Search Results

Search found 9156 results on 367 pages for 'partial match'.

Page 99/367 | < Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >

  • What is the REGEX of a CSS selector

    - by user421563
    I'd like to parce a CSS file and add before every CSS selector another selector. From: p{margin:0 0 10px;} .lead{margin-bottom:20px;font-size:21px;font-weight:200;line-height:30px;} I'd like: .mySelector p{margin:0 0 10px;} .mySelector .lead{margin-bottom:20px;font-size:21px;font-weight:200;line-height:30px;} But my CSS file is really complex (in fact it is the bootstrap css file) so the regex should match all CSS selectors. For now I have this regex: ([^\r\n,{};]+)(,|{) and you can see the result here http://regexr.com?328ps but as you can see there are a lot of matches that shouldn't match for example: text-shadow:0 -1px 0 rgba(0, matchs positive but it shouldn't Does someone have a solution ? THX

    Read the article

  • Is there a way to pass a regex capture to a block in Ruby?

    - by Gordon Fontenot
    I have a hash with a regex for the key and a block for the value. Something like the following: { 'test (.+?)' => { puts $1 } } Not exactly like that, obviously, since the block is being stored as a Proc, but that's the idea. I then have a regex match later on that looks a lot like this hash.each do |pattern, action| if /#{pattern}/i.match(string) action.call end end The idea was to store the block away in the hash to make it a bit easier for me to expand upon in the future, but now the regex capture doesn't get passed to the block. Is there a way to do this cleanly that would support any number of captures I put in the regex (as in, some regex patterns may have 1 capture, others may have 3)?

    Read the article

  • Best way to search a point across several polygons

    - by user1474341
    I have a requirement whereby I need to match a given point (lat,lon) against several polygons to decide if there is a match. The easiest way would be to iterative over each polygon and apply the point-in-polygon check algorithm, but that is prohibitively expensive. The next optimization that I did was to define a bounding rectangle for each polygon (upper bound, lower bound) and iteratively check the point against the bounding box (fewer comparisons as against checking all the points in the polygon). Is there any other optimization possible? Would a spatial index on the bound rectangle points or a geohash help ? Any guidance would be greatly appreciated. Thanks!

    Read the article

  • Reverse Search Best Practices?

    - by edub
    I'm making an app that has a need for reverse searches. By this, I mean that users of the app will enter search parameters and save them; then, when any new objects get entered onto the system, if they match the existing search parameters that a user has saved, a notification will be sent, etc. I am having a hard time finding solutions for this type of problem. I am using Django and thinking of building the searches and pickling them using Q objects as outlined here: http://www.djangozen.com/blog/the-power-of-q The way I see it, when a new object is entered into the database, I will have to load every single saved query from the db and somehow run it against this one new object to see if it would match that search query... This doesn't seem ideal - has anyone tackled such a problem before?

    Read the article

  • Substitute all matches with values in Ruby regular expression

    - by Lewisham
    Hi all, I'm having a problem with getting a Ruby string substitution going. I'm writing a preprocessor for a limited language that I'm using, that doesn't natively support arrays, so I'm hacking in my own. I have a line: x[0] = x[1] & x[1] = x[2] I want to replace each instance with a reformatted version: x__0 = x__1 & x__1 = x__2 The line may include square brackets elsewhere. I've got a regex that will match the array use: array_usage = /(\w+)\[(\d+)\]/ but I can't figure out the Ruby construct to replace each instance one by one. I can't use .gsub() because that will match every instance on the line, and replace every array declaration with whatever the first one was. .scan() complains that the string is being modified if you try and use scan with a .sub()! inside a block. Any ideas would be appreciated!

    Read the article

  • extracting string occurrence in c

    - by David78
    I have a string from a text file that look something like this: long_str = "returns between paragraphs 20102/34.23" - 9203 1232 "test" "basic HTML" Note: Quotes are part of the string. int match(char *long_str){ char * str; if ((str = strchr(long_str, '"')) != NULL) str++; // last " ? else return 1; return 0; } Using strstr I'm trying to get the whole substring between the last two quotes: "basic HTML". I'm just not quite sure what would be a good and efficient way of getting that match. I'm open to any other ideas on how to approach this. Thanks

    Read the article

  • Unable to replace & with &amp; in XML uses Preg_replace in PHP

    - by Raind
    Hi, Need help here. Am not able to replace the '&' with '&' uses Preg_replace in PhP. But, if i do it manually (edited) on the xml file, it works out fine. Here are the sample: $XMLCharactersPreg = "/[&<\"\'()^*@+]/"; $XMLPregReplace = "&"; $d_Description = "50% offer & 20% further reduction for member"; if (preg_match($XMLCharactersPreg, $d_Description)) { echo "A match was found."; $XMLDealDescription = preg_replace($XMLCharactersPreg , $XMLPregReplace, $d_Description); echo "$XMLDealDescription "; } else { echo "A match was not found."; } Thanks.

    Read the article

  • VS2010 (older) installer project - two or more objects have the same target location.

    - by Hamish Grubijan
    This installer project was created back in 2004 and upgraded ever since. There are two offending dll files, which produce a total of 4 errors. I have searched online for this warning message and did not find a permanent fix (I did manage to make it go away once until I have done something like a clean, or built in Release, and then in Debug). I also tried cleaning, and then refreshing the dependencies. The duplicated entries are still in there. I also did not find a good explanation for what this error means. Additional warnings are of this nature: Warning 36 The version of the .NET Framework launch condition '.NET Framework 4' does not match the selected .NET Framework bootstrapper package. Update the .NET Framework launch condition to match the version of the .NET Framework selected in the Prerequisites Dialog Box. So, where is this prerequisites box? I want to make both things agree on .Net 4.0, just having a hard time locating both of them.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Rails Routes Mappings

    - by rdasxy
    I'm a rails newbie, and I have a controller called resource_links that I've mapped to resources: resources :resources, :as => :resource_links, :controller => :resource_links And this works (basically /resources works as /resource_links). However, trying to go to /resources/tags does not work. To get around this, I added more mappings as: match 'resource_links/tag/:tag(.:format)' => 'resource_links#tag', :via => :get, :as => 'resource_links_tagged', :constraints => {:tag => /.*/} match 'resource_links/tags' => 'resource_links#tags', :via => :get, :as => 'resource_links_tags' Is there any way I can get /resources/tags to be mapped to /resource_links/tag?

    Read the article

  • Where is the 'indeterminate type'?

    - by Daniel
    I'm defining the following type extension: type System.Reflection.MemberInfo with member x.GetAttribute<'T when 'T :> Attribute>(required, inherit') = match required, Attribute.GetCustomAttribute(x, typeof<'T>, inherit') with | true, null -> invalidOp (sprintf "Missing required attribute: %s" typeof<'T>.FullName) | _, attr -> attr :> 'T The last match expression (attr :> 'T) gives the error: The static coercion from Attribute to 'T involves an indeterminate type based on information prior to this program point. Static coercions are not allowed on some types. Further type annotations are needed. I've tried annotating the function return type, but got the same result. I would hate to change this to a dynamic cast. Is there a way to make the static cast work?

    Read the article

  • Strange SQL problem selecting multiple values for same column

    - by Nubber
    Hello there, Been at this for a few hours now and I can't make any sense of it. I've used this way of selecting multiple values for same column a few times, but there is something weird with this one. SELECT * FROM employee as s INNER JOIN works AS w1 ON w1.name = s.name INNER JOIN employee AS w2 ON w2.name = s.name INNER JOIN employee AS w3 ON w3.name = s.name WHERE w2.city = 'Washington' Basically what I want to do is find all companies which have people in all the cities. The company name is under 'works'. The problem is however that if I have the WHERE w2.city='Washington' it will make ALL the cities match Washington when it should only touch w2 and leave w3 alone so I could match it with another value. Anyone know why its doing this? Or know a better way to do it. Thank you very much in advance.

    Read the article

  • C# matching two text files, case sensitive issue

    - by Mike
    What i have is two files, sourcecolumns.txt and destcolumns.txt. What i need to do is compare source to dest and if the text doesnt match write out to a new file. The code below works except i have case sensitive issues like this: CPI Cpi These say they dont match because of captial letters, any help is always thanked! string[] sourcelinestotal = File.ReadAllLines(@"C:\testdirectory\" + "sourcecolumns.txt"); string[] destlinestotal = File.ReadAllLines(@"C:\testdirectory\" + "destcolumns.txt"); foreach (string sline in sourcelinestotal) { if(destlinestotal.Contains(sline)) { } else { File.AppendAllText(@"C:\testdirectory\" + "missingcolumns.txt", sline); } }

    Read the article

  • SQL Server FTS: possible to get information how/why rows were matched?

    - by jimmy_keen
    Is it possible to get the information why/how given row returned by FTS query was matched (or which substring caused row to match)? For example, consider simpliest table with id and text columns, with FTS index on the later one. SELECT * FROM Example WHERE CONTAINS(text, 'FORMSOF(INFLECTIONAL, jump)'); This examplary query could return, say row {1, 'Jumping Jack'}. Now, is it possible to somehow get information that this very row was matched because of 'Jumping' word? It doesn't even have to be exact information, more of a which substring caused row to match. Why I'm asking - I got C# app that builds up those queries basing on user input (keywords to search for), and I need the very basic information why/how row was matched back, to use further in C# code. If it's not possible, any alternatives?

    Read the article

  • Prototype setStyle not working in IE6.

    - by Smickie
    Hi, I'm using prototype and setStyle in IE6 is just messing everything up. It's throwing a big error. I've Googled it but cant find a solution. I've identified the line in prototype with the IE script debugger, it's the final else block: setStyle: function(element, styles) { element = $(element); var elementStyle = element.style, match; if (Object.isString(styles)) { element.style.cssText += ';' + styles; return styles.include('opacity') ? element.setOpacity(styles.match(/opacity:\s*(\d?\.?\d*)/)[1]) : element; } for (var property in styles) if (property == 'opacity') element.setOpacity(styles[property]); else elementStyle[(property == 'float' || property == 'cssFloat') ? (Object.isUndefined(elementStyle.styleFloat) ? 'cssFloat' : 'styleFloat') : property] = styles[property]; return element; }, Anyone had this problem? P.S. normally I would use jQuery however this is someone else code I've had to update.

    Read the article

  • Get div and the correct close tag preg

    - by Barkermn01
    hi all, Now preg has always been a tool to me that i like but i cant figure out for the life if me if what i want to do is possible let and how to do it is going over my head What i want is preg_match to be able to return me a div's innerHTML the problem is the div im tring to read has more divs in it and my preg keeps closing on the first tag it find Here is my Actual code $scrape_address = "http://isohunt.com/torrent_details/133831593/98e034bd6382e0f4ecaa9fe2b5eac01614edc3c6?tab=summary"; $ch = curl_init($scrape_address); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, '1'); curl_setopt($ch, CURLOPT_HEADER, 0); curl_setopt($ch, CURLOPT_ENCODING, ""); $data = curl_exec($ch); preg_match('% <div id="torrent_details">(.*)</div> %six', $data, $match); print_r($match); This has been updated for TomcatExodus's help Live at :: http://megatorrentz.com/beta/details.php?hash=98e034bd6382e0f4ecaa9fe2b5eac01614edc3c6

    Read the article

  • Getting all matches for a regexp on clojure

    - by Deleteman
    I'm trying to parse an HTML file and get all href's inside it. So far, the code I'm using is: (map #(println (str "Match: " %)) (re-find #"(?sm)href=\"([a-zA-Z.:/]+)\"" str_response)) str_response being the string with the HTML code inside it. According to my basic understanding of Clojure, that code should print a list of matches, but so far, no luck. It doens't crash, but it doens't match anything either. I've tried using re-seq instead of re-find, but with no luck. Any help? Thanks!

    Read the article

  • Android search list, String

    - by NightSky
    Hey guys what is the best way to search through my list of objects, they return a few strings, last name and first name for example. Here how i'm currently searching but my search needs to match the entire string which I don't want. The search needs it to match part of the string like our contacts list on our phone and ignore the case. if (searchQ.equalsIgnoreCase(child.first_name)) { addChildToList(child); } Ive tried contains and starts with for example, they did not work. Whats going on? Thanks! Cheers!

    Read the article

  • Port forwarding DD-WRT

    - by Pawel
    Hi, I'am runing locally service on port 81 (192.168.1.101) I would like to access server from outside MY.WAN.IP.ADDR:81. Everything is working fine on my local network, However can't access it from outside. Below iptables rules on the router. I am using dd-wrt and asus rt-n16 (everything is setup through standard port range forwarding in dd-wrt ) It might be something obvious, but I don't have any experience with routing. Any help will be really appreciated. Thanks. #iptables -t nat -vnL Chain PREROUTING (policy ACCEPT 1285 packets, 148K bytes) pkts bytes target prot opt in out source destination 3 252 DNAT icmp -- * * 0.0.0.0/0 MY.WAN.IP.ADDR to:192.168.1.1 5 300 DNAT tcp -- * * 0.0.0.0/0 MY.WAN.IP.ADDR tcp dpt:81 to:192.168.1.101 0 0 DNAT udp -- * * 0.0.0.0/0 MY.WAN.IP.ADDR udp dpt:81 to:192.168.1.101 298 39375 TRIGGER 0 -- * * 0.0.0.0/0 MY.WAN.IP.ADDR TRIGGER type:dnat match:0 relate:0 Chain POSTROUTING (policy ACCEPT 7 packets, 433 bytes) pkts bytes target prot opt in out source destination 747 91318 SNAT 0 -- * vlan2 0.0.0.0/0 0.0.0.0/0 to:MY.WAN.IP.ADDR 0 0 RETURN 0 -- * br0 0.0.0.0/0 0.0.0.0/0 PKTTYPE = broadcast Chain OUTPUT (policy ACCEPT 86 packets, 5673 bytes) pkts bytes target prot opt in out source destination # iptables -L Chain INPUT (policy ACCEPT) target prot opt source destination DROP tcp -- anywhere anywhere tcp dpt:webcache DROP tcp -- anywhere anywhere tcp dpt:www DROP tcp -- anywhere anywhere tcp dpt:https DROP tcp -- anywhere anywhere tcp dpt:69 DROP tcp -- anywhere anywhere tcp dpt:ssh DROP tcp -- anywhere anywhere tcp dpt:ssh DROP tcp -- anywhere anywhere tcp dpt:telnet DROP tcp -- anywhere anywhere tcp dpt:telnet Chain FORWARD (policy ACCEPT) target prot opt source destination ACCEPT 0 -- anywhere anywhere TCPMSS tcp -- anywhere anywhere tcp flags:SYN,RST/SYN TCPMSS clamp to PMTU lan2wan 0 -- anywhere anywhere ACCEPT 0 -- anywhere anywhere state RELATED,ESTABLISHED logaccept tcp -- anywhere pawel-ubuntu tcp dpt:81 logaccept udp -- anywhere pawel-ubuntu udp dpt:81 TRIGGER 0 -- anywhere anywhere TRIGGER type:in match:0 relate:0 trigger_out 0 -- anywhere anywhere logaccept 0 -- anywhere anywhere state NEW Chain OUTPUT (policy ACCEPT) target prot opt source destination Chain advgrp_1 (0 references) target prot opt source destination Chain advgrp_10 (0 references) target prot opt source destination Chain advgrp_2 (0 references) target prot opt source destination Chain advgrp_3 (0 references) target prot opt source destination Chain advgrp_4 (0 references) target prot opt source destination Chain advgrp_5 (0 references) target prot opt source destination Chain advgrp_6 (0 references) target prot opt source destination Chain advgrp_7 (0 references) target prot opt source destination Chain advgrp_8 (0 references) target prot opt source destination Chain advgrp_9 (0 references) target prot opt source destination Chain grp_1 (0 references) target prot opt source destination Chain grp_10 (0 references) target prot opt source destination Chain grp_2 (0 references) target prot opt source destination Chain grp_3 (0 references) target prot opt source destination Chain grp_4 (0 references) target prot opt source destination Chain grp_5 (0 references) target prot opt source destination Chain grp_6 (0 references) target prot opt source destination Chain grp_7 (0 references) target prot opt source destination Chain grp_8 (0 references) target prot opt source destination Chain grp_9 (0 references) target prot opt source destination Chain lan2wan (1 references) target prot opt source destination Chain logaccept (3 references) target prot opt source destination ACCEPT 0 -- anywhere anywhere Chain logdrop (0 references) target prot opt source destination DROP 0 -- anywhere anywhere Chain logreject (0 references) target prot opt source destination REJECT tcp -- anywhere anywhere tcp reject-with tcp-reset Chain trigger_out (1 references) target prot opt source destination #iptables -vnL FORWARD Chain FORWARD (policy ACCEPT 130 packets, 5327 bytes) pkts bytes target prot opt in out source destination 15 900 ACCEPT 0 -- br0 br0 0.0.0.0/0 0.0.0.0/0 390 20708 TCPMSS tcp -- * * 0.0.0.0/0 0.0.0.0/0 tcp flags:0x06/0x02 TCPMSS clamp to PMTU 182K 130M lan2wan 0 -- * * 0.0.0.0/0 0.0.0.0/0 179K 129M ACCEPT 0 -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED 0 0 logaccept tcp -- * * 0.0.0.0/0 192.168.1.101 tcp dpt:81 0 0 logaccept udp -- * * 0.0.0.0/0 192.168.1.101 udp dpt:81 0 0 TRIGGER 0 -- vlan2 br0 0.0.0.0/0 0.0.0.0/0 TRIGGER type:in match:0 relate:0 2612 768K trigger_out 0 -- br0 * 0.0.0.0/0 0.0.0.0/0 2482 762K logaccept 0 -- br0 * 0.0.0.0/0 0.0.0.0/0 state NEW

    Read the article

  • Bandwidth Limit User

    - by user45611
    Hello, i'm saxtor i would like to know how to limit users bandwidth for 10gb per day however i dont want to limit them by ipaddress because if they where to go to an internet cafe the users at the cafe will be restricted with that quota, i need to log them via sockets, example the user request to download a file from http://localhost with there username and password, when they download the file sql will update there bandwidth they used, i have a script here but its not working my buffer doesnt work that rate when a user uses multiple connections thanks for the help!. /** * @author saxtor if you can improve this code email me @saxtorinc.com * @copyright 2010 / /* * CREATE TABLE IF NOT EXISTS max_traffic ( id int(255) NOT NULL AUTO_INCREMENT, limit int(255) NOT NULL, PRIMARY KEY (id) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=0 ; */ //SQL Connection [this is hackable for testing] date_default_timezone_set("America/Guyana"); mysql_connect("localhost", "root", "") or die(mysql_error()); mysql_select_db("Quota") or die(mysql_error()); function quota($id) { $result = mysql_query("SELECT `limit` FROM max_traffic WHERE id='$id' ") or die(error_log(mysql_error()));; $row = mysql_fetch_array($result); return $row[0]; } function update_quota($id,$value) { $result = mysql_query("UPDATE `max_traffic` SET `limit`='$value' WHERE id='$id'") or die(mysql_error()); return $value; } if ( quota(1) != 0) $limit = quota(1); else $limit = 0; $multipart = false; //was a part of the file requested? (partial download) $range = $_SERVER["HTTP_RANGE"]; if ($range) { //pass client Range header to rapidshare // _insert($range); $cookie .= "\r\nRange: $range"; $multipart = true; header("X-UR-RANGE-Range: $range"); } $url = 'http://127.0.0.1/puppy.iso'; $filename = basename($url); //octet-stream + attachment = client always stores file header('Content-type: application/octet-stream'); header('Content-Disposition: attachment; filename="'.$filename.'"'); //always included so clients know this script supports resuming header("Accept-Ranges: bytes"); //awful hack to pass rapidshare the premium cookie $user_agent = ini_get("user_agent"); ini_set("user_agent", $user_agent . "\r\nCookie: enc=$cookie"); $httphandle = fopen($url, "r"); $headers = stream_get_meta_data($httphandle); $size = $headers["wrapper_data"][6]; $sizer = explode(' ',$size); $size = $sizer[1]; //let's check the return header of rapidshare for range / length indicators //we'll just pass these to the client foreach ($headers["wrapper_data"] as $header) { $header = trim($header); if (substr(strtolower($header), 0, strlen("content-range")) == "content-range") { // _insert($range); header($header); header("X-RS-RANGE-" . $header); $multipart = true; //content-range indicates partial download } elseif (substr(strtolower($header), 0, strlen("Content-Length")) == "content-length") { // _insert($range); header($header); header("X-RS-CL-" . $header); } } if ($multipart) header('HTTP/1.1 206 Partial Content'); flush(); $speed = 4128; $packet = 1; //this is private dont touch. $bufsize = 128; //this is private dont touch/ $bandwidth = 0; //this is private dont touch. while (!(connection_aborted() || connection_status() == 1) && $size > 0) { while (!feof($httphandle) && $size > 0) { if ($limit <= 0 ) $size = 0; if ( $size < $bufsize && $size != 0 && $limit != 0) { echo fread($httphandle,$size); $bandwidth += $size; } else { if( $limit != 0) echo fread($httphandle,$bufsize); $bandwidth += $bufsize; } $size -= $bufsize; $limit -= $bufsize; flush(); if ($speed > 0 && ($bandwidth > $speed*$packet*103)) { usleep(100000); $packet++; //update_quota(1,$limit); } error_log(update_quota(1,$limit)); $limit = quota(1); //if( $size <= 0 ) // exit; } fclose($httphandle); } exit; ?

    Read the article

  • What's the difference between find and findstr commands in Windows?

    - by Prashant Bhate
    In Windows, what are the differences between find and findstr commands? Both seems to search text in files: find c:\>find /? Searches for a text string in a file or files. FIND [/V] [/C] [/N] [/I] [/OFF[LINE]] "string" [[drive:][path]filename[ ...]] /V Displays all lines NOT containing the specified string. /C Displays only the count of lines containing the string. /N Displays line numbers with the displayed lines. /I Ignores the case of characters when searching for the string. /OFF[LINE] Do not skip files with offline attribute set. "string" Specifies the text string to find. [drive:][path]filename Specifies a file or files to search. If a path is not specified, FIND searches the text typed at the prompt or piped from another command. findstr c:\>findstr /? Searches for strings in files. FINDSTR [/B] [/E] [/L] [/R] [/S] [/I] [/X] [/V] [/N] [/M] [/O] [/P] [/F:file] [/C:string] [/G:file] [/D:dir list] [/A:color attributes] [/OFF[LINE]] strings [[drive:][path]filename[ ...]] /B Matches pattern if at the beginning of a line. /E Matches pattern if at the end of a line. /L Uses search strings literally. /R Uses search strings as regular expressions. /S Searches for matching files in the current directory and all subdirectories. /I Specifies that the search is not to be case-sensitive. /X Prints lines that match exactly. /V Prints only lines that do not contain a match. /N Prints the line number before each line that matches. /M Prints only the filename if a file contains a match. /O Prints character offset before each matching line. /P Skip files with non-printable characters. /OFF[LINE] Do not skip files with offline attribute set. /A:attr Specifies color attribute with two hex digits. See "color /?" /F:file Reads file list from the specified file(/ stands for console). /C:string Uses specified string as a literal search string. /G:file Gets search strings from the specified file(/ stands for console). /D:dir Search a semicolon delimited list of directories strings Text to be searched for. [drive:][path]filename Specifies a file or files to search. Use spaces to separate multiple search strings unless the argument is prefixed with /C. For example, 'FINDSTR "hello there" x.y' searches for "hello" or "there" in file x.y. 'FINDSTR /C:"hello there" x.y' searches for "hello there" in file x.y. Regular expression quick reference: . Wildcard: any character * Repeat: zero or more occurances of previous character or class ^ Line position: beginning of line $ Line position: end of line [class] Character class: any one character in set [^class] Inverse class: any one character not in set [x-y] Range: any characters within the specified range \x Escape: literal use of metacharacter x \<xyz Word position: beginning of word xyz\> Word position: end of word For full information on FINDSTR regular expressions refer to the online Command Reference.

    Read the article

  • CodePlex Daily Summary for Saturday, June 12, 2010

    CodePlex Daily Summary for Saturday, June 12, 2010New ProjectsAdverTool (Advertisement tool): AdverTool is an online tool which integrates the most popular advertisement networks (such as Microsoft adCenter, Google AdWords, Yahoo! Search Mar...Authentication Configuration Tool for SharePoint: Helpful tools to automatically configure SharePoint 2007 and 2010 for forms based authentication and other authentication mechanisms.Bacicworx: A C# .Net 3.5 helper library containing functionality for compression, encryption, hashes, downloading, PayPal API, text analysis and generation, a...BlogEngine.Net iPhone Theme: A port of BETouch originally created by soundbbgBT UPnP Nat Library: This Library makes it extremly simple to add NAT upnp port forwarding to your .net applications. Developed in C# using .Net 4.0CheckBox & CheckBoxList Validators: These validators fill the much needed gap in the Asp.Net Server controlsDataFactories: The DataFactories project was created to provide a standardized interface to SSAS and MSSQL data. However, as it is implemented using the Abstract ...DVD Swarm: Converts unprotected DVD video & audio streams to H.264 with AAC/Vorbis.Frio IM: Frio IM - is cross protocol instant messenger.jiuyuan: jiuyuan management systemMGM: MyGroupManager is a simple graphical interface written in PowerShell that can be deployed to Active Directory users to simplify the managed of grou...MGR2010: This the MA thesis by Witold Stanik & Michał Sereja, PJWSTK.Nauplius.ActiveDirectory: Web-based Active Directory management.Partial rendering control using JQuery: This article show a web custom control that allows partial rendering using JQueryREG - The Random Entertainment Generator: A simple tool to make your mid up when you can't figure out what you want to do!Runes of Magic - Heilerrechner: Heilerrechner für die Heiler von Runes of Magic (www.runes.ofmagic.com)Semagsoft Calculator: Basic calculator for Windows XP, Vista and Windows 7.SO League Tables: SOLT: Stack Overflow League Tables. A fun little app that lets you compare your stack overflow performance for each month, relative to other member...Stacky StackApps .Net Client Library: StackApps is a REST API for which provides access to the stackoverflow.com family of websites. Stacky is a .net client for that API. Stacky current...TwitterDotNet: TwitterDotNet is a TwitterLibrary for .NET Framework.ValiVIN: VIN (Vehicle Identification Number) Validator Validate Vin NumberWorkLogger: Simple work hour logger in WPFNew ReleasesAdverTool (Advertisement tool): Official releases: Please visit http://advertool.org to access the complete source code and downloads.Authentication Configuration Tool for SharePoint: Auth Config Tool (WSS 3.0, MOSS 2007 version): This tool automates the setup of dual authentication web applications in SharePoint that use Windows Authentication and Forms Based Authentication....BlogEngine.Net iPhone Theme: Version 0.1: Original version 0.1 from soundbbgBraintree Client Library: Braintree-2.3.0: Return AvsErrorResponseCode, AvsPostalCodeResponseCode, AvsStreetAddressResponseCode, CurrencyIsoCode, CvvResponseCode with Transaction Return Cr...BT UPnP Nat Library: Bt_Upnp Nat Library Alpha: Alpha Release of the libraryCNZK Library: Silverlight Behaviors - Deep Zoom Tag Filter: Behavior library for Silverlight 4 containing a Deep Zoom Tag Filter Behavior. Sample at the Expression Gallery http://gallery.expression.microsof...Demina: Demina Binaries version 0.2: Updated binaries. This release contains all of the new features, including simple animation transitions.DTLoggedExec: 1.0.0.2: -Fixed a bug that prevented loading packages from SSIS Package Store -Added support for {filename} placeholder in both Data Flow Profiling and CSV ...DVD Swarm: v0.8.10.611: Initial release, mostly stable.Exchange 2010 RBAC Editor (RBAC GUI) - updated on 6/11/2010: RBAC Editor 0.9.5.1: now supports creating and editing Role Assignment Policies; rest of the stuff is the same - still a lot of way to go :) Please use email address i...Extend SmallBasic: Teaching Extensions v.021: Compatible with SmallBasic v0.9 Lame version of TicTacToe Added - more coming later.Free Silverlight & WPF Chart Control - Visifire: Visifire SL and WPF Charts v3.1.1 GA Released: Hi, Today we are releasing Visifire 3.1.1 GA with the following features: * Logarithmic Axis * ShowIndicator() in Chart. * HideIndica...Free Silverlight & WPF Chart Control - Visifire: Visifire SL and WPF Charts v3.5.4 GA Released: Hi, Today we are releasing Visifire 3.1.1 GA with the following features: Logarithmic Axis ShowIndicator() in Chart. HideIndicator() in Chart...Keep Focused - an enhanced tool for Time Management using Pomodoro Technique: Release 0.3.1 Alpha: Release 0.3.1 Alpha Technical patch. The previous release 0.3 Alpha had some errors and missing features. It was probably not build from the source...Mesopotamia Experiment: Mesopotamia 1.2.96: Bug Fixes - Fixed duplicate cells being added on creating new cells via mutations - Fixed bug where organisms without IO synapses where getting ios...NLog - Advanced .NET Logging: Nightly Build 2010.06.11.001: Changes since the last build:No changes. Unit test results:Passed 243/243 (100%) Passed 243/243 (100%) Passed 267/267 (100%) Passed 269/269 (100%)...Partial rendering control using JQuery: JQuery Web Control V 1.0: This is the first release of the code. It includes the source code and a web application to see how it worksphpxw: Phpxw2.0: 框架目录说明 ./_mod 模块存放目录 ./phpxw/ 框架核心目录 ./phpxw/common/ 框架核心函数 ./phpxw/system/ 框架核心基础类存放目录 ./phpxw/userlib/ 用户继承类存放目录 ./temp...Questionable Content Screensaver: Questionable Content Screensaver: Should be pretty self explanatory, install the appropriate version for your computer (x64 or x86). Features Include Cache comics for offline viewi...Quick Performance Monitor: Version 1.4.1: Added option to change the 'minimum' maximum value visible on the graph at run-time. Also fixed a number of other bugs.Refix - .NET dependency management: Refix v0.1.0.82 ALPHA: This has now been run against a real life project to tease out some of the issues. While this remains alpha software, which you use at your own ris...Rhyduino - Arduino and Managed Code: Beta Release (v0.8.2): ContentsSample Project - Demonstrates basic functionality and is flooded with code comments, so it's capable of being used as a learning tool. It d...Runes of Magic - Heilerrechner: Rom_Heiler_0.1: Erste Version von "RoM Heilerrechner". .Net 4.0 Framework wird vorausgesetzt. Das erhälst du hier: http://www.microsoft.com/downloads/details.aspx?...Semagsoft Calculator: 2.0: new theme and bug fix'sSilverlight Reporting: Release 2: Updated to correct issue in report footer xaml, and to add support for a calculated report footer.Stacky StackApps .Net Client Library: Beta Preview: This is a beta preview to go along with the StackApps beta.TwitterDotNet: TwitterDotNet Library: first versionUnOfficial AW Wrapper dot Net: Aw Wrapper 1.0.0.0 (5.0): New Functions :DValiVIN: ValiVIN first release: First Iteration. METHODS: IsValid(string vin) - Checks if a string is a valid VIN (returns true or false) GetCheckSumValue(string vin) - Returns...VCC: Latest build, v2.1.30611.0: Automatic drop of latest buildViewModelSupport: ViewModelSupport 1.0: Version 1.0 More information: http://houseofbilz.net/archives/2010/05/08/adventures-in-mvvm-my-viewmodel-base/ http://houseofbilz.net/archives/201...VolgaTransTelecomClient: v.1.0.3.0: v.1.0.3.0WCF Client Generator: Version 0.9.3.19259: Changed: - Always generate full type names for parameters and return typesWCF Client Generator: Version 0.9.3.21153: Fixed: - Service contracts namespace generation Added: - Templates assembly code base read from configurationXen: Graphics API for XNA: Xen 2.0 ALPHA: This is a very early alpha for Xen 2.0. Please note: The documentation for this alpha has not been updated yet. Xen 2.0 is not backwards compatib...ZGuideTV.NET: ZGuideTV.NET 0.93: Vendredi 11 avril 2010 (ZGuideTV.NET bêta 9 build 0.93) - English below Ajout : - Classement du contenu dans la description (affichage légende si...Most Popular ProjectsCAML GeneratorSharePoint Geographic Data VisualizerDbIdiom for ADO.NET CorestudyDTSRun Job RunnerXBStudio.asp.net.automationSilverlight load on demand with MEFCloud Business ServicesSharePoint 2010 Taxonomy Import UtilitySTS Federation Metadata EditorMost Active ProjectsRhyduino - Arduino and Managed Codepatterns & practices – Enterprise LibraryjQuery Library for SharePoint Web ServicesNB_Store - Free DotNetNuke Ecommerce Catalog ModuleCommunity Forums NNTP bridgeCassandraemonBlogEngine.NETMediaCoder.NETMicrosoft Silverlight Media FrameworkAndrew's XNA Helpers

    Read the article

  • CodePlex Daily Summary for Wednesday, June 16, 2010

    CodePlex Daily Summary for Wednesday, June 16, 2010New ProjectsAtomFeedBuilder: Simple and lightweight Atom feed builder. Developed in VB.Net.Cable and Wire harness tester: If you build lots of cable/wire harness' you know that testing them is a pain. I have wanted an automated cable tester for a while now but commerci...Carmenta Engine Power Pack: The target of Carmenta Engine Power Pack is to provide extensions, utilities and wrapper classes that allows developers to work more efficiently w...Customer Book: Customer Book, its like address book with facility for generating quotation for a business or a supplier to the clients.Dialector: Using this program, you can convert pure Turkish texts into different dialects; such as: Emmi, Kufurbaz, Kusdili, Laz, Peltek, Tiki, and many more....Downline Commision Generator: Analyze the compensations plan of the organizations in multi-level marketing or network marketing. Check with this tool the commision plan of the c...EmbeddedSpark 2010 Project M: Project M is a system for seamlessly interfacing a tabletop interface to portable devices placed upon it. Using image recognition and projectors, P...Event Log Creator by eVestment Alliance: Provides a simple utility to create a new source and log in the Windows event log. The utility checks if the current user is an administrator, and...ExchangeHog: Desktop/daemon application that aggregates emails from multiple pop3-accounts into single Microsoft Exchange 2010 account. For users receiving ema...Extra Time Calculator: Extra Time Calculator allows exam end times to be easily calculated for students receiving an extra time accommodation.Generic WCF Hosting Service: The Generic Host Service provides a simple, reusable, and reliable mechanism for hosting WCF services. Google Storage for .NET: Google Storage for .NET (GSN) is an open source library that provides .NET developers with easy access to the Google Storage API. The library allo...Helium: The Helium XNA game engine is a light portable game engine designed to work on many platforms and soon to be expanded on more. Currently the helium...IconizedButton Control Set: ASP.NET WebForms IconizedButton Custom Control Set. Replaces the dull Button/LinkButton/HyperLink controls with styling and left and right aligned...Jedi Council PM List: Allows for users to process Private Message Lists on the Jedi Council forums for TheForce.Net.JetPumpDesign: 本软件为蒸气喷射泵设计计算软件 作者:申阳 单位:西安交通大学过程装备与控制工程61班log4Nez: An high personalized implementation of a logging libraryMutantFramework: Provides a common set of building blocks for building enterprise applicationsNUnit Add-in for Growl Notifications: NUnit add-in which allows to send notifications to Growl when test run is started or finished, when a first test failure occurs and so on.Object Reports: Object Reports is a "proof of concept" application which provides users the ability to visualy build queries based on data stored in the relational...openTrionyx: openTrionyx is a set of tools to make easier web application development. Includes Data, Web and plain text documents tools. Developed in C#, compl...Partial Rendering control for MVC 2: This project shows a web custom control that allow to have partial rendering using async post-back (through JQuery) in a MVC 2 web application.PowerGUI Visual Studio Extension: The PowerGUI Visual Studio Extension exposes PowerGUI as an editor in Visual Studio. PowerShell developers can now write scripts directly in Visual...PowerShell Script Provider: Write your own PowerShell provider using only script, no C# required. Module definition is provided by a Windows PowerShell 2.0 Module, which may b...Scholar: Scholar is a solution/framework for .Net developers to help with the creation of distributed data processing (think SETI@home style apps). It is in...scrabb: Scrabb help people play scrabble over net.SharePointNuke: A DotNetNuke module that connects to a SharePoint server using web services API and displays the content of a specified list. SolidWorksBackConverter: a Project to Convert a solidwork file to an older version Soma - Sql Oriented MApping framework: Sql Oriented MApping framework.SPCreate: SPCreate auto store procedure creator. It's developed in c#. SpCreate as output ADO.NET Class (C# or VB.Net) and SQL Server or MS Access Store pro...std::streambuf wrapper for COM IStream: This provides a subclass of std::streambuf that wraps a COM IStream, so you can use an IStream with any C++ code that uses iostreams or the STL alg...VACID solutions: Solutions of verification problems posed in paper "Verification of Ample Correctness of Invariants of Data-structures". Developed with various tool...Viewer: Our Goal is to create a C# project that will centeralize Image and Movie Viewing in a forms application, It will also have a Specialized Webbrowser...vsXPathTester: vsXPathTester is a utility for Developer. This help them load XML file and the run their XPath Query. The Resultant is shown in window. It save the...New Releases.Net Max Framework: Version 1.0.0: Version 1.0.0 - EstableAndrew's XNA Helpers: V1.2: Features upgraded features based off of the V1.1 code for both X86 and XBOX Additions/Changes Reworked the Texture2D and Rectangle extender namesp...BaseCalendar: BaseControls 1.2: BaseControls 1.2 contains the BaseCalendar ASP.NET control. Changes: 1.2 Exposed EffectiveVisibleDate and FirstVisibleDay methods 1.1 Rendering ...Customer Book: Customer Book Code: Bronze Release PostgreSQL database dump for Customer Book. Open PgAdmin III and restore the database dump into your server. Notice User Name for t...Data Connection Suite: Data Connections Suite v1.0.0.0: This is the first release of this incomplete component, but good enought to use in a production environment (it's what we do).DigitArchive: Build 8: Now the software works on .NET 3.5 and above. So if you have Windows 7 it installs without any pre-requisites. Changes: -Works on .NET 3.5 -Now t...Doom 64 Ex (SVN Builds): Doom 64 Ex r-738: Finally a new build after so many months. There are way to many updates to even begin to write about here just download and frag away. There is a s...DotNetNuke® Media: 03.03.00a: This release is Beta!! There is no guaranteed upgrade path to the 03.03.00 release version! Please use this to help us and test what we have. Repor...Downline Commision Generator: Downline Commision Generator: Downline Commision GeneratorElmah2 : An extensable error logger for ASP.net: 1.0 Beta 1: This is a beta release be sure to report any errors etc. Be sure to check out the documentation tab on information on how to install and configure...EPiServer Template Foundation: First compiled release: First compiled release for experimenting only! :) An introductory post will be published shortly on the blog.Helium: Initial Release: This is the initial release of the Helium Engine. Please check out the documentation link for information on how to use the engine. To see a ful...IconizedButton Control Set: IconizedButton Control Set: Taking a line from Google's play book - marking everything as Beta. Seriously, I'd like to hear some feedback before moving the Development Status...JetPumpDesign: JetPumpDesign 1.0: 当前的软件可以设计5级以内的蒸汽喷射泵。Microsoft Silverlight Analytics Framework: Version 1.4.4 Installer: Tools TargetingVisual Studio 2010 Expression Blend 4 (part of Expression Studio 4) Analytics Services Included Vendor Behavior Silverlight 3...NHibernate Sidekick Library: 0.7.0: Added a few methods for use with the NHibernate 2nd level cache (EvictAllObjectsFromCache and EvictPersistentClass). I also added the boolean optio...NHibernate Sidekick Library: 0.7.5: Fix for http://nhprof.com/Learn/Alerts/DoNotUseImplicitTransactionsNito.KitchenSink: Version 9: Dependencies Nito.Linq 0.6 Beta (released 2010-06-14) Rx 1.0.2563.0 (released 2010-06-09) Supported Platforms .NET 4.0 Client Profile, with Rx. ...NQueue: Version 1.0.0.0: Version 1.0.0.0NUnit Add-in for Growl Notifications: NUnit Add-in for Growl Notifications 1.0 build 0: The very first stable releasePartial Rendering control for MVC 2: Partial Rendering control for MVC 2: Here there is the source code and a MVC 2 web site as testPowerShell Script Provider: PSProvider 0.1: Requires PowerShell 2.0 RTM The functions in the attached ps1 script are the bare minimum for a working container-style provider (no subfolders.) ...Quick Performance Monitor: Version 1.4.3: Fixed issue where if an instance name contains backslash characters (\) the program would not load the performance counter properly. Also added sta...SharePointNuke: SharePointNuke 2.00.08: SharePointNuke 2.00.08 - Binary DotNetNuke 5.x module.Skype Voice Changer: 1.0 Updated Sample Code: This updated release is the accompanying code for the Skype Voice Changer article on Coding4Fun. Changes in this release: Added support for PreEmp...std::streambuf wrapper for COM IStream: Beta release (tested in a commercial project): This code has been tested in a custom Windows Search filter and property handler I wrote for a proprietary binary format. There may be some bugs, b...Sunlit World Scheme: Sunlit World Scheme - 20100615 - source and binary: This is the result of building the current source code in Debug mode. The source code is included. The binaries are in the SchemeCode folder along...Timo-Design / 40FINGERS DotNetNuke® Skinning Extensions: Style Helper Skin Object Beta: The 40FINGERS Style Helper Skin object allows you to add CSS and Javascript links and meta tags to the head of your page. It can also remove CSS l...Umbraco CMS: Umbraco 4.1 RC: This is the final test version of Umbraco 4.1 before the final release. PLEASE BE AWARE THAT UMBRACO 4.1 RC IS A .NET 4.0 RELEASE AND WON'T WORK O...VCC: Latest build, v2.1.30615.0: Automatic drop of latest buildWCF 4 Templates for Visual Studio 2010: UserNameForCertificate Template: Produces a WCF service application supporting username and password authentication, relying on message security to protect messages en route. Suppl...WCF 4 Templates for Visual Studio 2010: UserNameOverHttps Template: Produces a WCF service application supporting username and password authentication over HTTPS/SSL, relying on transport security to protect message...xUnit.net Contrib: xunitcontrib 0.4.1 alpha (ReSharper 5.1.1709 only): xunitcontrib release 0.4.1 (ReSharper runner) This release targets the current nightly build of ReSharper 5.1's Early Access Programme (build 1709)...Most Popular ProjectsCommunity Forums NNTP bridgeRIA Services EssentialsNeatUploadBxf (Basic XAML Framework).NET Transactional File ManagerSOLID by exampleSSIS Expression Editor & TesterWEI ShareChirpy - VS Add In For Handling Js, Css, and DotLess FilesASP.NET MVC Time PlannerMost Active ProjectsdotSpatialRhyduino - Arduino and Managed CodeCassandraemonpatterns & practices – Enterprise LibraryCommunity Forums NNTP bridgeLightweight Fluent Workflowpatterns & practices: Enterprise Library ContribNB_Store - Free DotNetNuke Ecommerce Catalog ModuleBlogEngine.NETjQuery Library for SharePoint Web Services

    Read the article

  • UpdatePanel, JavaScript postback and changing querystring at same time in SharePoint Search Page

    - by Lee Dale
    Hi Guys, Been tearing my hear out with this one. Let me see if I can explain: I have a SharePoint results page on which I have a Search Results Core WebPart. Now I want to change the parameter in the querystring when I postback the page so that the WebPart returns different results for each parameter e.g. the querystring will be interactivemap.aspx?k=Country:Romania this will filter the results for Romania. First issue is I want to do this with javascript so I call: document.getElementById('aspnetForm').action = "interactivemap.aspx?k=Country:" + country; Nothing special here but the reason I need to call from Javascript is there is also a flash applet on this page from which the Javascript calls originate. When the javascript calls are made the page needs to PostBack but not reload the flash applet. I turned to ASP.Net AJAX for this so I wrapped the search results webpart in an update panel. Now if I use a button within the UpdatePanel to postback the UpdatePanel behaves as expected and does a partial render of the search results webpart not reloading the flash applet. Problem comes because I need postback the page from javscript. I called __doPostBack() as I have used this successully in the past. It works on it's own but fails when I first call the above Javascript before the __doPostBack() (I also tried calling click() on a hidden button) the code for the page is at the bottom. I think the problem comes with the scriptmanager not allowing a partial render when the form post action has changed. My questions are. A) Is there some other way to change the search results webpart parameter without using the querystring. or B) Is there a way around changing the querystring when doing an AJAX postback and getting a partial render. <asp:Content ContentPlaceHolderID="PlaceHolderFullContent" runat="server"> function update(country) { //__doPostBack('ContentUpdatePanel', ''); //document.getElementById('aspnetForm').action = "interactivemap.aspx?k=ArticleCountry:" + country; document.getElementById('ctl00_PlaceHolderFullContent_UpdateButton').click(); } Romania <div class="firstDataTitle"> <div class="datatabletitleOuterWrapper"> <div class="datatabletitle"> <span>Content</span></div> </div> <div class="datatableWrapper"> <div class="dataHolderWrapper"> <div class="datatable"> <div> <div class="searchMain"> <div class="searchZoneMain"> <asp:UpdatePanel runat="server" id="ContentUpdatePanel" UpdateMode="Conditional"> <ContentTemplate> <WebPartPages:webpartzone runat="server" AllowPersonalization="false" title="<%$Resources:sps,LayoutPageZone_BottomZone%>" id="BottomZone" orientation="Vertical" QuickAdd-GroupNames="Search" QuickAdd-ShowListsAndLibraries="false"><ZoneTemplate></ZoneTemplate></WebPartPages:webpartzone> <asp:Button id="UpdateButton" name="UpdateButton" runat="server" Text="Update"/> </ContentTemplate> </asp:UpdatePanel> </div> </div> </div> </div> </div> </div>

    Read the article

< Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >