Search Results

Search found 9744 results on 390 pages for 'k means'.

Page 351/390 | < Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >

  • Problem creating gui from xml -> Strange CPButton behaviour

    - by Superpro
    Hallo, I'm new to objective-j and cappuccino and just have tried to create a small application, that creates the gui dynamically from a xml file. Unfortunately it works only partially. It seems that the button regions are disorder. This means, that the buttons also response if I click besides the button.... Please help me. I dont get it.. - (void)applicationDidFinishLaunching:(CPNotification)aNotification { mControlList = [CPArray alloc]; theWindow = [[CPWindow alloc] initWithContentRect:CGRectMakeZero() styleMask:CPBorderlessBridgeWindowMask], contentView = [theWindow contentView]; [contentView setFrame:[[contentView superview] bounds]]; [contentView setAutoresizingMask:CPViewWidthSizable | CPViewHeightSizable]; // Loadxmlfile var xhttp; if (window.XMLHttpRequest) { xhttp=new XMLHttpRequest() } else { xhttp=new ActiveXObject("Microsoft.XMLHTTP") } xhttp.open("GET","test.xml",false); xhttp.send(""); xmlDoc = xhttp.responseXML; //Get controls nodeand iterate through all controls var node = xmlDoc.getElementsByTagName("controls")[0]; for (var i=0; i<node.childNodes.length; i++) { if(node.childNodes[i].nodeName=="button"){ var item = node.childNodes[i]; var name = item.attributes["name"].nodeValue; var text = item.getElementsByTagName("text") [0].childNodes[0].nodeValue; var x= item.getElementsByTagName("rect") [0].attributes["x"].nodeValue; var y= item.getElementsByTagName("rect") [0].attributes["y"].nodeValue; var width= item.getElementsByTagName("rect") [0].attributes["width"].nodeValue; var height= item.getElementsByTagName("rect") [0].attributes["height"].nodeValue; var b = [[Button alloc] InitWithParent:contentView Text:text X:x Y:y Width:width Height:height]; [mControlList addObject:b]; } } [theWindow orderFront:self]; } @implementation Button : CPObject { CPButton _button; } - (Button)InitWithParent:(CPView)contentView Text:(CPString)text X: (int)x Y:(int)y Width:(int)width Height:(int)height { _button = [[CPButton alloc] initWithFrame: CGRectMake(x,y,width,height)]; [_button setTitle:text]; [_button setTarget:self]; [_button setAction:@selector(cmdNext_onClick:)]; [contentView addSubview:_button]; return self; } - (void)cmdNext_onClick:(id)sender { } @end

    Read the article

  • Algorithm to split an article without breaking the reading flow or HTML code

    - by Victor Stanciu
    Hello, I have a very large database of articles, of varying lengths. The articles have HTML elements in them. I have to insert some ads (simple <script> elements) in the body of each article when it is displayed (I know, I hate ads that interrupt my reading too). Now, the problem is that each ad must be inserted at about the same position in each article. The simplest solution is to simply split the article on a fixed number of characters (without breaking words), and insert the ad code. This, however, runs the risk of inserting the ad in the middle of a HTML tag. I could go the regex way, but I was thinking about the following solution, using JS: Establish a character count threshold. For example, "the add should be inserted at about 200 words" Set accepted deviations in each direction, say -20, +20 characters. Loop through each text node inside the article, and while doing so, keep count of the total number of characters so far Once the count exceeds the threshold, make the following decision: 4.1. If count exceeds the threshold by a value lower that the positive accepted deviation (for example, 17 characters), insert the ad code just after the current text node. 4.2. If the count is greater than the sum of the threshold and the deviation, roll back to the previous text node, and make the same decision, only this time use the previous count and check if it's lower than the difference between the threshold and the deviation, and if not, insert the ad between the current node and the previous one. 4.3. If the 4.1 and 4.2 fail (which means that the previous node reached a too low character count and the current node a too high one), insert the ad after whatever character count is needed inside the current element. I know it's convoluted, but it's the first thing out of my mind and it has the advantage that, by trying to insert the ad between text nodes, perhaps it will not break the flow of the article as bad as it would if I would just stick it in (like the final 4.3 case) Here is some pseudo-code I put together, I don't trust my english-explaining skills: threshold = 200 deviation = 20 current_count = 0 for each node in article_nodes { previous_count = current_count current_count = current_count + node.length if current_count < threshold { continue // next interation } if current_count > threshold + deviation { if previous_count < threshdold - deviation { // insert ad in current node } else { // insert ad between the current and previous nodes } } else { // insert ad after the current node } break; } Am I over-complicating stuff, or am I missing a simpler, more elegant solution?

    Read the article

  • SEO Help with Pages Indexed by Google

    - by Joe Majewski
    I'm working on optimizing my site for Google's search engine, and lately I've noticed that when doing a "site:www.joemajewski.com" query, I get results for pages that shouldn't be indexed at all. Let's take a look at this page, for example: http://www.joemajewski.com/wow/profile.php?id=3 I created my own CMS, and this is simply a breakdown of user id #3's statistics, which I noticed is indexed by Google, although it shouldn't be. I understand that it takes some time before Google's results reflect accurately on my site's content, but this has been improperly indexed for nearly six months now. Here are the precautions that I have taken: My robots.txt file has a line like this: Disallow: /wow/profile.php* When running the url through Google Webmaster Tools, it indicates that I did, indeed, correctly create the disallow command. It did state, however, that a page that doesn't get crawled may still get displayed in the search results if it's being linked to. Thus, I took one more precaution. In the source code I included the following meta data: <meta name="robots" content="noindex,follow" /> I am assuming that follow means to use the page when calculating PageRank, etc, and the noindex tells Google to not display the page in the search results. This page, profile.php, is used to take the $_GET['id'] and find the corresponding registered user. It displays a bit of information about that user, but is in no way relevant enough to warrant a display in the search results, so that is why I am trying to stop Google from indexing it. This is not the only page Google is indexing that I would like removed. I also have a WordPress blog, and there are many category pages, tag pages, and archive pages that I would like removed, and am doing the same procedures to attempt to remove them. Can someone explain how to get pages removed from Google's search results, and possibly some criteria that should help determine what types of pages that I don't want indexed. In terms of my WordPress blog, the only pages that I truly want indexed are my articles. Everything else I have tried to block, with little luck from Google. Can someone also explain why it's bad to have pages indexed that don't provide any new or relevant content, such as pages for WordPress tags or categories, which are clearly never going to receive traffic from Google. Thanks!

    Read the article

  • Why does firefox round-trip to the server to determine whether my files are modifed?

    - by erikkallen
    I have some static content on my web site that I have set up caching for (using Asp.NET MVC). According to Firebug, the first time I open the page, Firefox sends this request: GET /CoreContent/Core.css?asm=0.7.3614.34951 Host: 127.0.0.1:3916 User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.1.5) Gecko/20091102 Firefox/3.5.5 (.NET CLR 3.5.30729) Accept: text/css,*/*;q=0.1 Accept-Language: en-us,en;q=0.5 Accept-Encoding: gzip,deflate Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive: 300 Connection: keep-alive Referer: http://127.0.0.1:3916/Edit/1/101 Cookie: .ASPXAUTH=52312E5A802C1A079E2BA29AA2BFBC5A38058977B84452D62ED52855D4164659B4307661EC73A307BFFB2ED3871C67CB3A9AAFDB3A75A99AC0A21C63A6AADE9A11A7138C672E75125D9FF3EFFBD9BF62 Pragma: no-cache Cache-Control: no-cache Which my server replies to with this: Server: ASP.NET Development Server/9.0.0.0 Date: Mon, 23 Nov 2009 18:44:41 GMT X-AspNet-Version: 2.0.50727 X-AspNetMvc-Version: 1.0 Cache-Control: public, max-age=31535671 Expires: Tue, 23 Nov 2010 18:39:12 GMT Last-Modified: Mon, 23 Nov 2009 18:39:12 GMT Vary: * Content-Type: text/css Content-Length: 15006 Connection: Close So far, so good. However, if I refresh Firefox (not a cache-clearing refresh, just a normal one), during that refresh cycle Firefox will once again go to the server with this request: GET /CoreContent/Core.css?asm=0.7.3614.34951 Host: 127.0.0.1:3916 User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.1.5) Gecko/20091102 Firefox/3.5.5 (.NET CLR 3.5.30729) Accept: text/css,*/*;q=0.1 Accept-Language: en-us,en;q=0.5 Accept-Encoding: gzip,deflate Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive: 300 Connection: keep-alive Referer: http://127.0.0.1:3916/Edit/1/101 Cookie: .ASPXAUTH=52312E5A802C1A079E2BA29AA2BFBC5A38058977B84452D62ED52855D4164659B4307661EC73A307BFFB2ED3871C67CB3A9AAFDB3A75A99AC0A21C63A6AADE9A11A7138C672E75125D9FF3EFFBD9BF62 If-Modified-Since: Mon, 23 Nov 2009 18:39:20 GMT Cache-Control: max-age=0 to which my server responds 304 Not Modified. Why does Firefox issue this second request? In the first response, I said that the cache does not expire for a year (I intend to use query parameters whenever things change). Do I have to add another response header to prevent this extra roundtrip? Edit: It does not matter whether I press refresh, or whether I go to the page again (or a different URL, which references the same external files). Firefox does the same again. Also, I don't claim this to be a bug in FF, I just wonder if there is another header I can set which means "This document will never change, don't bother me again".

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • SSL Authentication with Certificates: Should the Certificates have a hostname?

    - by sixtyfootersdude
    Summary JBoss allows clients and servers to authenticate using certificates and ssl. One thing that seems strange is that you are not required to give your hostname on the certificate. I think that this means if Server B is in your truststore, Sever B can pretend to be any server that they want. (And likewise: if Client B is in your truststore...) Am I missing something here? Authentication Steps (Summary of Wikipeida Page) Client Server ================================================================================================= 1) Client sends Client Hello ENCRIPTION: None - highest TLS protocol supported - random number - list of cipher suites - compression methods 2) Sever Hello ENCRIPTION: None - highest TLS protocol supported - random number - choosen cipher suite - choosen compression method 3) Certificate Message ENCRIPTION: None - 4) ServerHelloDone ENCRIPTION: None 5) Certificate Message ENCRIPTION: None 6) ClientKeyExchange Message ENCRIPTION: server's public key => only server can read => if sever can read this he must own the certificate - may contain a PreMasterSecerate, public key or nothing (depends on cipher) 7) CertificateVerify Message ENCRIPTION: clients private key - purpose is to prove to the server that client owns the cert 8) BOTH CLIENT AND SERVER: - use random numbers and PreMasterSecret to compute a common secerate 9) Finished message - contains a has and MAC over previous handshakes (to ensure that those unincripted messages did not get broken) 10) Finished message - samething Sever Knows The client has the public key for the sent certificate (step 7) The client's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the server's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Client Knows The server has the public key for the sent certificate (step 6 with step 8) The server's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the client's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Potential Problem Suppose the client's truststore has certs in it: Server A Server B (malicous) Server A has hostname www.A.com Server B has hostname www.B.com Suppose: The client tries to connect to Server A but Server B launches a man in the middle attack. Since server B: has a public key for the certificate that will be sent to the client has a "valid certificate" (a cert in the truststore) And since: certificates do not have a hostname feild in them It seems like Server B can pretend to be Server A easily. Is there something that I am missing?

    Read the article

  • NSArraycontroller selectionIndexes bindings

    - by Michael Scherbaum
    Hi all, I have the following set-up: A Window that has a splitView in which I display I NSCollectionView in the left view and a detailView in the right view. Both views are set-up in separate xibs. Furthermore I have a Datacontroller (of class NSArrayController) that manages a mutable Array of NSMutableDictionaries (moviesForChoice). The dataController is set-up as application delegate. The movie objects in the array have properties like (name, plot, genre etc.) so far so good... In the xib for the NScollectionview I bound a NSArraycontroller content property to my datacontroller via Application.delegate.moviesForChoice The collectionView accesses the arraycontroller.arrrangedObjects and arraycontroller.selectionIndexes. This works fine the contents are displayed and the selection works fine in the collectionview (my collectionviewItem renders a selection color) In the xib for the detailView I want to display information for the selected object in the collectionview. Therefore I also added an arraycontroller to the xib, bound the content aray to Application.delegate.moviesForChoice and bound the NSTextfields in the view to e.g. arraycontroller.selection.name Here comes my issue: everytime I open the window with the two xibs, my collectionview displays all movies that are for choice correctly, and the detailview displays the information for the 1st object in my collectionview. Whenever I click on a different movie in the collectionView the res. item renders a selection color, but the detailView doesn't update. My understanding of it would be that the DataController is not informed about updates in the selectionIndexes and can therefore not trigger an update in the detailView. Correct me if I'm wrong... To remedy this I tried to bind the selectionIndexes property of the arraycontroller in the collectionView xib to Application.delegate.moviesForChoice.selecionIndexes but this failed with: addObserver:forKeyPath:options:context:] is not supported. Key path: selectionIndexes I could imagine that this means that the datacontroller is not KVO compliant for my Array moviesForChoice, but I implemented the following methods for it: -(void)insertObject:(NSDictionary *)dict inMoviesForChoiceAtIndex:(NSUInteger)index { [moviesForChoice insertObject:dict atIndex:index]; } -(void)removeObjectFromMoviesForChoiceAtIndex:(NSUInteger)index { [moviesForChoice removeObjectAtIndex:index]; } -(void)setMoviesForChoice:(NSMutableArray *)a { moviesForChoice = a; } -(NSArray*)moviesForChoice { return moviesForChoice; } -(NSUInteger)countOfMoviesForChoice { return [moviesForChoice count]; } - (void)addMovieForChoiceObject:(Movie *)anObject { [moviesForChoice addObject:anObject]; } So where am I wrong? How do I correctly bind to the selectionIndexes? You help is much appreciated! M

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • Debugging a basic OpenGL texture fail? (iphone)

    - by Ben
    Hey all, I have a very basic texture map problem in GL on iPhone, and I'm wondering what strategies there are for debugging this kind of thing. (Frankly, just staring at state machine calls and wondering if any of them is wrong or misordered is no way to live-- are there tools for this?) I have a 512x512 PNG file that I'm loading up from disk (not specially packed), creating a CGBitmapContext, then calling CGContextDrawImage to get bytes out of it. (This code is essentially stolen from an Apple sample.) I'm trying to map the texture to a "quad", with code that looks essentially like this-- all flat 2D stuff, nothing fancy: glEnable(GL_TEXTURE_2D); glTexEnvf(GL_TEXTURE_ENV, GL_TEXTURE_ENV_MODE, GL_MODULATE); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_S, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_T, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR); glEnableClientState(GL_TEXTURE_COORD_ARRAY); GLfloat vertices[8] = { viewRect.origin.x, viewRect.size.height, viewRect.origin.x, viewRect.origin.y, viewRect.size.width, viewRect.origin.y, viewRect.size.width, viewRect.size.height }; GLfloat texCoords[8] = { 0, 1.0, 0, 0, 1.0, 0, 1.0, 1.0 }; glBindTexture(GL_TEXTURE_2D, myTextureRef); // This was previously bound to glVertexPointer(2, GL_FLOAT , 0, vertices); glTexCoordPointer(2, GL_FLOAT, 0, texCoords); glDrawArrays(GL_TRIANGLE_FAN, 0, 4); glDisableClientState(GL_TEXTURE_COORD_ARRAY); glDisable(GL_TEXTURE_2D); My supposedly textured area comes out just black. I see no debug output from the CG calls to set up the texture. glGetError reports nothing. If I simplify this code block to just draw the verts, but set up a pure color, the quad area lights up exactly as expected. If I clear the whole context immediately beforehand to red, I don't see the red-- which means something is being rendered there, but not the contents of my PNG. What could I be doing wrong? And more importantly, what are the right tools and techniques for debugging this sort of thing, because running into this kind of problem and not being able to "step through it" in a debugger in any meaningful way is a bummer. Thanks!

    Read the article

  • How to change button's image in visual c++ at run time?

    - by karikari
    After trying and error for many times, I decided to ask here. My objective is I wanted to change the feature of my IE toolbar button. The button is firstly setup by IE at IE startup using the function CRebarHandler::onSetRedraw and CRebarHandler::setButtonMenu2(). And then, I create a call from another cpp file, to call CRebarHandler::setButtonMenu2(). I intent to change just the button's image. I assigned the ID of the image correctly. But somehow it does not work. When I put other code inside this function,like a code for writing to file, it is proven work. Means, it is properly being called from the other file. But the thing is, the code for the button inside CRebarHandler::setButtonMenu2() seems does not work. Need help. Here is the code I am working on (I modify John Lister's button code): LRESULT CRebarHandler::onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled){ bHandled=false; if (m_ieVer==6){ if (!m_hWndToolbar) scanForToolbarSlow(); if (m_hWndToolbar){ findButton(m_hWndToolbar); if (m_buttonID>0) setButtonMenu(); } } return S_OK; } void CRebarHandler::setButtonMenu(){ HIMAGELIST hImageList = ImageList_Create(32, 32,ILC_COLOR16 | ILC_MASK,1, 0); HINSTANCE module = _AtlBaseModule.GetResourceInstance(); TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; char psBuffer[128]; FILE *pPipe; float f = 0; pPipe = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt", "rt" ); char* p = fgets(psBuffer, 128, pPipe); std::istringstream iss(p); iss >> f; if (f > 0.9) { inf.iImage = 1; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } else { inf.iImage = 2; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } iss.clear(); f = 0; } void CRebarHandler::setButtonMenu2(){ TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; inf.iImage = 1; //green SendMessage(NULL, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); }

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • div "top" bug IE and everything else. Big problem

    - by Victor
    Hi everyone. I am new in CSS so please help me in this problem. I hope to describe it wright. I am making div named content where my site content is. I made it with z-index:-1; so an image to be over this div. But in Chrome, FF and safari, content became inactive. I cant select text , click on link and write in the forms. So I tried with positive states in the z-index but IE don't know what this means. Damn. So I decided to make conditional div. Here is the code: .content { background:#FFF; width:990px; position:relative; float:left; top:50px; } .content_IE { background:#FFF; width:990px; position:relative; float:left; top: 50px; z-index:-1; } and here is the HTML: <!--[if IE 7]> <div class="content_IE" style="height:750px;"> <![endif]--> <div class="content" style="height:550px;"> Everything is fine with the z-index but the problem is that if there is no top in .content class everything looks fine in IE but there is no space in the other browsers. If i put back the top:50px; there onother 50px like padding in the .content_IE class. I mean that the page looks like I've put top:50px; and padding-top=50px;. I've try everything like margin-top:-50px; padding-top:-50px; and stuff like this but I am still in the circle. It look fine only if there is no top option in .content class. Please help.

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • Getting 404 when attempting to POST file to Google Cloud Storage from service account

    - by klactose
    I'm wondering if anyone can tell me the proper syntax & formatting for a service account to send a POST Object to bucket request? I'm attempting it programmatically using the HttpComponents library. I manage to get a token from my GoogleCredential, but every time I construct the POST request, I get: HTTP/1.1 403 Forbidden <?xml version='1.0' encoding='UTF-8'?><Error><Code>AccessDenied</Code><Message>Access denied.</Message><Detailsbucket-name</Details></Error The Google documentation that describes the request methods, mentions posting using html forms, but I'm hoping that wasn't suggesting the ONLY way to get the job done. I know that HttpComponents has a way to explicitly create form data by using UrlEncodedFormEntity, but it doesn't support multipart data. Which is why I went with using the MultipartEntity class. My code is below: MultipartEntity entity = new MultipartEntity( HttpMultipartMode.BROWSER_COMPATIBLE ); String token = credential.getAccessToken(); entity.addPart("Authorization", new StringBody("OAuth " + token)); String date = formatDate(new Date()); entity.addPart("Date", new StringBody(date)); entity.addPart("Content-Encoding", new StringBody("UTF-8")); entity.addPart("Content-Type", new StringBody("multipart/form-data")); entity.addPart("bucket", new StringBody(bucket)); entity.addPart("key", new StringBody("fileName")); entity.addPart("success_action_redirect", new StringBody("/storage")); File uploadFile = new File("pathToFile"); FileBody fileBody = new FileBody(uploadFile, "text/xml"); entity.addPart("file", fileBody); httppost.setEntity(entity); System.out.println("Posting URI = "+httppost.toString()); HttpResponse response = client.execute(httppost); HttpEntity resp_entity = response.getEntity(); As I mentioned, I am able to get an actual token, so I'm pretty sure the problem is in how I've formed the request as opposed to not being properly authenticated. Keep in mind: This is being performed by a service account. Which means that it does have Read/Write access Thanks for reading, and I appreciate any help!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' readonly?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Slider - Moving of slider clears the screen.....

    - by Mahesh
    Hi, I am currently working on Silver light 3.0. Currently facing one simple issue but not able to find the solution about it. I have one column slider, which is placed in between column 1 and column 3. Column 2 contains slider itself. But when i move the slider from column1 on column 3. That means column1 will only be visible right now. But when i move the slider to the right corer it clears the screen. Please find herewith my code...... <Grid Name="grdTopLeft" Grid.Row="1" Grid.Column="0" HorizontalAlignment="Stretch" VerticalAlignment="Stretch" Margin="0, 0, 0, 0" > <radNavigation:RadTabControl x:Name="layerTabControl" TabStripPlacement="Top" Style="{StaticResource IControllerRadTab}"> <radNavigation:RadTabItem Header="{Binding SelectedLayer.Name}" Style="{StaticResource IRadTabItem}"> <Page:WordView x:Name="WordView" Tag="DefaultLayer"/> </radNavigation:RadTabItem> </radNavigation:RadTabControl> </Grid> <!-- Top Splitter --> <basic:GridSplitter Grid.Row="1" Grid.Column="1" Width="3" Style="{StaticResource GridSplitterStyle}" VerticalAlignment="Stretch" HorizontalAlignment="Center" IsTabStop="False"/> <!--Top Right: Related--> <Grid Grid.Row="1" Grid.Column="2" VerticalAlignment="Stretch" HorizontalAlignment="Stretch" Margin="0, 0, 0, 0"> <Grid.RowDefinitions> <RowDefinition Height="Auto" /> <RowDefinition Height="*" /> </Grid.RowDefinitions> <radNavigation:RadTabControl x:Name="LayersTabControl" TabStripPlacement="Top" ItemContainerStyle="{StaticResource IRadTabItem}" ItemsSource="{Binding TabItems}" Style="{StaticResource IControllerRadTab1}" SelectedIndex="{Binding ActiveTab,Mode=TwoWay}" SelectionChanged="LayersTabControl_SelectionChanged" /> <Grid Grid.Row="1" Background="#EFF2F7" VerticalAlignment="Stretch" HorizontalAlignment="Stretch" > <Page:WordView x:Name="RelatedView" Margin="5,5,5,5" Tag="ActiveLayer"/> </Grid> </Grid> Can anyone please help me out from this issue..... Thanks in advance. Mahesh

    Read the article

  • 1180: Call to a possibly undefined method addEventListener

    - by Chris
    I'm going through some AS3 training, but I'm getting a weird error... I'm trying to add an event listener to the end of a motion tween in AS. I've created a tween, highlighted the frames, right clicked and copied the tween as AS and pasted it into the movie clip (I think there's a better way to do this, but I'm not sure what it is...) When I try to add the listener to the end of that code, I get the error. Here's my code. import fl.motion.AnimatorFactory; import fl.motion.MotionBase; import fl.motion.Motion; import flash.filters.*; import flash.geom.Point; import fl.motion.MotionEvent; import fl.events.*; var __motion_Enemy_3:MotionBase; if(__motion_Enemy_3 == null) { __motion_Enemy_3 = new Motion(); __motion_Enemy_3.duration = 30; // Call overrideTargetTransform to prevent the scale, skew, // or rotation values from being made relative to the target // object's original transform. // __motion_Enemy_3.overrideTargetTransform(); // The following calls to addPropertyArray assign data values // for each tweened property. There is one value in the Array // for every frame in the tween, or fewer if the last value // remains the same for the rest of the frames. __motion_Enemy_3.addPropertyArray("x", [0]); __motion_Enemy_3.addPropertyArray("y", [0]); __motion_Enemy_3.addPropertyArray("scaleX", [1.000000,1.048712,1.097424,1.146136,1.194847,1.243559,1.292271,1.340983,1.389695,1.438407,1.487118,1.535830,1.584542,1.633254,1.681966,1.730678,1.779389,1.828101,1.876813,1.925525,1.974237,2.022949,2.071661,2.120372,2.169084,2.217796,2.266508,2.315220,2.363932,2.412643]); __motion_Enemy_3.addPropertyArray("scaleY", [1.000000,1.048712,1.097424,1.146136,1.194847,1.243559,1.292271,1.340983,1.389695,1.438407,1.487118,1.535830,1.584542,1.633254,1.681966,1.730678,1.779389,1.828101,1.876813,1.925525,1.974237,2.022949,2.071661,2.120372,2.169084,2.217796,2.266508,2.315220,2.363932,2.412643]); __motion_Enemy_3.addPropertyArray("skewX", [0]); __motion_Enemy_3.addPropertyArray("skewY", [0]); __motion_Enemy_3.addPropertyArray("rotationConcat", [0]); __motion_Enemy_3.addPropertyArray("blendMode", ["normal"]); __motion_Enemy_3.addPropertyArray("cacheAsBitmap", [false]); __motion_Enemy_3.addEventListener(MotionEvent.MOTION_END, hurtPlayer); // Create an AnimatorFactory instance, which will manage // targets for its corresponding Motion. var __animFactory_Enemy_3:AnimatorFactory = new AnimatorFactory(__motion_Enemy_3); __animFactory_Enemy_3.transformationPoint = new Point(0.499558, 0.500000); // Call the addTarget function on the AnimatorFactory // instance to target a DisplayObject with this Motion. // The second parameter is the number of times the animation // will play - the default value of 0 means it will loop. // __animFactory_Enemy_3.addTarget(<instance name goes here>, 0); } function hurtPlayer(event:MotionEvent):void { this.parent.removeChild(this); } I've tried a few places for it, both with the animFactory_Enemy_3 variable and the motion_Enemy_3 variable - getting the same error both times.

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • how to find the data key on checkedchanged event of checkbox in a list view in asp.net?

    - by subodh
    I am using a list view inside that in item template i am using a label and a checkbox. I want that whenever user clicks on the check box the value should be updated in a table.i am using a datakeys in listview.on the basis of datakey value should be updated in the table query is string updateQuery = "UPDATE [TABLE] SET [COLUMN] = " + Convert.ToInt32(chk.Checked) + " WHERE PK_ID =" + dataKey + " "; also i want some help in displaying the result as it is inside the table.means if the value for column in table for a particular pkid is 1 then the checkbox shoul be checked. here is the code snippet <asp:ListView ID="lvFocusArea" runat="server" DataKeyNames="PK_ID" onitemdatabound="lvFocusArea_ItemDataBound" > <LayoutTemplate> <table border="0" cellpadding="1" width="400px"> <tr style="background-color: #E5E5FE"> <th align="left"> Focus Area </th> <th> Is Current Focused </th> </tr> <tr id="itemPlaceholder" runat="server"> </tr> </table> </LayoutTemplate> <ItemTemplate> <tr> <td width="80%"> <asp:Label ID="lblFocusArea" runat="server" Text=""><%#Eval("FOCUS_AREA_NAME") %></asp:Label> </td> <td align="center" width="20%"> <asp:CheckBox ID="chkFocusArea" runat="server" OnCheckedChanged="chkFocusArea_CheckedChanged" AutoPostBack="true"/> </td> </tr> </ItemTemplate> <AlternatingItemTemplate> <tr style="background-color: #EFEFEF"> <td> <asp:Label ID="lblFocusArea" runat="server" Text=""><%#Eval("FOCUS_AREA_NAME") %></asp:Label> </td> <td align="center"> <asp:CheckBox ID="chkFocusArea" runat="server" oncheckedchanged="chkFocusArea_CheckedChanged" AutoPostBack="true" /> </td> </tr> </AlternatingItemTemplate> <SelectedItemTemplate> <td> item selected</td> </SelectedItemTemplate> </asp:ListView> help me.

    Read the article

< Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >