter unknown problems. Difficult to implement a progress indicator for the processing task. I would like to hear all your opinions about SQL CLR. Does anybody use it in production? Are there any problems with such design? Is it a good thing?

    Read the article

  • EF 4.0 : Save Changes Retry Logic

    - by BGR
    Hi, I would like to implement an application wide retry system for all entity SaveChanges method calls. Technologies: Entity framework 4.0 .Net 4.0 namespace Sample.Data.Store.Entities { public partial class StoreDB { public override int SaveChanges(System.Data.Objects.SaveOptions options) { for (Int32 attempt = 1; ; ) { try { return base.SaveChanges(options); } catch (SqlException sqlException) { // Increment Trys attempt++; // Find Maximum Trys Int32 maxRetryCount = 5; // Throw Error if we have reach the maximum number of retries if (attempt == maxRetryCount) throw; // Determine if we should retry or abort. if (!RetryLitmus(sqlException)) throw; else Thread.Sleep(ConnectionRetryWaitSeconds(attempt)); } } } static Int32 ConnectionRetryWaitSeconds(Int32 attempt) { Int32 connectionRetryWaitSeconds = 2000; // Backoff Throttling connectionRetryWaitSeconds = connectionRetryWaitSeconds * (Int32)Math.Pow(2, attempt); return (connectionRetryWaitSeconds); } /// <summary> /// Determine from the exception if the execution /// of the connection should Be attempted again /// </summary> /// <param name="exception">Generic Exception</param> /// <returns>True if a a retry is needed, false if not</returns> static Boolean RetryLitmus(SqlException sqlException) { switch (sqlException.Number) { // The service has encountered an error // processing your request. Please try again. // Error code %d. case 40197: // The service is currently busy. Retry // the request after 10 seconds. Code: %d. case 40501: //A transport-level error has occurred when // receiving results from the server. (provider: // TCP Provider, error: 0 - An established connection // was aborted by the software in your host machine.) case 10053: return (true); } return (false); } } } The problem: How can I run the StoreDB.SaveChanges to retry on a new DB context after an error occured? Something simular to Detach/Attach might come in handy. Thanks in advance! Bart

    Read the article

  • singleton pattern in Windows Activation Service

    - by Joshua
    Hello I have a few WCF services that are currently being self hosted, in a very basic NT Service. I want to expand my application to add provisioning of WCF Services, and updates, as well as isolation (I want each WCF Service to be in its own AppDomain). These WCF Services contain logic that needs to be run on a regular basis, pinging the database, and getting information from external devices so that when a request comes in the data is readily available. I'm thinking about trying out Windows Activation Service, because i really like the provisioning, and isolation that comes with a managed services infrastructure. If I didn't use WAS I would essentially have to write the same code myself. From what I understand though WAS does not really support the model of having a service that is running before someone actually calls a method on the service. the article I read here MSDN Article Link states "That means in essence that out-of-the-box WAS hosting is not something that is really suited for sessionful or singleton services. It is more suitable for stateless per-call services." it does say that "Out of the box" so I'm wondering if anyone has used WAS to host a WCF service that really behaves more like an NT Service (starting and stopping independantly of having a method called upon it). Or any other ideas would be great. I was planning on writting this infrastructure myself, to host WCF services in a custom ServiceHost, and put their execution in a seporate AppDomain, as well as allow for provision of these services after initial installation, along with updates. However, I would MUCH MUCH MUCH rather not own that code if I don't have to. thanks Joshua

    Read the article

  • How to reliably send a request cross domain and cross browser on page unload

    - by Agmin
    I have javascript code that's loaded by 3rd parties. The javascript keeps track of a number of metrics, and when a user exits the page I'd like to send the metrics back to my server. Due to XSS checks in some browsers, like IE, I cannot do a simple jquery.ajax() call. Instead, I'm appending an image src to the page with jquery. Here's the code, cased by browser: function record_metrics() { //Arbitrary code execution here to set test_url $esajquery('#MainDiv').append("<img src='" + test_url + "' />"); } if ($esajquery.browser.msie) { window.onbeforeunload = function() { record_metrics(); } } else { $esajquery(window).unload( function(){ record_metrics(); } ); } FF aborts the request to "test_url" if I use window.onbeforeunload, and IE8 doesn't work with jquery's unload(). IE8 also fails to work if the arbitrary test_url setting code is too long, although IE8 seems to work fine if the is immediately appended to the DOM. Is there a better way to solve this issue? Unfortunately this really needs to execute when a user leaves the page.

    Read the article

  • Locking a table for getting MAX in LINQ

    - by Hossein Margani
    Hi Every one! I have a query in LINQ, I want to get MAX of Code of my table and increase it and insert new record with new Code. just like the IDENTITY feature of SQL Server, but here my Code column is char(5) where can be alphabets and numeric. My problem is when inserting a new row, two concurrent processes get max and insert an equal Code to the record. my command is: var maxCode = db.Customers.Select(c=>c.Code).Max(); var anotherCustomer = db.Customers.Where(...).SingleOrDefault(); anotherCustomer.Code = GenerateNextCode(maxCode); db.SubmitChanges(); I ran this command cross 1000 threads and each updating 200 customers, and used a Transaction with IsolationLevel.Serializable, after two or three execution an error occured: using (var db = new DBModelDataContext()) { DbTransaction tran = null; try { db.Connection.Open(); tran = db.Connection.BeginTransaction(IsolationLevel.Serializable); db.Transaction = tran; . . . . tran.Commit(); } catch { tran.Rollback(); } finally { db.Connection.Close(); } } error: Transaction (Process ID 60) was deadlocked on lock resources with another process and has been chosen as the deadlock victim. Rerun the transaction. other IsolationLevels generates this error: Row not found or changed. Please help me, thank you.

    Read the article

  • Unhandled Exception with c++ app on Visual Studio 2008 release build - occurs when returning from fu

    - by Rich
    Hi, I have a (rather large) application that I have written in C++ and until recently it has been running fine outside of visual studio from the release build. However, now, whenever I run it it says "Unhandled exception at 0x77cf205b in myprog.exe: 0xC0000005: Access violation writing location 0x45000200.", and leads me to "crtexe.c" at line 582 ("mainret = main(argc, argv, envp);") if I attempt to debug it. Note that this problem never shows if I run my debug executable outside of visual studio, or if I run my debug or release build within visual studio. It only happens when running the release build outside of visual studio. I have been through and put plenty of printfs and a couple of while(1)s in it to see when it actually crashed, and found that the access violation occurs at exactly the point that the value is returned from the function (I'm returning a pointer to an object). I don't fully understand why I would get an access violation at the point it returns, and it doesn't seem to matter what I'm returning as it still occurs when I return 0. The point it started crashing was when I added a function which does a lot of reading from a file using ifstream. I am opening the stream every time I attempt to read a new file and close it when I finish reading it. If I keep attempting to run it, it will run once in about 20 tries. It seems a lot more reliable if I run it off my pen drive (it seems to crash the first 3 or 4 times then run fine after that - maybe it's due to its slower read speed). Thanks for your help, and if I've missed anything let me know.

    Read the article

  • Change made in the Converter will notify the change in the bound property?

    - by Kishore Kumar
    I have two property FirstName and LastName and bound to a textblock using Multibinidng and converter to display the FullName as FirstName + Last Name. FirstName="Kishore" LastName="Kumar" In the Converter I changed the LastName as "Changed Text" values[1] = "Changed Text"; After executing the Converter my TextBlock will show "Kishore Changed Text" but Dependency property LastName is still have the last value "Kumar". Why I am not getting the "Changed Text" value in the LastName property after the execution?. Will the change made at converter will notify the bound property? <Window.Resources> <local:NameConverter x:Key="NameConverter"></local:NameConverter> </Window.Resources> <Grid> <TextBlock> <TextBlock.Text> <MultiBinding Converter="{StaticResource NameConverter}"> <Binding Path="FirstName"></Binding> <Binding Path="LastName"></Binding> </MultiBinding> </TextBlock.Text> </TextBlock> </Grid> Converter: public class NameConverter:IMultiValueConverter { #region IMultiValueConverter Members public object Convert(object[] values, Type targetType, object parameter, System.Globalization.CultureInfo culture) { values[1] = "Changed Text"; return values[0].ToString() + " " + values[1].ToString(); } public object[] ConvertBack(object value, Type[] targetTypes, object parameter, System.Globalization.CultureInfo culture) { throw new NotImplementedException(); } #endregion }

    Read the article

  • Alternative native api for Process.Start

    - by Akash Kava
    Ok this is not duplicate of "http://stackoverflow.com/questions/2065592/alternative-to-process-start" because my question is something different here. I need to run a process and wait till execution of process and get the output of console. There is way to set RedirectStandardOutput and RedirectStandardError to true, however this does not function well on some machines, (where .NET SDK is not installed), only .NET runtime is installed, now it works on some machines and doesnt work on some machines so we dont know where is the problem. I have following code, ProcessStartInfo info = new ProcessStartInfo("myapp.exe", cmd); info.CreateNoWindow = true; info.UseShellExecute = false; info.RedirectStandardError = true; info.RedirectStandardOutput = true; Process p = Process.Start(info); p.WaitForExit(); Trace.WriteLine(p.StandardOutput.ReadToEnd()); Trace.WriteLine(p.StandardError.ReadToEnd()); On some machines, this will hang forever on p.WaitForExit(), and one some machine it works correctly, the behaviour is so random and there is no clue. Now if I can get a real good workaround for this using pinvoke, I will be very happy.

    Read the article

  • Maven GAE Plugin - Unable to run gae:debug

    - by Taylor L
    I'm having trouble running the gae:debug goal of the Maven GAE Plugin. The error I'm receiving is below. Any ideas? I'm running it with "mvn gae:debug". [INFO] Packaging webapp [INFO] Assembling webapp[test-gae] in [C:\development\test-gae\target\test-gae-0.0.1-SNAPSHOT] [INFO] Processing war project [INFO] Webapp assembled in[56 msecs] [INFO] Building war: C:\development\test-gae\target\test-gae-0.0.1-SNAPSHOT.war [INFO] [statemgmt:end-fork] [INFO] Ending forked execution [fork id: -2101914270] [INFO] [gae:debug] Usage: <dev-appserver> [options] <war directory> Options: --help, -h Show this help message and exit. --server=SERVER The server to use to determine the latest -s SERVER SDK version. --address=ADDRESS The address of the interface on the local machine -a ADDRESS to bind to (or 0.0.0.0 for all interfaces). --port=PORT The port number to bind to on the local machine. -p PORT --sdk_root=root Overrides where the SDK is located. --disable_update_check Disable the check for newer SDK versions. EDIT: gae:run with the jvmFlags option is also giving me the same result with the below configuration. <plugin> <groupId>net.kindleit</groupId> <artifactId>maven-gae-plugin</artifactId> <version>0.5.0</version> <configuration> <jvmFlags> <jvmFlag>-Xdebug</jvmFlag> <jvmFlag>-Xrunjdwp:transport=dt_socket,server=y,suspend=n,address=8000</jvmFlag> </jvmFlags> </configuration> </plugin>

    Read the article

  • Problem in creating win installer in i

    - by user356108
    Hi Everyone, I am trying to create an executable file (.exe) of iReport with my module included in it. While I run the target the create-iReport-distro-win-installer, I am getting the following error. Note: I am using netbeans 6.5.1 java.io.IOException: Cannot run program "makensis" (in directory "C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src"): CreateProcess error=2, The system cannot find the file specified at java.lang.ProcessBuilder.start(ProcessBuilder.java:459) at java.lang.Runtime.exec(Runtime.java:593) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.tools.ant.taskdefs.Execute$Java13CommandLauncher.exec(Execute.java:832) at org.apache.tools.ant.taskdefs.Execute.launch(Execute.java:447) at org.apache.tools.ant.taskdefs.Execute.execute(Execute.java:461) at net.sf.nsisant.Task.execute(Task.java:205) at org.apache.tools.ant.UnknownElement.execute(UnknownElement.java:288) at sun.reflect.GeneratedMethodAccessor97.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.tools.ant.dispatch.DispatchUtils.execute(DispatchUtils.java:106) at org.apache.tools.ant.Task.perform(Task.java:348) at org.apache.tools.ant.Target.execute(Target.java:357) at org.apache.tools.ant.Target.performTasks(Target.java:385) at org.apache.tools.ant.Project.executeSortedTargets(Project.java:1337) at org.apache.tools.ant.Project.executeTarget(Project.java:1306) at org.apache.tools.ant.helper.DefaultExecutor.executeTargets(DefaultExecutor.java:41) at org.apache.tools.ant.Project.executeTargets(Project.java:1189) at org.apache.tools.ant.module.bridge.impl.BridgeImpl.run(BridgeImpl.java:273) at org.apache.tools.ant.module.run.TargetExecutor.run(TargetExecutor.java:499) at org.netbeans.core.execution.RunClassThread.run(RunClassThread.java:151) Caused by: java.io.IOException: CreateProcess error=2, The system cannot find the file specified at java.lang.ProcessImpl.create(Native Method) at java.lang.ProcessImpl.<init>(ProcessImpl.java:81) at java.lang.ProcessImpl.start(ProcessImpl.java:30) at java.lang.ProcessBuilder.start(ProcessBuilder.java:452) ... 24 more C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src\build.xml:327: Command failed: 'makensis /DPRODUCT_VERSION=3.7.2 /DPRODUCT_NAME=iReport /DPRODUCT_WEB_SITE=http://ireport.sourceforge.net "C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src\etc\iReportInstaller.nsi"' BUILD FAILED (total time: 1 minute 22 seconds)

    Read the article

  • What strategy do you use to sync your code when working from home

    - by Ben Daniel
    At my work I currently have my development environment inside a Virtual Machine. When I need to do work from home I copy my VM and any databases I need onto a laptop drive sized external USB drive. After about 10 minutes of copying I put the drive in my pocket and head home, copy back the VM and databases onto my personal computer and I'm ready to work. I follow the same steps to take the work back with me. So if I count the total amount of time I spend waiting around for files to finish copying in order for me to take work home and bring it back again, it comes to around 40 minutes! I do have a VPN connection to my work from home (providing the internet is up at both sites) and a decent internet speed (8mbits down/?up) but I find Remote Desktoping into my work machine laggy enough for me to want to work on my VM directly. So in looking at what other options I have or how I could improve my existing option I'm interested in what strategy you use or recommend to do work at home and keeping your code/environment in sync. EDIT: I'd prefer an option where I don't have to commit my changes into version control before I leave work - as I like to make meaningful descriptive comments in my commits, committing would take longer than just copying my VM onto a portable drive! lol Also I'd prefer a solution where my dev environment stays in sync too. Having said that I'm still very interested in your own solutions even if they don't exactly solve my problem as best as I'd like. :)

    Read the article

  • Versioning SharePoint binary Workflow ASPX task forms

    - by Janis Veinbergs
    Hello. As noted by some developers, workflow versioning is somekind of headache in SharePoint. I`m wondering is there a way I can version my aspx forms? For sure, i can version code behind assemblies, but if markup changes for any of my files in LAYOUTS folder? Is there versioning available for files or do i have to choose new filename for my form? Sorry, i should have been more specific. Yes, i have files under version control (i can restore previous versions etc), but i`m not talking about this kind of version control. But by deploying new Workflow Version, i must not delete old one, because it is still running on many items in SharePoint, but rather , as noted in previous links, deploy new one so i don't break execution of workflows. But workflows will still break if i don't preserve old aspx forms used by users to interact with workflows. So i must ensure that Assemblies with old version numbers used by old workflow exists (this one is ok, i just changed assembly version number and deployed to GAC) I must ensure that old workflow still uses old aspx form used users to interact with workflow, but new workflow version should use new aspx form with more options (how to do this?).

    Read the article

  • Is SQLDataReader slower than using the command line utility sqlcmd?

    - by Andrew
    I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

    Read the article

  • How to completely wipe a previous ClickOnce installation?

    - by Dabblernl
    I have a curious problem: My app is distributed through ClickOnce. I recently installed three new clients on a new location. They worked. After an update however, all old clients worked fine, but the three new clients did not. As my code is swallowing an exception somewhere I have been unable thusfar to pinpoint where the error lies. When I XCopy the latest version of the app to the desktop of the three new client computers the program works fine. So, I thought uninstalling and reinstalling the program from the download location should fix the problem, but it does not! I can think of two explanations: The new location has some firewall/virusscanner in place that doesn't like the latest version of my app when it is run from a standard ClickOnce directory, but it allows execution from the desktop. Some old settings (the app uses user scoped and app scoped settings) remain in effect after the uninstall. When I find and check the user.config file for the app however, I find no incorrect setttings there. Thusfar, I have been unable to reproduce the error on any other machine. How can I solve this!?

    Read the article

  • Vlad the deployer on Dreamhost - initial script

    - by xmariachi
    Hi, I'm trying to deploy an app with SVN and Vlad the deployer. Vlad and its dependencies are installed and seem OK. I'm trying the following: rake prod vlad:update Being my config/deploy.rb file: task :prod do set :application, "xxx" set :deploy_timestamped, "false" set :user, "username" set :scm_user, "scmusername" set :repository, "http://domain.com/svn/app" set :domain, "domain.com" set :deploy_to, "/home/username/deployments/app" puts "Production deployment to #{deploy_to}" end I have done "rake prod vlad:setup" already, that's fine. But when calling "rake prod vlad:update", I get the following A ...file Exported revision 14. ln: creating symbolic link `/home/username/deployments/drupalgestalt/releases/20100503164225/public/system' to `/home/username/deployments/drupalgestalt/shared/system': No such file or directory rake aborted! execution failed with status 1: ssh domain.com ln -s /home/username/deployments/app/shared/log /home/username/deployments/app/releases/20100503164225/log && ln -s /home/username/deployments/app/shared/system /home/username/deployments/app/releases/20100503164225/public/system && ln -s /home/username/deployments/app/shared/pids /home/username/deployments/app/releases/20100503164225/tmp/pids Apparently it complains when creating the ln, but permissions are all set up fine. Am I doing anything wrong? I'm just starting with Vlad on the assumption it was super-easy to set up. Had played a bit with cap in the past, and I do like Vlad idea.

    Read the article

  • SVN commit using cruise control

    - by pratap
    hi all, can any one tell how to tell svn that these files are to be deleted from repository through command line. i am using cruise control to automate the svn commit process. but the execution of svn commit command restores the files which i deleted from my working copy. the way i am doing is. 1. delete some files in my working copy.( no. of files in my WC is less than no. of files in repository) 2. execute svn command using cruise control. <exec executable="svn.exe"> <buildArgs>ci -m "test msg" --no-auth-cache --non-interactive</buildArgs> <buildTimeoutSeconds>1000</buildTimeoutSeconds> </exec> result: the deleted files are restored in my WC... Can someone help me in figuring out where i have gone wrong... or if i have to do some changes / configurations... thank u all. regards. uday

    Read the article

  • SVN commit using cruise control

    - by pratap
    hi all, i am using cruise control to automate the svn commit process. but the execution of svn commit command restores the files which i deleted from my working copy. the way i am doing is. 1. delete some files in my working copy.( no. of files in my WC is less than no. of files in repository) 2. execute svn command using cruise control. <exec executable="svn.exe"> <buildArgs>ci -m "test msg" --no-auth-cache --non-interactive</buildArgs> <buildTimeoutSeconds>1000</buildTimeoutSeconds> </exec> result: the deleted files are restored in my WC... Can someone help me in figuring out where i have gone wrong... or if i have to do some changes / configurations... thank u all. regards. uday

    Read the article

  • Is there a way in .NET to access the bytecode/IL/CLR that is currently running?

    - by Alix
    Hi. I'd like to have access to the bytecode that is currently running or about to run in order to detect certain instructions and take specific actions (depending the instructions). In short, I'd like to monitor the bytecode in order to add safety control. Is this possible? I know there are some AOP frameworks that notify you of specific events, like an access to a field or the invocation of a method, but I'd like to skip that extra layer and just look at all the bytecode myself, throughout the entire execution of the application. I've already looked at the following questions (...among many many others ;) ):     Preprocessing C# - Detecting Methods     What CLR/.NET bytecode tools exist? as well as several AOP frameworks (although not in great detail, since they don't seem to do quite what I need) and I'm familiar with Mono.Cecil. I appreciate alternative suggestions, but I don't want to introduce the overhead of an AOP framework when what I actually need is access to the bytecode, without all the stuff they add on top to make it more user-friendly (... admittedly very useful stuff when you don't want to go low-level). Thanks :)

    Read the article

  • How to temporarily replace one primitive type with another when compiling to different targets in c#

    - by Keith
    How to easily/quickly replace float's for doubles (for example) for compiling to two different targets using these two particular choices of primitive types? Discussion: I have a large amount of c# code under development that I need to compile to alternatively use float, double or decimals depending on the use case of the target assembly. Using something like “class MYNumber : Double” so that it is only necessary to change one line of code does not work as Double is sealed, and obviously there is no #define in C#. Peppering the code with #if #else statements is also not an option, there is just too much supporting Math operators/related code using these particular primitive types. I am at a loss on how to do this apparently simple task, thanks! Edit: Just a quick comment in relation to boxing mentioned in Kyles reply: Unfortunately I need to avoid boxing, mainly since float's are being chosen when maximum speed is required, and decimals when maximum accuracy is the priority (and taking the 20x+ performance hit is acceptable). Boxing would probably rules out decimals as a valid choice and defeat the purpose somewhat. Edit2: For reference, those suggesting generics as a possible answer to this question note that there are many issues which count generics out (at least for our needs). For an overview and further references see Using generics for calculations

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Far jump in ntdll.dll's internal ZwCreateUserProcess

    - by user49164
    I'm trying to understand how the Windows API creates processes so I can create a program to determine where invalid exes fail. I have a program that calls kernel32.CreateProcessA. Following along in OllyDbg, this calls kernel32.CreateProcessInternalA, which calls kernel32.CreateProcessInternalW, which calls ntdll.ZwCreateUserProcess. This function goes: mov eax, 0xAA xor ecx, ecx lea edx, dword ptr [esp+4] call dword ptr fs:[0xC0] add esp, 4 retn 0x2C So I follow the call to fs:[0xC0], which contains a single instruction: jmp far 0x33:0x74BE271E But when I step this instruction, Olly just comes back to ntdll.ZwCreateUserProcess at the add esp, 4 right after the call (which is not at 0x74BE271E). I put a breakpoint at retn 0x2C, and I find that the new process was somehow created during the execution of add esp, 4. So I'm assuming there's some magic involved in the far jump. I tried to change the CS register to 0x33 and EIP to 0x74BE271E instead of actually executing the far jump, but that just gave me an access violation after a few instructions. What's going on here? I need to be able to delve deeper beyond the abstraction of this ZwCreateUserProcess to figure out how exactly Windows creates processes.

    Read the article

  • Forking in PHP on Windows

    - by Doug Kavendek
    We are running PHP on a Windows server (a source of many problems indeed, but migrating is not an option currently). There are a few points where a user-initiated action will need to kick off a few things that take a while and about which the user doesn't need to know if they succeed or fail, such as sending off an email or making sure some third-party accounts are updated. If I could just fork with pcntl_fork(), this would be very simple, but the PCNTL functions are not available in Windows. It seems the closest I can get is to do something of this nature: exec( 'php-cgi.exe somescript.php' ); However, this would be far more complicated. The actions I need to kick off rely on a lot of context that already will exist in the running process; to use the above example, I'd need to figure out the essential data and supply it to the new script in some way. If I could fork, it'd just be a matter of letting the parent process return early, leaving the child to work on a few more things. I've found a few people talking about their own work in getting various PCNTL functions compiled on Windows, but none seemed to have anything available (broken links, etc). Despite this question having practically the same name as mine, it seems the problem was more execution timeout than needing to fork. So, is my best option to just refactor a bit to deal with calling php-cgi, or are there other options? Edit: It seems exec() won't work for this, at least not without me figuring some other aspect of it, as it waits until the call returns. I figured I could use START, sort of like exec( 'start php-cgi.exe somescript.php' );, but it still waits until the other script finishes.

    Read the article

  • PHP set timeout for script with system call, set_time_limit not working

    - by tehalive
    I have a command-line PHP script that runs a wget request using each member of an array with foreach. This wget request can sometimes take a long time so I want to be able to set a timeout for killing the script if it goes past 15 seconds for example. I have PHP safemode disabled and tried set_time_limit(15) early in the script, however it continues indefinitely. Update: Thanks to Dor for pointing out this is because set_time_limit() does not respect system() calls. So I was trying to find other ways to kill the script after 15 seconds of execution. However, I'm not sure if it's possible to check the time a script has been running while it's in the middle of a wget request at the same time (a do while loop did not work). Maybe fork a process with a timer and set it to kill the parent after a set amount of time? Thanks for any tips! Update: Below is my relevant code. $url is passed from the command-line and is an array of multiple URLs (sorry for not posting this initially): foreach( $url as $key => $value){ $wget = "wget -r -H -nd -l 999 $value"; system($wget); }

    Read the article

  • Flush separate Castle ActiveRecord Transaction, and refresh object in another Transaction

    - by eanticev
    I've got all of my ASP.NET requests wrapped in a Session and a Transaction that gets commited only at the very end of the request. At some point during execution of the request, I would like to insert an object and make it visible to other potential threads - i.e. split the insertion into a new transaction, commit that transaction, and move on. The reason is that the request in question hits an API that then chain hits another one of my pages (near-synchronously) to let me know that it processed, and thus double submits a transaction record, because the original request had not yet finished, and thus not committed the transaction record. So I've tried wrapping the insertion code with a new SessionScope, TransactionScope(TransactionMode.New), combination of both, flushing everything manually, etc. However, when I call Refresh on the object I'm still getting the old object state. Here's some code sample for what I'm seeing: Post outsidePost = Post.Find(id); // status of this post is Status.Old using (TransactionScope transaction = new TransactionScope(TransactionMode.New)) { Post p = Post.Find(id); p.Status = Status.New; // new status set here p.Update(); SessionScope.Current.Flush(); transaction.Flush(); transaction.VoteCommit(); } outsidePost.Refresh(); // refresh doesn't get the new status, status is still Status.Old Any suggestions, ideas, and comments are appreciated!

    Read the article

  • count on LINQ union

    - by brechtvhb
    I'm having this link statement: List<UserGroup> domains = UserRepository.Instance.UserIsAdminOf(currentUser.User_ID); query = (from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentFrom equals uug.User_ID where domains.Contains(uug.UserGroup) select doc) .Union(from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentTo equals uug.User_ID where domains.Contains(uug.UserGroup) select doc); Running this statement doesn't cause any problems. But when I want to count the resultset the query suddenly runs quite slow. totalRecords = query.Count(); The result of this query is : SELECT COUNT([t5].[DocumentID]) FROM ( SELECT [t4].[DocumentID], [t4].[DocumentFrom], [t4].[DocumentTo] FROM ( SELECT [t0].[DocumentID], [t0].[DocumentFrom], [t0].[DocumentTo FROM [dbo].[Document] AS [t0] INNER JOIN [dbo].[User_UserGroup] AS [t1] ON [t0].[DocumentFrom] = [t1].[User_ID] WHERE ([t1].[UserGroupID] = 2) OR ([t1].[UserGroupID] = 3) OR ([t1].[UserGroupID] = 6) UNION SELECT [t2].[DocumentID], [t2].[DocumentFrom], [t2].[DocumentTo] FROM [dbo].[Document] AS [t2] INNER JOIN [dbo].[User_UserGroup] AS [t3] ON [t2].[DocumentTo] = [t3].[User_ID] WHERE ([t3].[UserGroupID] = 2) OR ([t3].[UserGroupID] = 3) OR ([t3].[UserGroupID] = 6) ) AS [t4] ) AS [t5] Can anyone help me to improve the speed of the count query? Thanks in advance!

    Read the article

< Previous Page | 320 321 322 323 324 325 326 327 328 329 330 331  | Next Page >