Search Results

Search found 29502 results on 1181 pages for 'line segment'.

Page 381/1181 | < Previous Page | 377 378 379 380 381 382 383 384 385 386 387 388  | Next Page >

• UIViewController is popped from view stack and NSURLConnection crashes the application

  - by rickharrison

  I am pushing a UIViewController onto a UINavigationController. This view controller immediately starts a download of an xml feed and then parses it. However, if you hit the back button before it is done downloading, and crashes with EXC_BAD_ACCESS. The line that is crashing it is in parserDidEndDocument and is this line: if (self.delegate && [self.delegate conformsToProtocol:@protocol(ModelDelegate)]) [self.delegate modelDidFinishParsing:self]; I assume it is crashing because it is trying to access self.delegate which is not assigned anymore. How do I get around this? Also, I would release the model object in the modelDidFinishParsing method. How would I release this model if it never reaches this method.

  Read the article

• Finding rank of the student -Sql Compact

  - by Jankhana

  I have a table like this : Name Mar1 Mar2 Mar3 Total xxx 80 80 80 240 yyy 60 70 50 180 aaa 85 65 75 225 I wanted to find the rank of the student based on total. I using SQL Compact 3.5 . As we have rank() function in sql server do we have something with which we can find the students rank??? When I used "select Total,rank() over (order by total desc) i1 from stmarks " it's giving error as " Major Error 0x80040E14, Minor Error 25501 select Total,rank() over (order by total desc) i1 from stmarks There was an error parsing the query. [ Token line number = 1,Token line offset = 21,Token in error = over ] " Do Sql Compact support rank() over or is there any another way???

  Read the article

• HASHREF in Perl

  - by Uri

  I'm trying to decrypt a Perl code which I'm not familiar with, somehow related to HashRef. I'm using Amazon::S3, but my question is a general Perl question. See the code below: use Amazon::S3; my $s3 = Amazon::S3-new( ... ); my $response = $s3-buckets; Documentation (here) sais, about s3-buckets: Returns undef on error, else HASHREF of results The following line is working for me, but I don't understand why: for $b in ( @ { $response-{buckets} } ) { print "bucket: " . $b-bucket . "\n"; } I'm buzzled by each operator on the first line. What type exactly are $response, $respone-{bucket}. Looks like the expression within the 'for' is an array, but I don't understand this syntax: @{ ... }?

  Read the article

• NSURLConnection shown as leaking in instruments

  - by Gyozo Kudor

  Hello another stupid question regarding leaks and also NSURLConnection. How do i release it? Is it enough if i release in the following 2 methods? (void)connection:(NSURLConnection *)connection didFailWithError:(NSError *)error (void)connectionDidFinishLoading:(NSURLConnection *)connection Because in instruments it shows me the line where I alloc my connection as the source of leaking. OK I don't get it. After the following code my urlConnection has a retain count of 2. WTF? NSURLConnection *urlConnection = [[NSURLConnection alloc] initWithRequest: urlRequest delegate: self]; This is the line that instruments points me to. I find this very weird.

  Read the article

• ASP.NET Treeview Control not expanding on click

  - by Scott Vercuski

  I having an issue with the ASP.NET Treeview control. I create the treeview just fine but the nodes will not expand or collapse. I see there is a javascript error but it is for line 1 character 0 of the webpage, there is nothing at line 1 character 0. I am using the ASP:Treeview control in conjunction with the Telerik controls, but I'm not sure if that is an issue. I saw there was a similar question here but the answer is not pertinent to my site. Has anyone run into this issue before? I've tried searching Google and tried a number of proposed solutions but so far none have worked. Thank you,

  Read the article

• Is it hard problem?

  - by Lukasz Lew

  I can't solve it: You are given 8 integers: A, B, C representing a line on a plane with equation A*x + B*y = C a, b, c representing another line x, y representing a point on a plane The two lines are not parallel therefore divide plane into 4 pieces. Point (x, y) lies inside of one these pieces. Problem: Write a fast algorithm that will find a point with integer coordinates in the same piece as (x,y) that is closest to the cross point of the two given lines. Note: This is not a homework, this is old Euler-type task that I have absolutely no idea how to approach.

  Read the article

• Can I test for the end of the content of a text/plain file with Selenium or javascript?

  - by fool4jesus

  I have a page that results in a text/plain file being displayed in the browser that looks like this: ... Admin Site Administration 2010-04-21 22:26:34 [email protected] Test Site Bob Smith 2010-04-21 22:27:09 [email protected] Admin Site Administration 2010-04-21 22:29:26 [email protected] I am trying to write a Selenium test against this that verifies the last line of the file has "[email protected]" at the end. How would you do this? I can't depend on the date/time as this is a login report that is constantly getting updated - all I want is to ensure that the last line ends with that email address. And I can't figure out how to do it using Selenium expressions, DOM, or XPath.

  Read the article

• How to compare if string has a enter key in the end using jquery/javascript?

  - by user144842

  I have a string value from a user input box. I have to figure out if last char is a enter key (line feed). Thats the code. Here I am checking if last char has a whitespace. Now I also have to check if last char is enter key (carriage return or line feed). How can i do this? var txt = $get("<%= txtUserText.ClientID %>"); if (txt.value.substring(txt.value.length -1) !== ' ' || <checkifLastCharIsEnterKey>) //my code to take action **I don't think i need a keypress or keyup event because this above piece of code is not invoked at the time of user input.

  Read the article

• how to show the right word in my code, my code is : os.urandom(64)

  - by zjm1126

  My code is: print os.urandom(64) which outputs: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" \xd0\xc8=<\xdbD' \xdf\xf0\xb3>\xfc\xf2\x99\x93 =S\xb2\xcd'\xdbD\x8d\xd0\\xbc{&YkD[\xdd\x8b\xbd\x82\x9e\xad\xd5\x90\x90\xdcD9\xbf9.\xeb\x9b>\xef#n\x84 which isn't readable, so I tried this: print os.urandom(64).decode("utf-8") but then I get: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" Traceback (most recent call last): File "D:\zjm_code\a.py", line 17, in <module> print os.urandom(64).decode("utf-8") File "D:\Python25\lib\encodings\utf_8.py", line 16, in decode return codecs.utf_8_decode(input, errors, True) UnicodeDecodeError: 'utf8' codec can't decode bytes in position 0-3: invalid data What should I do to get human-readable output?

  Read the article

• Same-directory includes failing on a Fedora server with PHP.

  - by JimmySawczuk

  I have a couple files that look like this: index.php: <?php include('includes/header.php'); ... includes/header.php: <?php include('config.php'); ... The error I get is Warning: require(config.php) [function.require]: failed to open stream: No such file or directory in [dir]/includes/header.php on line 2 Fatal error: require() [function.require]: Failed opening required 'config.php' (include_path='.:/usr/share/pear:/usr/share/php') in [dir]/includes/header.php on line 2 I did some further debugging: when I add the call system('pwd'); to includes/header.php, it shows [dir], where it should say [dir]/includes. Adding the 'includes/' to the include path works, but isn't desirable because that would fail on the production server. The above code works on a production server, and worked fine on my development Fedora server, until I tried to change my development environment so that the Fedora server's document root is a mounted CIFS share. Any ideas? Thanks.

  Read the article

• consts and other animals

  - by bks

  Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Kerning problems when drawing text character by character

  - by shekel

  I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

  Read the article

• Template class implicit copy constructor issues

  - by Nate

  Stepping through my program in gdb, line 108 returns right back to the calling function, and doesn't call the copy constructor in class A, like (I thought) it should: template <class S> class A{ //etc... A( const A & old ){ //do stuff... } //etc... }; template <class T> class B{ //etc... A<T> ReturnsAnA(){ A<T> result; // do some stuff with result return result; //line 108 } //etc... }; Any hints? I've banged my head against the wall about this for 4 hours now, and can't seem to come up with what's happening here.

  Read the article

• how to manage formating of text when read a save file?

  - by moon

  hello i have a java applet application in which i use rich text area . i write URDU the national language of PAKISTAN. i managed to do so with uni codes. the problem is, when i write urdu in text area and select a font and color for each line it do all of this but when i save this file using UTF-8 encoding and then open it again it shows all text formatted as i choose format of last line. my requirement is to open file as it is saved. i mean each file should have same formatting as i done before saving.

  Read the article

• What's wrong in this SELECT statement

  - by user522211

  Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Dim SQLData As New System.Data.SqlClient.SqlConnection("Data Source=.\SQLEXPRESS;AttachDbFilename=|DataDirectory|\Database.mdf;Integrated Security=True;User Instance=True") Dim cmdSelect As New System.Data.SqlClient.SqlCommand("SELECT * FROM Table1 WHERE Seats ='" & TextBox1.Text & "'", SQLData) SQLData.Open() Using adapter As New SqlDataAdapter(cmdSelect) Using table As New Data.DataTable() adapter.Fill(table) TextBox1.Text = [String].Join(", ", table.AsEnumerable().[Select](Function(r) r.Field(Of Integer)("seat_select"))) End Using End Using SQLData.Close() End Sub This line will be highlighted with blue line: TextBox1.Text = [String].Join(", ", table.AsEnumerable().[Select](Function(r) r.Field(Of Integer)("seat_select")))

  Read the article

• Cannot redeclare class but there are no other classes with that name

  - by hsz

  Hello ! I am working right now with Zend Framework and I've created a Model_User_Row in app\models\User\Row.php. When I try to create an instance of that class in IndexController I get an error: Fatal error: Cannot redeclare class Model_User_Row in F:\Projekty\www\inz\app\models\User\Row.php on line 14 14th line is a close brace. <?php class Model_User_Row extends Zend_Db_Table_Row { /** * @return array */ public function toArray() { $res = parent::toArray(); unset($res['password']); return $res; } } // #14 In my project I have no other class called Model_User_Row. I am a bit confused - how to debug this case ?

  Read the article

• What is this for an IP in my google app engine log file?

  - by Christian Harms

  I get many normal log lines in my google app engine application. But today I go these instead the 4-part number: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 What is this for an format? ipv6 are 6 numbers, mac address too... Normal logfile line: 187.14.44.208 - - [19/Mar/2010:14:31:35 -0700] "GET /geo_data.js HTTP/1.1" 200 776 "http://www.xxx.com.br/spl19/index.php?refid=gv_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 5.1; pt-BR; rv:1.9.2) Gecko/20100115 Firefox/3.6 (.NET CLR 3.5.30729),gzip(gfe)" This special logfile line: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 - - [18/Mar/2010:17:00:37 -0700] "GET /geo_data.js HTTP/1.1" 500 450 "http://www.xxx.com.br/spl19/index.php?refid=cm_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 6.1; pt-PT; rv:1.9.2) Gecko/20100115 Firefox/3.6,gzip(gfe)"

  Read the article

• Flash AS3: automate property assignment to new instance from arguments in constructor

  - by matt lohkamp

  I like finding out about tricky new ways to do things. Let's say you've got a class with a property that gets set to the value of an argument in the constructor, like so: package{ public class SomeClass{ private var someProperty:*; public function SomeClass(_someProperty:*):void{ someProperty = _someProperty; } } } That's not exactly a hassle. But imagine you've got... I don't know, five properties. Ten properties, maybe. Rather then writing out each individual assignment, line by line, isn't there a way to loop through the constructor's arguments and set the value of each corresponding property on the new instance accordingly? I don't think that the ...rest or arguments objects will work, since they only keep an enumerated list of the arguments, not the argument names - I'm thinking something like this would be better: for(var propertyName:String in argsAsAssocArray){this[propertyName] = argsAsAssocArray[propertyName];} ... does something like this exist?

  Read the article

• HD Crash SQL server -> DBCC - consistency errors in table 'sysindexes'

  - by Julian de Wit

  Hello A client of mine has had an HD crash an a SQL DB got corrupt : They did not make backups so they have a big problem. When I tried (an ultimate measure) to DBCC-repair I got the following message. Can anybody help me with this ? Server: Msg 8966, Level 16, State 1, Line 1 Could not read and latch page (1:872) with latch type SH. sysindexes failed. Server: Msg 8944, Level 16, State 1, Line 1 Table error: Object ID 2, index ID 0, page (1:872), row 11. Test (columnOffsets->IsComplex (varColumnNumber) && (ColumnId == COLID_HYDRA_TEXTPTR || ColumnId == COLID_INROW_ROOT || ColumnId == COLID_BACKPTR)) failed. Values are 2 and 5. The repair level on the DBCC statement caused this repair to be bypassed. CHECKTABLE found 0 allocation errors and 1 consistency errors in table 'sysindexes' (object ID 2). DBCC execution completed. If DBCC printed error messages, contact your system administrator.

  Read the article

• urllib alternative for iPhone

  - by Pr301

  hi, I am trying to create an iPhone application which in some point connects to the internet, fills an on-line form, fetches the resulting website, parses it and returns a string to the user. I want all this process to happen in the background. I know how to do this kind of things with python and urllib but in objc I can't find an alternative, from on-line search I found either sites that explain how to use webkit to retrieve webpages (I suppose this is for displaying them to the user) or how to parse an existing HTML file or string. Since I want the file to be retrieved from the internet and the whole process should be running in the background, neither of these solutions covers my needs.

  Read the article

• Writing Java code in Matlab?

  - by scooziexp

  Hi, I'm trying to use the Java commands pw.println() and br.readLine() in Matlab because I have set up a socket (input_socket2) between Matlab and a command-line program I want to control using Java classes BufferedReader and PrintWriter. Before the following snippet of code, I implemented another socket that goes between 2 computers. This works great and I also know that the following snippet of code successfully opens up a communication line between Matlab and the other program. However, Matlab throws an error at pw.println('noop'). I think it has something to do with syntax, but I'm not sure how to write the command in Matlab syntax then: try input_socket2 = Socket(host2,port2); input_stream2 = input_socket2.getInputStream; d_input_stream2 = DataInputStream(input_stream2); br = BufferedReader(InputStreamReader(input_stream2)); pw = PrintWriter(input_socket2.getOutputStream,true); pw.println('noop') br.read end Any ideas?

  Read the article

• MVC Html Layout C# code formatting

  - by Andrew Florko

  I insert into asp.net mvc views C# logic that manages layout like the following: <% if (Model.People.Count > 0 ) { %> <% foreach (var person in Model.People) { %> ... <% }} else { %> <span class="error">Sorry, no people</span> <%} %> I try to minimize <% % code placing "{" symbol on the same line as it's condition (java-style). Html layout looks more clear to me after that. Do you apply C# formatting rules to <% % html injections "}" should be on a new line or manage layout in different way? Thank you in advance!

  Read the article

• How to read and write UTF-8 to disk on the Android?

  - by Rob Kent

  I cannot read and write extended characters (French accented characters, for example) to a text file using the standard InputStreamReader methods shown in the Android API examples. When I read back the file using: InputStreamReader tmp = new InputStreamReader(in); BufferedReader reader = new BufferedReader(tmp); String str; while ((str = reader.readLine()) != null) { ... the string read is truncated at the extended characters instead of at the end-of-line. The second half of the string then comes on the next line. I'm assuming that I need to persist my data as UTF-8 but I cannot find any examples of that, and I'm new to Java. Can anyone provide me with an example or a link to relevant documentation?

  Read the article

• Running OpenMPI on Windows XP

  - by iamweird

  Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

  Read the article

< Previous Page | 377 378 379 380 381 382 383 384 385 386 387 388  | Next Page >