Search Results

Search found 13605 results on 545 pages for 'mail header'.

Page 336/545 | < Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >

  • VMware postfix server drops connection

    - by nicoX
    Our physical server godzilla forwards mails to our virtuall VMware server b4. They are on the same net. Often connection drops, we can't ping godzilla with our b4. That means mails from godzilla won't reach b4 and the mails will be in handed into the mailq. Sometimes it takes some hours and the issue will auto fix itself, b4 will wake up and the mail will be delivered. Another thing if we remotely ssh into the b4, the b4 will wake up and and receive any mailq mails from godzilla and deliver them. netadmin@b4:/var/log$ arp -a ? (192.168.209.80) at 00:1E:C9:AE:79:9D [ether] on eth0 root@godzilla:/usr/local/bin# arp -a ? (192.168.209.20) at 00:50:56:91:7d:b2 [ether] on eth0

    Read the article

  • Sendmail Undeliverable Redirection?

    - by Dizzle
    Good afternoon; I don't know much about sendmail, so this may be fairly easy for those of you more experienced with it. We have an account, "[email protected]", sending reports to various groups. From time to time an undeliverable message will be sent back to "[email protected]". We'd like for those undeliverable messages to be rerouted, or bounced, from "[email protected]" to a group of our choosing. To carve out a scenario for clarity: [email protected] sends a report to [email protected] and [email protected] [email protected] has someone who's mail account no longer exists, triggering an undeliverable message being sent back to [email protected] Rather than having the undeliverable message sit in [email protected]'s Inbox, we'd like for it to be automatically rerouted/bounced to an admin group, [email protected] So I guess a "rule" of sorts. I've come across this solution: Sendmail : ignore local delivery But I don't know enough about sendmail to know if this is what will fit this situation. Any help is greatly appreciated.

    Read the article

  • Very slow accessing printer shared from Windows Machine

    - by Tarski
    How do I go about debugging a networking problem where the office printer is shared off a Windows XP PC and is very slow from me to access? Print/changing any settings can take several minutes and applications often display "Not Responding" in this time. My machine is a Windows Vista PC. The other PCs in the office are either Vista or XP and do not suffer from any printing problems. I am not experiencing any other network related problems, I can access the web and e-mail fine. The printer is a HP officejet Pro 8000

    Read the article

  • PHP MAMP email stopped sending

    - by Kyle Parisi
    I'm working on a simple registration email. I'm using MAMP (free) with PHP. I was getting emails from my code before. Now I get nothing. Here is a test code that doesn't send the email either. <?php $to = "[email protected]"; $subject = "Hi!"; $body = "Hi,\n\nHow are you?"; if (mail($to, $subject, $body)) { echo("<p>Message successfully sent!</p>"); } else { echo("<p>Message delivery failed...</p>"); } ?> What might have changed? I read that perhaps my ISP blocked sending emails? How do I find out?

    Read the article

  • How do I show the 'blog last updated' time in Wordpress?

    - by detj
    I want to show the time of the last blog update at the header of my wordpress blog. It's not the last update time of a post but rather any post or page (i.e. any last update done in the blog) e.g. Format: Tuesday, March 16, 2010 Last Update: 6:09 PM ET Is there any template tag to accomplish this?

    Read the article

  • C++ snippet support in visual studio?

    - by Jeremy Bell
    I'm writing code in native C++ (not C++/CLR). I know that there is no built-in support for C++ with regards to the snippet manager and snipper picker interfaces, however I found a utility called "snippy" which supposedly can generate C++ snippets. Here is a c++ snippet that the program generated: <?xml version="1.0" encoding="utf-8"?> <CodeSnippets xmlns="http://schemas.microsoft.com/VisualStudio/2005/CodeSnippet"> <CodeSnippet Format="1.0.0"> <Header> <Title>MySnippet</Title> <Shortcut>MySnippet</Shortcut> <Description>Just a test snippet</Description> <Author>Me</Author> <SnippetTypes> <SnippetType>Expansion</SnippetType> </SnippetTypes> </Header> <Snippet> <Declarations> <Literal Editable="true"> <ID>literal1</ID> <ToolTip>just a placeholder</ToolTip> <Default> </Default> <Function> </Function> </Literal> </Declarations> <Code Language="cpp"><![CDATA[cout << "$literal1$" << std::endl;]]></Code> </Snippet> </CodeSnippet> </CodeSnippets> If there is support in visual C++, even in a limited capacity, for C++ snippets, how do I add them to my environment, and what are the limitations? All I need is support for basic expansion snippets that I can invoke by typing a shortcut and hitting tab, and which supports basic literals that I can tab through (basically, if it supports the above snippet, I'm good). If this can't be done, are there any free add-ons or extensions to visual studio that support snippets for C++? I'm using both visual studio 2010 and 2008, but I mostly write code in 2010 right now.

    Read the article

  • HTTP, HTTPS and FTP is not working but SMTP and IMAP are working.

    - by nWorx
    Yesterday on a computer of a friend a strange thing happened. after booting the ports fo http, https and ftp are closed but e-mail is still working. in the control panel the windows firewall seems active even if he tries to deactivate it. I have a suspision that it is the faul of norton internet security 2010, we have tried to uninstall it, but the uninstallation did not work. when using the removal tool from symantec it just goes to 23% and then it crashes. the process ccSvcHst.exe is still running. How can I safely remove the rest of Norton Internet Security? Edit: Norton Internet Security 2010 is sucesfully removed, but still no connectivity...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • JSON object array to store data of a form in local storage temporary (PhoneGap project)

    - by Nadeesha
    I am building a data aqusition system using PhoneGap. .I am trying to store my form data temporary on local storage using JSON,Data should be visible after I close and reopen the application (after pressing Get Data button),But after I close it only the lastly entered record is visible This is my code <!DOCTYPE html> <html> <head> <title>Household Profile DB storage</title> <meta charset="utf-8"> <meta name="viewport" content="user-scalable=no, initial-scale=1, maximum-scale=1, minimum-scale=1,width=device-width" /> <link rel="stylesheet" href="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.css"> <link rel="stylesheet" href="css/table.css"> <script type="text/javascript" src="js/jquery-1.9.1.min.js"></script> <script type="text/javascript" src="jquery.mobile-1.4.2/jquery.mobile-1.4.2.min.js"></script> <script type="text/javascript" src="js/iscroll.js"></script> <script type="text/javascript" charset="utf-8"> function onDeviceReady() { persistData(homeId,owner,gramaND,contactNo,address,race); } function saveLocal(form){ if (window.localStorage) { var fhomeId = form.homeId.value, fowner = form.owner.value, fgramaND = form.gramaND.value, fcontactNo= form.contactNo.value, faddress = form.address.value, frace = form.race.value; alert("hi"); var highscores = [{"homeId": fhomeId, "owner":fowner, "gramaND":fgramaND, "contactNo":fcontactNo, "address":faddress, "race":frace}]; localStorage.setItem("highscores",JSON.stringify(highscores)); alert("The data has been stored successfully."); } else { alert("Your Browser does not support LocalStorage."); } } function readLocal(){ if (window.localStorage) { var scores =[]; //Get the highscores object scores = localStorage.getItem("highscores"); scores = JSON.parse(scores); for (i=0;i<scores.length;i++){ var text = "homeId :"+scores[i].homeId +"<br>"+ "owner:"+ scores[i].owner+"<br>"+ "address"+scores[i].address +"<br>"+ "gramaND"+scores[i].gramaND +"<br>"+ "contactNo"+scores[i].contactNo+"<br>" + '<Button value="DELETE" onclick="'+scores.splice(i, 0)+'><>/Button>'; var tbodyx = document.getElementsByTagName("tbody"); var tr=document.createElement("TR"); var td=document.createElement("TD"); td.innerHTML = text; tr.appendChild(td); tbody.appendChild(tr); } } } </script> </head> <body> <div data-role="page" id="page1"> <!--/header--> <div data-role="header" data-position="inline" data-theme="b"> <a href="#" data-icon="back" data-rel="back" title="Go back">Back</a> <h1>Household Profile</h1> <a href="index.html" data-icon="home">Menu</a> </div> <!--/header--> <div id="wrapper"> <form id="userInput" action ="" method="GET"> <div data-role="content"> <div data-role="fieldcontain"> <label > Home ID </label> <input class="inputClass" id="homeId" placeholder="H0001" value="" data-mini="true" type="text"> </div> <div data-role="fieldcontain"> <label > Owner </label> <input class="inputClass" id="owner" placeholder="Aberathne" value="" type="text"> </div> <div data-role="fieldcontain"> <label class="select">GramaNiladhari Division</label> <select class="inputClass" id="gramaND"> <option value="GramaNiladhari Division 1">GramaNiladhari Division 1</option> <option value="GramaNiladhari Division 2">GramaNiladhari Division 2</option> <option value="GramaNiladhari Division 3">GramaNiladhari Division 3</option> <option value="GramaNiladhari Division 4">GramaNiladhari Division 4</option> </select> </div> <div data-role="fieldcontain"> <label > Contact No </label> <input class="inputClass" id="contactNo" placeholder="071-9545-073" value="" type="number"> </div> <div data-role="fieldcontain"> <label >Address:</label> <textarea cols="40" rows="8" class="inputClass" id="address"></textarea> </div> <div class="ui-block-a"><button type="submit" data-theme="d">Location in a Map</button></div> <div data-role="fieldcontain"> <label >Race</label> <select class="inputClass" id="race"> <option value=" Sinhalese"> Sinhalese</option> <option value=" Sri Lanka Tamils"> Sri Lanka Tamils</option> <option value=" Moors"> Moors</option> <option value=" Indian Tamils "> Indian Tamils </option> <option value=" Malays "> Malays </option> <option value=" Burghers "> Burghers </option> </select> </div> <input class="buttonClass" type="button" value="Insert Data" onclick="saveLocal(this.form);"> </div> </form> </div> <input class="buttonClass" type="button" value="get Data" onclick="readLocal();"> <!-- <p id="dhomeId"></p> <p id="downer"></p> <p id="dgramaND"></p> <p id="dcontactNo"></p> <p id="daddress"></p> <p id="drace"></p>--> <table border="1"> <tbody id="tbody"> <tr><td>test1</td></tr> <tr><td>test2</td></tr> </tbody> </table> </div> </body> </html> Also I need to expand my code to edit and delete record from local storage.

    Read the article

  • accessing Ruby variable(from model or controller) in SASS

    - by corroded
    Is there a way to access ruby variables in sass or do i have to make a custom function for it? What im trying to do is to generate a stylesheet for each user so in the controller, i do something like: def show respond_to do |format| format.css{render :partial => "styles"} end end then in the view name _styles.haml i do this: :sass #header :background url(user.banner.url) is this possible at all?

    Read the article

  • How to poll the popular websites in PHP?

    - by Runner
    It's springed from this answer: http://superuser.com/questions/129741/how-does-search-engines-update-indexing-so-soon/129743#129743 BTW,for the servers that's polled,is it the same whether the request is just for polling(header information) or complete web page?

    Read the article

  • Tool for Search in Outlook

    - by LeeRob
    Hey guys, I am in search of a tool, with which I can organize my e-mail inbox!! It should search of course for e-mails, but it would be nice if I can also search for and in attachments, appointments, adresses etc. Beside this it also should be small and of course fast! ;) I heard and read of several tool (xobni, copernic, WDS, Lookeen), but now wanted to know your opinions which would be the best...I am interested in all, no matter if freeware or not! Thank you!

    Read the article

  • How to send raw XML in Python?

    - by davywahd
    Hi, I am trying to send raw xml to a service in Python. I have a the address of the service and my question is how would I wrap XML in python and send it to the service. The address is in the format below. 192.1100.2.2:54239 And say the XML is: <xml version="1.0" encoding="UTF-8"><header/><body><code><body/> Anyone know what to do?

    Read the article

  • How to enable MALLOC_PROTECT_BEFORE in Xcode?

    - by Daniel S.
    After switching on some debug options in Xcode, it now tells me the following in the output: GuardMalloc[Roadcast-4010]: free: magic is 0x0000090b, not 0xdeadbeef. GuardMalloc[Roadcast-4010]: free: header magic value at 0x43f49bf0, for block 0x43f49c00-0x43f50000, has been trashed by a buffer underrun. GuardMalloc[Roadcast-4010]: Try running with MALLOC_PROTECT_BEFORE to catch this error immediately as it happens. How do I switch on MALLOC_PROTECT_BEFORE?

    Read the article

  • change password code error

    - by ejah85
    I've created a code to change a password. Now it seem contain an error. When I fill in the form to change password, and click save the error message: Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 I really don’t know what the error message means. Please guys. Help me fix it. Here's is the code: <?php session_start(); ?> <?php # change password.php //set the page title and include the html header. $page_title = 'Change Your Password'; //include('templates/header.inc'); if(isset($_POST['submit'])){//handle the form require_once('connectioncomplaint.php');//connect to the db. //include "connectioncomplaint.php"; //create a function for escaping the data. function escape_data($data){ global $dbc;//need the connection. if(ini_get('magic_quotes_gpc')){ $data=stripslashes($data); } return mysql_real_escape_string($data, $dbc); }//end function $message=NULL;//create the empty new variable. //check for a username if(empty($_POST['userid'])){ $u=FALSE; $message .='<p> You forgot enter your userid!</p>'; }else{ $u=escape_data($_POST['userid']); } //check for existing password if(empty($_POST['password'])){ $p=FALSE; $message .='<p>You forgot to enter your existing password!</p>'; }else{ $p=escape_data($_POST['password']); } //check for a password and match againts the comfirmed password. if(empty($_POST['password1'])) { $np=FALSE; $message .='<p> you forgot to enter your new password!</p>'; }else{ if($_POST['password1'] == $_POST['password2']){ $np=escape_data($_POST['password1']); }else{ $np=FALSE; $message .='<p> your new password did not match the confirmed new password!</p>'; } } if($u && $p && $np){//if everything's ok. $query="SELECT userid FROM access WHERE (userid='$u' AND password=PASSWORD('$p'))"; $result=@mysql_query($query); $num=mysql_num_rows($result); if($num == 1){ $row=mysql_fetch_array($result, MYSQL_NUM); //make the query $query="UPDATE access SET password=PASSWORD('$np') WHERE userid=$row[0]"; $result=@mysql_query($query);//run the query. if(mysql_affected_rows() == 1) {//if it run ok. //send an email,if desired. echo '<p><b>your password has been changed.</b></p>'; include('templates/footer.inc');//include the HTML footer. exit();//quit the script. }else{//if it did not run OK. $message= '<p>Your password could not be change due to a system error.We apolpgize for any inconvenience.</p><p>' .mysql_error() .'</p>'; } }else{ $message= '<p> Your username and password do not match our records.</p>'; } mysql_close();//close the database connection. }else{ $message .='<p>Please try again.</p>'; } }//end oh=f the submit conditional. //print the error message if there is one. if(isset($message)){ echo'<font color="red">' , $message, '</font>'; } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <body> <script language="JavaScript1.2">mmLoadMenus();</script> <table width="604" height="599" border="0" align="center" cellpadding="0" cellspacing="0"> <tr> <td height="130" colspan="7"><img src="images/banner(E-Complaint)-.jpg" width="759" height="130" /></td> </tr> <tr> <td width="100" height="30" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="160" bgcolor="#ABD519"> <?php include "header.php"; ?>&nbsp;</td> </tr> <tr> <td colspan="7" bgcolor="#FFFFFF"> <fieldset><legend> Enter your information in the form below:</legend> <p><b>User ID:</b> <input type="text" name="username" size="10" maxlength="20" value="<?php if(isset($_POST['userid'])) echo $_POST['userid']; ?>" /></p> <p><b>Current Password:</b> <input type="password" name="password" size="20" maxlength="20" /></p> <p><b>New Password:</b> <input type="password" name="password1" size="20" maxlength="20" /></p> <p><b>Confirm New Password:</b> <input type="password" name="password2" size="20" maxlength="20" /></p> </fieldset> <div align="center"> <input type="submit" name="submit" value="Change My Password" /></div> </form><!--End Form--> </td> </tr> </table> </body> </html>

    Read the article

  • Linking CSS Navbar WIth Wordpress Pages

    - by JCHASE11
    I am using wordpress as a full on CMS on a site I am building. One thing I cant seem to figure out is how to link up my navigation bar to the pages I am creating in wordpress. I am using a sprite image hover navbar that is defined in the header.php file. Does anyone have any idea how I can take a typical CSS sprite navbar and link it up with the pages I am creating within wordpress?

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • Deleting Multiple rows from a TableView

    - by Sid
    hi Frnz, i want to delete multiple rows from a table view based on users selection.obviously i cant use didSelectRowAtIndexPath method coz it will be called for every row selected. i want to allow user to select multiple rows for deletion and then delete them in one go...Is it possible if yes then how to go about it.Also i am using a single view based project and i want the header of table view changed to "Delete" on the same view when the user want to delete the rows from the view. Thx

    Read the article

  • Are protocols inheritable in Objective-C?

    - by aquaibm
    I saw this in some header file in the framework directory: @interface NSCharacterSet : NSObject <NSCopying, NSMutableCopying, NSCoding> @end @interface NSMutableCharacterSet : NSCharacterSet <NSCopying, NSMutableCopying> @end I thought protocols were inheritable.If I am right about that,There is no need to type <NSCopying, NSMutableCopying> again after "NSMutableCharacterSet : NSCharacterSet".And NSMutableCharacterSet also conforms to NSCoding protocol, right? Than why is Apple typing that again?Am I making mistake?

    Read the article

  • How do I start Chrome using a specified "user profile"?

    - by Danny Tuppeny
    I use the new built-in "Users" feature of Chrome to switch between Home/Work accounts easily. However, Chrome remembers the "last" user profile you had selected when launching new windows. This is a problem if I close down my "Home" profile last, because when I then click the Email shortcut on my taskbar, because it goes to mail.mycompany.com using my Home profile, and I'm not logged in. I'd like to change the shortcut to the company webmail to pass a switch that tells Chrome to always start as the "Default" user, regardless of the last one used. Note: I have tried user-data-dir, and this seems to do something very different, completely isolated from the Users functionality built in to Chrome. It's possible I'm using it wrong, but please test this before assuming it does the same thing and posting an answer ;-)

    Read the article

  • How to accept email *only* from white-listed addresses in Gmail? [migrated]

    - by Mawg
    I only want to accpet email from two addresses, the rest I want to delete immediately, unseen. I know how to make fileers and I can whitelist those two addresses. If I make 3 filter, in this order; 1) from [email protected] move to inbox, never mark as spam 2) from [email protected] move to inbox, never mark as spam 3) from *@*.* delete immediately, never move to trash can I be guaranteed that that will do what I want? For instance, can I be sure that the filters are executed in that order? I dont want to lose amy mail from those two adresses.

    Read the article

  • Making my SVN Public

    - by azz0r
    Hello, I'm looking todo an SVN checkout on a server so I need to make my local SVN public. I looked into GITHUB, but I'm not willing to pay or let the world see my project. Are there any alternates? Okay so I went through this tutorial: http://www.petri.co.il/setup-ssh-server-vista.htm Had some issues, so I did this: mail-archive.com/[email protected]/msg84875.html Now I'm wondering how let the SSH access my SVN repo found in c:/wamp/svnRepo. Any tutorials or advice (please no: go read this book crap) greatly welcome!

    Read the article

  • Recurring network issues the same time every day.

    - by Peter Turner
    Something has been happening on my company's network at 9:30 every day. I'm not the sysadmin but he's not a ServerFault guy so I'm not privy to every aspect of the network but I can ask questions if follow up is needed. The symptoms are the following : Sluggish network and download speed (I don't notice it, but others do) 3Com phones start ringing without having people on the other end. We've got the following ports exposed to the public for a web server, a few other ports for communicating with our clients for tech support and a VPN. We've got a Cisco ASA blocking everything else. We've got a smallish network (less than 50 computers/vms on at any time). An Active Directory server and a few VM servers. We host our own mail server too. I'm thinking the problem is internal, but what's a good way to figure out where it's coming from?

    Read the article

< Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >