Search Results

Search found 9447 results on 378 pages for 'str replace'.

Page 351/378 | < Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • Is this implementation truely tail-recursive?

    - by CFP
    Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • custom control in DataGridTemplateColumn

    - by Johnsonlu
    Hi all, I'd like to add my custom control into a template column of data grid. The custom control is very similar to a text box, but has an icon in it. The user can click the icon, and selects an item from a prompted window, then the selected item will be filled into the text box. My problem is when the text box is filled, after I click the second column, the text will disappear. If I replace the custom control with a simple text box, the result is the same. Here is the sample code: //Employee.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace SimpleGridTest { public class Employee { public string Department { get; set; } public int ID { get; set; } public string Name { get; set; } } } Mainwindow.xaml <Window x:Class="SimpleGridTest.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525"> <Grid> <DataGrid x:Name="grid" Grid.Row="1" Margin="5" AutoGenerateColumns="False" RowHeight="25" RowHeaderWidth="10" ItemsSource="{Binding}" CanUserAddRows="True" CanUserSortColumns="False"> <DataGrid.Columns> <DataGridTemplateColumn Header="Department" Width="150"> <DataGridTemplateColumn.CellTemplate> <DataTemplate> <TextBox Text="{Binding Department}" /> </DataTemplate> </DataGridTemplateColumn.CellTemplate> </DataGridTemplateColumn> <DataGridTextColumn Header="ID" Binding="{Binding Path=ID}" Width="100"/> <DataGridTextColumn Header="Name" Binding="{Binding Path=Name}" Width="200"/> </DataGrid.Columns> </DataGrid> </Grid> </Window> MainWindow.xaml.cs using System.Windows; using System.Collections.ObjectModel; namespace SimpleGridTest { /// <summary> /// Interaction logic for MainWindow.xaml /// </summary> public partial class MainWindow : Window { private ObservableCollection<Employee> _employees = new ObservableCollection<Employee>(); public ObservableCollection<Employee> Employees { get { return _employees; } set { _employees = value; } } public MainWindow() { InitializeComponent(); grid.ItemsSource = Employees; } } } How can I fix this problem? Or I need to write a DataGrid***Column as DataGridTextColumn? Thanks in advance! Best Regards, Johnson

    Read the article

  • Sanitizing DB inputs with XSLT

    - by azathoth
    Hello I've been looking for a method to strip my XML content of apostrophes (') like: <name> Jim O'Connor</name> since my DBMS is complaining of receiving those. By looking at the example described here, that is supposed to replace ' with '', I constructed the following script: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes" /> <xsl:template match="node()|@*"> <xsl:copy> <xsl:apply-templates select="node()|@*" /> </xsl:copy> </xsl:template> <xsl:template name="sqlApostrophe"> <xsl:param name="string" /> <xsl:variable name="apostrophe">'</xsl:variable> <xsl:choose> <xsl:when test="contains($string,$apostrophe)"> <xsl:value-of select="concat(substring-before($string,$apostrophe), $apostrophe,$apostrophe)" disable-output-escaping="yes" /> <xsl:call-template name="sqlApostrophe"> <xsl:with-param name="string" select="substring-after($string,$apostrophe)" /> </xsl:call-template> </xsl:when> <xsl:otherwise> <xsl:value-of select="$string" disable-output-escaping="yes" /> </xsl:otherwise> </xsl:choose> </xsl:template> <xsl:template match="node()|@*"> <xsl:apply-templates name="sqlApostrophe"/> </xsl:template> </xsl:stylesheet> However, the processor isn't accepting it. What am I missing here? Is there a better way to get rid of the apostrophes? Perhaps another approach for sanitizing DB inputs by using XSLT? Thanks for your help

    Read the article

  • PHP Session Class and $_SESSION Array

    - by Gianluca Bargelli
    Hello, i've implemented this custom PHP Session Class for storing sessions into a MySQL database: class Session { private $_session; public $maxTime; private $database; public function __construct(mysqli $database) { $this->database=$database; $this->maxTime['access'] = time(); $this->maxTime['gc'] = get_cfg_var('session.gc_maxlifetime'); session_set_save_handler(array($this,'_open'), array($this,'_close'), array($this,'_read'), array($this,'_write'), array($this,'_destroy'), array($this,'_clean') ); register_shutdown_function('session_write_close'); session_start();//SESSION START } public function _open() { return true; } public function _close() { $this->_clean($this->maxTime['gc']); } public function _read($id) { $getData= $this->database->prepare("SELECT data FROM Sessions AS Session WHERE Session.id = ?"); $getData->bind_param('s',$id); $getData->execute(); $allData= $getData->fetch(); $totalData = count($allData); $hasData=(bool) $totalData >=1; return $hasData ? $allData['data'] : ''; } public function _write($id, $data) { $getData = $this->database->prepare("REPLACE INTO Sessions VALUES (?, ?, ?)"); $getData->bind_param('sss', $id, $this->maxTime['access'], $data); return $getData->execute(); } public function _destroy($id) { $getData=$this->database->prepare("DELETE FROM Sessions WHERE id = ?"); $getData->bind_param('S', $id); return $getData->execute(); } public function _clean($max) { $old=($this->maxTime['access'] - $max); $getData = $this->database->prepare("DELETE FROM Sessions WHERE access < ?"); $getData->bind_param('s', $old); return $getData->execute(); } } It works well but i don't really know how to properly access the $_SESSION array: For example: $db=new DBClass();//This is a custom database class $session=new Session($db->getConnection()); if (isset($_SESSION['user'])) { echo($_SESSION['user']);//THIS IS NEVER EXECUTED! } else { $_SESSION['user']="test"; Echo("Session created!"); } At every page refresh it seems that $_SESSION['user'] is somehow "resetted", what methods can i apply to prevent such behaviour?

    Read the article

  • Perl: Compare and edit underlying structure in hash

    - by Mahfuzur Rahman Pallab
    I have a hash of complex structure and I want to perform a search and replace. The first hash is like the following: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"], 456 => ["as", "sd", "df"] }, mno => { 987 => ["lk", "dm", "sd"] }, } and I want to iteratively search for all '123'/'456' elements, and if a match is found, I need to do a comparison of the sublayer, i.e. of ['ab','cd','ef'] and ['as','sd','df'] and in this case, keep only the one with ['ab','cd','ef']. So the output will be as follows: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"] }, mno => { 987 => ["lk", "dm", "sd"] }, } So the deletion is based on the substructure, and not index. How can it be done? Thanks for the help!! Lets assume that I will declare the values to be kept, i.e. I will keep 456 = ["ab", "cd", "ef"] based on a predeclared value of ["ab", "cd", "ef"] and delete any other instance of 456 anywhere else. The search has to be for every key. so the code will go through the hash, first taking 123 = ["xx", "yy", "zy"] and compare it against itself throughout the rest of the hash, if no match is found, do nothing. If a match is found, like in the case of 456 = ["ab", "cd", "ef"], it will compare the two, and as I have said that in case of a match the one with ["ab", "cd", "ef"] would be kept, it will keep 456 = ["ab", "cd", "ef"] and discard any other instances of 456 anywhere else in the hash, i.e. it will delete 456 = ["as", "sd", "df"] in this case.

    Read the article

  • Regular expression to convert ul to textindent and back, with a different attribute value for first

    - by chapmanio
    Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

    Read the article

  • vb6 ADODB TSQL procedure call quit working after database migration

    - by phill
    This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

    Read the article

  • maven-ear-plugin works if jboss version is 4.2, but not 5. Why ?

    - by NSINGH
    I am using maven to configure maven-ear-plugin. I am getting following exception when I say jboss version is 5 (See below code, under tag). It works if I replace version to 4.2 <build> <finalName>tactical</finalName> <plugins> <plugin> <artifactId>maven-ear-plugin</artifactId> <configuration> <version>5</version> <defaultJavaBundleDir>lib</defaultJavaBundleDir> <jboss> <version>5</version> <loader-repository>seam.jboss.org:loader=tactical</loader-repository> </jboss> <modules> <ejbModule> <groupId>${project.groupId}</groupId> <artifactId>tactical-jar</artifactId> </ejbModule> </modules> </configuration> </plugin> </plugins> </build> Why it works fine for jboss 4.2 but not for 5. What ?? I get the following exception: [INFO] Failed to initialize JBoss configuration Embedded error: Invalid JBoss configuration, version[5] is not supported. [INFO] ------------------------------------------------------------------------ [INFO] Trace org.apache.maven.lifecycle.LifecycleExecutionException: Failed to initialize JBoss configuration at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoals(DefaultLifecycleExecutor.java:583) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoalWithLifecycle(DefaultLifecycleExecutor.java:49 9) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoal(DefaultLifecycleExecutor.java:478) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoalAndHandleFailures(DefaultLifecycleExecutor.jav a:330) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeTaskSegments(DefaultLifecycleExecutor.java:291) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.execute(DefaultLifecycleExecutor.java:142) at org.apache.maven.DefaultMaven.doExecute(DefaultMaven.java:336) at org.apache.maven.DefaultMaven.execute(DefaultMaven.java:129) at org.apache.maven.cli.MavenCli.main(MavenCli.java:287) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.codehaus.classworlds.Launcher.launchEnhanced(Launcher.java:315) at org.codehaus.classworlds.Launcher.launch(Launcher.java:255) at org.codehaus.classworlds.Launcher.mainWithExitCode(Launcher.java:430) at org.codehaus.classworlds.Launcher.main(Launcher.java:375) Caused by: org.apache.maven.plugin.MojoExecutionException: Failed to initialize JBoss configuration at org.apache.maven.plugin.ear.AbstractEarMojo.execute(AbstractEarMojo.java:159) at org.apache.maven.plugin.ear.GenerateApplicationXmlMojo.execute(GenerateApplicationXmlMojo.java:96) at org.apache.maven.plugin.DefaultPluginManager.executeMojo(DefaultPluginManager.java:451) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoals(DefaultLifecycleExecutor.java:558) ... 16 more Caused by: org.apache.maven.plugin.ear.EarPluginException: Invalid JBoss configuration, version[5] is not supported. at org.apache.maven.plugin.ear.JbossConfiguration.(JbossConfiguration.java:95) at org.apache.maven.plugin.ear.AbstractEarMojo.initializeJbossConfiguration(AbstractEarMojo.java:296) at org.apache.maven.plugin.ear.AbstractEarMojo.execute(AbstractEarMojo.java:155) ... 19 more [INFO] ------------------------------------------------------------------------ [INFO] Total time: 2 seconds Any idea. Thanks

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • List of checkboxes

    - by Andrea Girardi
    Hi all, Happy New Year to all. I'm a newbie in VB.NET and ASP.NET. This is my problem: I retrieve a list of records from DB and, for every row, I need to show 4 checkboxes. I can use a checkboxlist for every rows, but it's not so clear how I can process the results after the submit. I've some object and some operations available for that object. From database I extract a list of object with all operations. For every operation I want to show a check box to enable or disable the operation. The result is something like that: OBJ1 - url - [] [x] [] OBJ2 - url - [] [x] [x] On url I've an href to another page created using the Id retrieved from DB. To create that I used this code: <td class="column-filename"> <strong> <asp:Label runat="server" Text='<%#DataBinder.Eval(Container.DataItem, "GroupName")%>'></asp:Label> </strong> </td> <td align="left"> <span style="vertical-align:middle"> <asp:CheckBoxList runat="server" ID="operations" RepeatDirection="Horizontal" RepeatLayout="Table"> <asp:ListItem Text="View"></asp:ListItem> <asp:ListItem Text="Upload"></asp:ListItem> <asp:ListItem Text="Move"></asp:ListItem> <asp:ListItem Text="Delete"></asp:ListItem> <asp:ListItem Text="Rename"></asp:ListItem> <asp:ListItem Text="Replace"></asp:ListItem> </asp:CheckBoxList> </span> </td> </asp> </asp> my problem is: how can I parse all checkboxes? could you help me or send me a link or any other resources to solve my issue? many thanks! Andrea

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to properly preload images, js and css files?

    - by Kenny Bones
    Hi, I'm creating a website from scratch and I was really into this in the late 90's but the web has changed alot since then! And I'm more of a designer so when I started putting this site together, I basically did a system of php includes to make the site more "dynamic" When you first visit the site, you'll be presented to a logon screen, if you're not already logged on (cookies). If you're not logged on, a page called access.php is introdused. I thought I'd preload the most heavy images at this point. So that when the user is done logging on, the images are already cached. And this is working as I want. But I still notice that the biggest image still isn't rendered immediatly anyway. So it's seems kinda pointless. All of this has made me rethink how the site is structured and how scripts and css files are loaded. Using FireBug and YSlow with Firefox I see a few pointers like expires headers and reducing the size of each script. But is this really the culprit? For example, would this be really really stupid in the main index.php? The entire site is basically structured like this <?php require("dbconnect.php"); ?> <?php include ("head.php"); ?> And below this is basically just the body and the content of the site. Head.php however consists of the doctype, head portions, linking of two css style sheets, jQuery library, jQuery validation engine, Cufon and Cufon font file, and then the small Cufon.Replace snippet. The rest of the body comes with the index.php file, but at the bottom of this again is an include of a file called "footer.php" which basically consists of loading of a couple of jsLoader scripts and a slidepanel and then a js function. All of this makes the end page source look like a typical complete webpage, but I'm wondering if any of you can see immediatly that "this is really really stupid" and "don't do that, do this instead" etc. :) Are includes a bad way to go? This site is also pretty image intensive and I can probably do a little more optimization. But I don't think that's its the primary culprit. YSlow gives me a report of what takes up the most space: doc(1) - 5.8K js(5) - 198.7K css(2) - 5.6K cssimage(8) - 634.7K image(6) - 110.8K I know it looks like it's cssimage(8) that weighs the most, but I've already preloaded these images from before and it doesn't really affect the rendering.

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • Commitment to Zend Framework - any arguments against?

    - by Pekka
    I am refurbishing a big CMS that I have been working on for quite a number of years now. The product itself is great, but some components, the Database and translation classes for example, need urgent replacing - partly self-made as far back as 2002, grown into a bit of a chaos over time, and might have trouble surviving a security audit. So, I've been looking closely at a number of frameworks (or, more exactly, component Libraries, as I do not intend to change the basic structure of the CMS) and ended up with liking Zend Framework the best. They offer a solid MVC model but don't force you into it, and they offer a lot of professional components that have obviously received a lot of attention (Did you know there are multiple plurals in Russian, and you can't translate them using a simple ($number == 0) or ($number > 1) switch? I didn't, but Zend_Translate can handle it. Just to illustrate the level of thorougness the library seems to have been built with.) I am now literally at the point of no return, starting to replace key components of the system by the Zend-made ones. I'm not really having second thoughts - and I am surely not looking to incite a flame war - but before going onward, I would like to step back for a moment and look whether there is anything speaking against tying a big system closely to Zend Framework. What I like about Zend: As far as I can see, very high quality code Extremely well documented, at least regarding introductions to how things work (Haven't had to use detailed API documentation yet) Backed by a company that has an interest in seeing the framework prosper Well received in the community, has a considerable user base Employs coding standards I like Comes with a full set of unit tests Feels to me like the right choice to make - or at least, one of the right choices - in terms of modern, professional PHP development. I have been thinking about encapsulating and abstracting ZF's functionality into own classes to be able to switch frameworks more easily, but have come to the conclusion that this would not be a good idea because: it would be an unnecessary level of abstraction it could cost performance the big advantage of using a framework - the existence of a developer base that is familiar with its components - would partly be cancelled out therefore, the commitment to ZF would be a deep one. Thus my question: Is there anything substantial speaking against committing to the Zend Framework? Do you have insider knowledge of plans of Zend Inc.'s to go evil in 2011, and make it a closed source library? Is Zend Inc. run by vampires? Are there conceptual flaws in the code base you start to notice when you've transitioned all your projects to it? Is the appearance of quality code an illusion? Does the code look good, but run terribly slow on anything below my quad-core workstation?

    Read the article

  • removing contents of div using Jquery "empty" doesn't work

    - by Andrew
    I'm trying to remove contents of particular div which are basically list items and a heading by using jquery empty so that I could replace with new contents. What happens when I run the code is, the whole div element blinked and flash the replaced content and then the old one reappear. Can anyone tell me what am I doing wrong? Here's an excerpt of my code - <pre> $("#msg_tab").bind("click",function(){ $("#sidebar1").remove(); var html="<ul><li><h2>test</h2><ul><li><a href='#'>Compose New Message</a></li><li><a href='#'>Inbox</a></li><li><a href='#'>Outbox</a></li><li><a href='#'>Unread</a></li><li><a href='#'>Archive</a></li></ul></li></ul>"; $("#sidebar1").append(html); }); <div id="sidebar1" class="sidebar"> <ul> <li> <h2>Messages</h2> <ul> <li><a href="#">Compose New Message</a></li> <li><a href="#">Inbox</a></li> <li><a href="#">Outbox</a></li> <li><a href="#">Unread</a></li> <li><a href="#">Archive</a></li> </ul> </li> </ul> </div> Another question is, how do I write multiple line html code string in javascript so that java would recognize as a string value? Placing forward slash at the end is ok when the string is not a html code but, in html code, I can't figure out how to escape forward slash from ending tags.I've tried escaping it with backward slash but doesn't work. I would be appreciated if anyone could shed a light on this matter as well.

    Read the article

  • How not to abort http response c#

    - by user194076
    I need to run several methods after sending file to a user for a download. What happens is that after I send a file to a user, response is aborted and I can no longer do anything after response.end(). for example, this is my sample code: Response.Clear(); Response.AddHeader("content-disposition", "attachment; filename=test.pdf"); Response.ContentType = "application/pdf"; byte[] a = System.Text.Encoding.UTF8.GetBytes("test"); Response.BinaryWrite(a); Response.End(); StartNextMethod(); Response.Redirect(URL); So, in this example StartNextMethod and Response.Redirect are not executing. What I tried is I created a separate handler(ashx) with the following code: public void ProcessRequest(HttpContext context) { context.Response.Clear(); context.Response.AddHeader("content-disposition", "attachment; filename=test.pdf"); context.Response.ContentType = "application/pdf"; byte[] a = System.Text.Encoding.UTF8.GetBytes("test"); context.Response.BinaryWrite(a); context.Response.End(); } and call it like this: Download d = new Download(); d.ProcessRequest(HttpContext.Current); StartNextMethod(); Response.Redirect(URL); but the same error happen. I've tryied to replace Response.End with CompleteRequest but it doesn't help. I guess the problem is that I'm using HttpContext.Current but should use a separate response stream. Is that correct? how do I do that in a separate method generically (Assume that I want my handler to accept byte array of data and content type and be downloadable from a separate response. I really do not want to use a separate page for a response. UPDATE I still didn't find a good solution. I'd like to do some actions after user has downloaded a file, but without using a separate page for a response\request thing.

    Read the article

  • Trouble with ASP.NET MVC auto-scaffolder template

    - by DanM
    I'm trying to write an auto-scaffolder template for Index views. I'd like to be able to pass in a collection of models or view-models (e.g., IQueryable<MyViewModel>) and get back an HTML table that uses the DisplayName attribute for the headings (th elements) and Html.Display(propertyName) for the cells (td elements). Each row should correspond to one item in the collection. Here's what I have so far: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl" %> <% var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; // How do I make this generic? var properties = items.First().GetMetadata().Properties .Where(pm => pm.ShowForDisplay && !ViewData.TemplateInfo.Visited(pm)); %> <table> <tr> <% foreach(var property in properties) { %> <th> <%= property.DisplayName %> </th> <% } %> </tr> <% foreach(var item in items) { HtmlHelper itemHtml = ????; // What should I put in place of "????"? %> <tr> <% foreach(var property in properties) { %> <td> <%= itemHtml.Display(property.DisplayName) %> </td> <% } %> </tr> <% } %> </table> Two problems with this: I'd like it to be generic. So, I'd like to replace var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; with var items = (IQueryable<T>)Model; or something to that effect. A property Html is automatically created for me when the view is created, but this HtmlHelper applies to the whole collection. I need to somehow create an itemHtml object that applies just to the current item in the foreach loop. I'm not sure how to do this, however, because the constructors for HtmlHelper don't take a Model object. How do I solve these two problems?

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • Thread sleep and thread join.

    - by Dhruv Gairola
    hi guys, if i put a thread to sleep in a loop, netbeans gives me a caution saying Invoking Thread.sleep in loop can cause performance problems. However, if i were to replace the sleep with join, no such caution is given. Both versions compile and work fine tho. My code is below (check the last few lines for "Thread.sleep() vs t.join()"). public class Test{ //Display a message, preceded by the name of the current thread static void threadMessage(String message) { String threadName = Thread.currentThread().getName(); System.out.format("%s: %s%n", threadName, message); } private static class MessageLoop implements Runnable { public void run() { String importantInfo[] = { "Mares eat oats", "Does eat oats", "Little lambs eat ivy", "A kid will eat ivy too" }; try { for (int i = 0; i < importantInfo.length; i++) { //Pause for 4 seconds Thread.sleep(4000); //Print a message threadMessage(importantInfo[i]); } } catch (InterruptedException e) { threadMessage("I wasn't done!"); } } } public static void main(String args[]) throws InterruptedException { //Delay, in milliseconds before we interrupt MessageLoop //thread (default one hour). long patience = 1000 * 60 * 60; //If command line argument present, gives patience in seconds. if (args.length > 0) { try { patience = Long.parseLong(args[0]) * 1000; } catch (NumberFormatException e) { System.err.println("Argument must be an integer."); System.exit(1); } } threadMessage("Starting MessageLoop thread"); long startTime = System.currentTimeMillis(); Thread t = new Thread(new MessageLoop()); t.start(); threadMessage("Waiting for MessageLoop thread to finish"); //loop until MessageLoop thread exits while (t.isAlive()) { threadMessage("Still waiting..."); //Wait maximum of 1 second for MessageLoop thread to //finish. /*******LOOK HERE**********************/ Thread.sleep(1000);//issues caution unlike t.join(1000) /**************************************/ if (((System.currentTimeMillis() - startTime) > patience) && t.isAlive()) { threadMessage("Tired of waiting!"); t.interrupt(); //Shouldn't be long now -- wait indefinitely t.join(); } } threadMessage("Finally!"); } } As i understand it, join waits for the other thread to complete, but in this case, arent both sleep and join doing the same thing? Then why does netbeans throw the caution?

    Read the article

  • SVG via dynamic XML+XSL

    - by Daniel
    This is a bit of a vague notion which I have been running over in my head, and which I am very curious if there is an elegant method of solving. Perhaps it should be taken as a thought experiment. Imagine you have an XML schema with a corresponding XSL transform, which renders the XML as SVG in the browser. The XSL generates SVG with appropriate Javascript handlers that, ultimately, implement editing-like functionality such that properties of the objects or their locations on the SVG canvas can be edited by the user. For instance, an element can be dragged from one location to another. Now, this isn't particularly difficult - the drag/drop example is simply a matter of changing the (x,y) coordinates of the SVG object, or a resize operation would be a simple matter of changing its width or height. But is there an elegant way to have Javascript work on the DOM of the source XML document instead of the rendered SVG? Why, you ask? Well, imagine you have very complex XSL transforms, where the modification of one property results in complex changes to the SVG. You want to maintain simplicity in your Javascript code, but also a simple way to persist the modified XML back to the server. Some possibilities of how this may function: After modification of the source DOM, simply re-run the XSL transform and replace the original. Downside: brute force, potentially expensive operation. Create id/class naming conventions in the source and target XML/SVG so elements can be related back to each other, and do an XSL transform on only a subset of the new DOM. In other words, modify temporary DOM, apply XSL to it, remove changed elements from SVG, and insert the new one. Downside: May not be possible to apply XSL to temporary in-browser DOMs(?). Also, perhaps a bit convoluted or ugly to maintain. I think that it may be possible to come up with a framework that handles the second scenario, but the challenge would be making it lightweight and not heavily tied to the actual XML schema. Any ideas or other possibilities? Or is there maybe an existing method of doing this which I'm not aware of? UPDATE: To clarify, as I mentioned in a comment below, this aids in separating the draw code from the edit code. For a more concrete example of how this is useful, imagine an element which determines how it is drawn dependent on the value of a property of an adjacent element. It's better to condense that logic directly in the draw code instead of also duplicating it in the edit code.

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

< Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >