Search Results

Search found 39207 results on 1569 pages for 'foreign function interfac'.

Page 568/1569 | < Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • autocomplete: how do I avoid a duplicate search?

    - by dnagirl
    I use JQuery plugin autocomplete as a kind of dataset chooser. If the user chooses a value from the autocomplete lookup, the database is queried for the matching dataset. If the user types in a new value, the user can enter a new dataset. An issue arises when the user types in an existing value rather than choosing it from the autocomplete lookup. When this is done, the autocomplete .result() method is not called and no dataset is retrieved. To fix this I added a .blur(function(){$(this).search();}); to the input element. This fixed the original problem. Now I have the problem that .result() fires on selection from lookup AND on blur. I would like .result() to fire on selection from lookup OR on blur. How do I make that happen? Here is my code: $('#groupset').autocomplete('ajax/php/leeruns.php'); $('#groupset').result( function(event, data, formatted) { if(data){ $('#groupsetdesc').val(formatted); groups.load(data[1]); //retrieve matching dataset } else { $('#groupsetdesc').val(''); } } ).blur(function(){$(this).search();});

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • Jquery tabs with cookie support restore wrong tab position after page refresh.

    - by zenonych
    Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

    Read the article

  • PHP modifying and combining array

    - by Industrial
    Hi everyone, I have a bit of an array headache going on. The function does what I want, but since I am not yet to well acquainted with PHP:s array/looping functions, so thereby my question is if there's any part of this function that could be improved from a performance-wise perspective? I tried to be as complete as possible in my descriptions in each stage of the functions which shortly described prefixes all keys in an array, fill up eventual empty/non-valid keys with '' and removes the prefixes before returning the array: $var = myFunction ( array('key1', 'key2', 'key3', '111') ); function myFunction ($keys) { $prefix = 'prefix_'; $keyCount = count($keys); // Prefix each key and remove old keys for($i=0;$i<$keyCount; $i++){ $keys[] = $prefix.$keys[$i]; unset($keys[$i]); } // output: array('prefix_key1', 'prefix_key2', 'prefix_key3', '111) // Get all keys from memcached. Only returns valid keys $items = $this->memcache->get($keys); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3) // note: key 111 was not found in memcache. // Fill upp eventual keys that are not valid/empty from memcache $return = $items + array_fill_keys($keys, ''); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3, 'prefix_111' => '') // Remove the prefixes for each result before returning array to application foreach ($return as $k => $v) { $expl = explode($prefix, $k); $return[$expl[1]] = $v; unset($return[$k]); } // output: array('key1' => 'value1', 'key2' => 'value2', 'key3'=>'value3, '111' => '') return $return; } Thanks a lot!

    Read the article

  • Load iframe in html, only with jquery

    - by phpExe
    In this jquery code: $(document).ready(function(){ $list = $(".channeList li"); $list.click(function(){ var $this = $(this); var $mainDesc = $(".ply"); var iframe = $("a", $this).attr("rel"); $("iframe", $mainDesc).attr("src", iframe); } ); } ); There is a list o channels in left that iframe loads from a rel's. I want to load first iframe in <div class="ply"></div> In html, I dont want insert the first item. Can we do this without load first item in html and do this only with jquery? The php function channel() { if (is_numeric($_GET['kanalID'])) { $kanalID = $_GET['kanalID']; } if ($_GET['kanalID'] == "") { $kanalID = 1;} $channel = '<ul class="channeList">'; foreach ($tv as $id => $kanal) { $class = $kanalID == $id ? $class = "currentt": ''; $channel .= '<li> <a href="#" rel="http://mysite.com/index.php?id='.$id.'&w=500&h=320" >'.$kanal.'</a></li>'; } $channel .= '</ul>'; $channel .= '<div class="ply"><iframe frameborder=0 width="500" height="320"></iframe></div>'; return $channel; } Thanks in advance

    Read the article

  • how to display two li in time intervel using jquery

    - by abc
    <html> <head> <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.4.js"></script> <style type="text/css"> body { color:green; } </style> <script type="text/javascript"> $(document).ready(function() { setInterval(findYellow,1000); function findYellow() { $("ul").each(function() { var $this = $(this); if($this.css("color") != "green") { $this.css("color", "green"); $this.text("abcd blue"); } else { $this.css("color", "blue"); $this.text("abcd green"); } }); } }); </script> </head> <body> <ul>This is a sample set <li>1</li> <li>3</li> <li>5</li> <li>7</li> <li>9</li> </ul> </body> </html>

    Read the article

  • Visual Studio 2008 linker wants all symbols to be resolved, not only used ones

    - by user343011
    We recently upgraded to Visual Studio 2008 from 2005, and I think those error started after that. In our solution, we have a multitude of projects. Many of those are utility projects, or projects containing core functionality used by other projects. The output of those is lib files that are linked to when building the projects generating the final binaries using the "Project dependencies..." option. One of the other projects---Let us call it ResultLib---generates a DLL, and it needs one single function from the core project. This function uses only static function from its own source file, but the project in its entirety uses a lot of low-level Windows functions and also imports a DLL---Let us call it Driver.dll. Our problem is that when building ExtLib, the linker complains about a multitude of unresolved externals, for example all functions exported from Driver.dll, since its lib file is not specified when linking. If we try to fix this by adding all lib files used by other projects that use all of the core project, our resulting ResultLib DLL ends up importing Driver.dll and also exporting all functions defined in it. How do we tell Visual Studio to only try to resolve symbols that are actually used?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • _beginthreadx and socket

    - by user638197
    hi, i have a question about the _beginthreadx function In the third and fourth parameter: if i have this line to create the thread hThread=(HANDLE)_beginthreadex(0,0, &RunThread, &m_socket,CREATE_SUSPENDED,&threadID ); m_socket is the socket that i want inside the thread (fourth parameter) and i have the RunThread function (third parameter) in this way static unsigned __stdcall RunThread (void* ptr) { return 0; } It is sufficient to create the thread independently if m_socket has something or not? Thanks in advance Thank you for the response Ciaran Keating helped me understand better the thread I'll explain a little more the situation I´m creating the tread in this function inside a class public: void getClientsConnection() { numberOfClients = 1; SOCKET temporalSocket = NULL; firstClient = NULL; secondClient = NULL; while (numberOfClients < 2) { temporalSocket = SOCKET_ERROR; while (temporalSocket == SOCKET_ERROR) { temporalSocket = accept(m_socket, NULL, NULL); //----------------------------------------------- HANDLE hThread; unsigned threadID; hThread=(HANDLE)_beginthreadex(0,0, &RunThread, &m_socket,CREATE_SUSPENDED,&threadID ); WaitForSingleObject( hThread, INFINITE ); if(!hThread) printf("ERROR AL CREAR EL HILO: %ld\n", WSAGetLastError()); //----------------------------------------------- } if(firstClient == NULL) { firstClient = temporalSocket; muebleC1 = temporalSocket; actionC1 = temporalSocket; ++numberOfClients; printf("CLIENTE 1 CONECTADO\n"); } else { secondClient = temporalSocket; muebleC2 = temporalSocket; actionC2 = temporalSocket; ++numberOfClients; printf("CLIENTE 2 CONECTADO\n"); } } } What i'm trying to do is to have the socket inside the thread while wait for a client connection Is this feasible as i have the code of the thread? I can change the state of the thread that is not a problem Thanks again

    Read the article

  • Segmentation fault on certain inputs and not others

    - by Brandon Schwandt
    Heres a function I wrote that has some debugging elements in it already. When i enter either a "y" or a "Y" as the input I get a segmentation fault during runtime. When I enter any other value the code runs. The seg fault kicks out after it scans and gives me the response but before the "scan worked" line is output. DOn't know why it would act like this only on these values. If anyone needs the function call I have that as well. query_user(char *response [10]) { printf("response after query call before clear=%s\n",response); strcpy(response,""); printf("response after clearing before scan=%s\n",response); printf("Enter another person into the line? y or n\n"); scanf("%s", response); printf("response after scan=%s\n",response); printf("scan worked"); } main() { char response [10]; strcpy(response,"y"); printf("response=%s\n",response); printf("When finished with program type \"done\" to exit\n"); while (strcmp(response,"done") != 0) { printf("response after while loop and before query call=%s\n",response); query_user(&response); } } output on error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n y response after scan=y Segmentation Fault (core dumped) output on non-error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n n response after scan=n scan worked Cycle number 0 (program continues to run outside this function)

    Read the article

  • Handling Apache Thrift list/map Return Types in C++

    - by initzero
    First off, I'll say I'm not the most competent C++ programmer, but I'm learning, and enjoying the power of Thrift. I've implemented a Thrift Service with some basic functions that return void, i32, and list. I'm using a Python client controlled by a Django web app to make RPC calls and it works pretty well. The generated code is pretty straight forward, except for list returns: namespace cpp Remote enum N_PROTO { N_TCP, N_UDP, N_ANY } service Rcon { i32 ping() i32 KillFlows() i32 RestartDispatch() i32 PrintActiveFlows() i32 PrintActiveListeners(1:i32 proto) list<string> ListAllFlows() } The generated signatures from Rcon.h: int32_t ping(); int32_t KillFlows(); int32_t RestartDispatch(); int32_t PrintActiveFlows(); int32_t PrintActiveListeners(const int32_t proto); int64_t ListenerBytesReceived(const int32_t id); void ListAllFlows(std::vector<std::string> & _return); As you see, the ListAllFlows() function generated takes a reference to a vector of strings. I guess I expect it to return a vector of strings as laid out in the .thrift description. I'm wondering if I am meant to provide the function a vector of strings to modify and then Thrift will handle returning it to my client despite the function returning void. I can find absolutely no resources or example usages of Thrift list< types in C++. Any guidance would be appreciated.

    Read the article

  • Chrome extension javascript array bug?

    - by Wayne Werner
    Hi, I'm working on a Google Chrome extension. In the popup I have the following code: var bookmarks = []; function appendBMTnode(node){ bookmarks.push([node[0].title, node[0].id]); } function addchildren(results){ for(x = 0; x < results.length; x++){ bookmarks.push([results[x].title, results[x].id]); chrome.bookmarks.getChildren(results[x].id, addchildren); } } function getallbookmarks(){ chrome.bookmarks.get('0', appendBMTnode); chrome.bookmarks.getChildren('0', addchildren); } console.debug(bookmarks.length); console.debug(bookmarks); Now, I would assume that the first command would issue the # of bookmarks I have. Indeed, when I use Chrome's debugger and add bookmarks.length to the watch list, 418 is the value. In the console of the debugger I can write bookmarks.length and it will give me the correct length. I can type for(x = 0; x < bookmarks.length; x++){ console.debug(bookmarks[x]); } and I get string representations of each inner array. However, that original console.debug(bookmarks.length) gives an output of zero. And if I add console.debug(bookmarks[0]); to the popup.html it tells me that the value is undefined. This seems like a bug to me, but my real question is how can I iterate over this list? Thanks

    Read the article

  • Core jQuery event modification problem

    - by DSKVR
    I am attempting to overwrite a core jQuery event, in this case the keydown event. My intention is to preventDefault() functionality of Left(37), Up(38), Right(39) and Down(40) to maintain the consistency of hot keys in my web application. I am using the solution provided here for the conditional charCode preventDefault problem. For some reason, my function overwrite is simply not firing, and I cannot put my finger on the problem. I am afraid that over the past 30 minutes this issue has resulted in some hair loss. Anybody have the remedy? /* Modify Keydown Event to prevent default PageDown and PageUp functionality */ (function(){ var charCodes = new Array(37,38,39,40); var original = jQuery.fn.keydown; jQuery.fn.keydown = function(e){ var key=e.charCode ? e.charCode : e.keyCode ? e.keyCode : 0; alert('now why is my keydown mod not firing?'); if($.inArray(key,charCodes)) { alert('is one of them, do not scroll page'); e.preventDefault(); return false; } original.apply( this, arguments ); } })();

    Read the article

  • Loading city/state from SQL Server to Google Maps?

    - by knawlejj
    I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

    Read the article

  • C++ read registry string value in char*

    - by Sunny
    I'm reading a registry value like this: char mydata[2048]; DWORD dataLength = sizeof(mydata); DWORD dwType = REG_SZ; ..... open key, etc ReqQueryValueEx(hKey, keyName, 0, &dwType, (BYTE*)mydata, &dataLength); My problem is, that after this, mydata content looks like: [63, 00, 3A, 00, 5C, 00...], i.e. this looks like a unicode?!?!. I need to convert this somehow to be a normal char array, without these [00], as they fail a simple logging function I have. I.e. if I call like this: WriteMessage(mydata), it outputs only "c", which is the first char in the registry. I have calls to this logging function all over the place, so I'd better of not modify it, but somehow "fix" the registry value. Here is the log function: void Logger::WriteMessage(const char *msg) { time_t now = time(0); struct tm* tm = localtime(&now); std::ofstream logFile; logFile.open(filename, std::ios::out | std::ios::app); if ( logFile.is_open() ) { logFile << tm->tm_mon << '/' << tm->tm_mday << '/' << tm->tm_year << ' '; logFile << tm->tm_hour << ':' << tm->tm_min << ':' << tm->tm_sec << "> "; logFile << msg << "\n"; logFile.close(); } }

    Read the article

  • mysql stored funtion usage

    - by shikhar
    I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

  • waiting for a signal

    - by Umesha MS
    Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

    Read the article

  • JQuery Checkbox generation

    - by Hash
    I have used the following code to generate some dynamic checkboxes. This works for the first time and adds the check box chk2 to the page and then after the trigger for the $('#newLink').click is not working. Please help me with this. <div id="chkBoxesDiv"> <input type="checkbox" id="chk1" ></input> <input id="answerText" type="text" size="30" ></input>&nbsp; <input type="button" value="add new" id="newLink"/> </div> $(document).ready(function(){ $('#newLink').click(function (event){ var i = 0; //To count the children $("#chkBoxesDiv").children().each(function(){ var child = $(this); if(child.is(":checkbox")){ i++; } }); //prevent action event.preventDefault(); //get textbox value to fill checkbox var text = $("#answerText").val(); alert(i); //if text not empty do stuff if(text != ""){ //add label $("#chk"+i).after("<label for=\"chk"+i+"\" id=\"lblchk"+i+"\">"+text+"</label>"); $("#newLink").remove(); $("#answerText").remove(); $("#lblchk1").after("<br /><input type=\"checkbox\" id=\"chk"+(1+i)+"\" ></input><input type=\"text\" id=\"answerText\" size=\"30\" ></input>&nbsp;<input type=\"button\" value=\"add new\" id=\"newLink\"/>"); } }); });

    Read the article

  • Flex customized Horizental List

    - by muzammal
    i have customized Horizontal List (items are image and some text) of a reel with some no of clips . i have customized highlight , un highlight and select style , which will be implemented dynamically and mouse over and out. now pproblem is to make un highlight previously playing clip. enter code here styleName="unhighlightedClip" updateComplete="currentlyPlaying();" rollOver="highlighted();" rollOut="unhighlighted();" .currentlyPlayingClip{ borderColor: #95123E; borderStyle: solid; borderThickness: 2; } .unhighlightedClip{ borderStyle: none; } .highlightedClip{ borderColor: #70BAE7; borderStyle: solid; borderThickness: 2; } </mx:Style> <mx:Script> <![CDATA[ import mx.controls.Alert; import mx.controls.HorizontalList; private var prevIndex:int = -1; protected function unhighlighted():void{ var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); clipDesription.useHandCursor = false; clipStartTime.useHandCursor = false; this.useHandCursor = false; if(!selected) this.setStyle('styleName', 'unhighlightedClip'); } protected function highlighted():void{ clipDesription.useHandCursor = true; clipStartTime.useHandCursor = true; this.useHandCursor = true; var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); if(!selected) this.setStyle('styleName', 'highlightedClip'); } protected function currentlyPlaying():void{ var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); var currentIndex:int = HorizontalList(this.owner).selectedIndex; if(selected) this.setStyle('styleName', 'currentlyPlayingClip'); // else if(prevIndex != currentIndex ) // this.setStyle('styleName', 'unhighlightedClip'); // // prevIndex = currentIndex; } ]]

    Read the article

  • jQuery indexOf select box manipulation

    - by kenny99
    Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

    Read the article

  • Fitting Text into an Image

    - by Abs
    Hello all, I have a function which takes in a font (ttf or otf file) and generates an image of text in different fonts. The problem I have is trying to work out how I can make the text fit in the image regardless of the font-size, type of font, and amount of text. I have tried to make the image rectangle variable so that it contains the text of different fonts without cutting a bit of the text since the image is not long or wide enough. Here is the function that I currently have, I have tried using the number of characters to determine the width of the image, but in some cases for some fonts and sizes, it still gets cut off. function generate_image($save_path, $text, $font_path){ $length = strlen($text) * 15; // Create the image $im = imagecreatetruecolor($length, 40); $white = imagecolorallocate($im, 255, 255, 255); $grey = imagecolorallocate($im, 128, 128, 128); $black = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, $length, 40, $white); $font = $font_path; imagettftext($im, 30, 0, 0, 25, $black, $font, $text); if(imagepng($im, $save_path)){ $status = true; }else{ $status = false; } imagedestroy($im); return $status; } Thank you all for any help

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

< Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >