Splitting Nucleotide Sequences in JS with Regexp

Posted by TEmerson on Stack Overflow See other posts from Stack Overflow or by TEmerson
Published on 2010-06-15T20:01:13Z Indexed on 2010/06/15 20:12 UTC
Read the original article Hit count: 150

Filed under:

JavaScript

|

regex

I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts.

For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results.

I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

© Stack Overflow or respective owner

Related posts about JavaScript

CHAT ROOMs 7 by 6

as seen on Stack Overflow - Search for 'Stack Overflow'
I am looking for chatroom on one page with 7 loggedin users and 6+rows for say 42 users.these users will keep on adding wthnew users.Need urgent help.A PRETTY UNUSUAL Q FOR MOST OF U.What is MORE REQ new features: Usernames are unique to users currently chatting You can see a "currently chatting"… >>> More
Integrating JavaScript Unit Tests with Visual Studio

as seen on Stephen Walter - Search for 'Stephen Walter'
Modern ASP.NET web applications take full advantage of client-side JavaScript to provide better interactivity and responsiveness. If you are building an ASP.NET application in the right way, you quickly end up with lots and lots of JavaScript code. When writing server code, you should be writing… >>> More
Has Javascript developed beyond what it was originally designed to do?

as seen on Programmers - Search for 'Programmers'
I've been talking with a friend about the purpose of Javascript, when and how it should be used, etc. He quoted that: JavaScript was designed to add interactivity to HTML pages [...] JavaScript gives HTML designers a programming tool HTML authors are normally not programmers… >>> More
PHP, javascript, single quote problems with IE when passing variable from ajax post to javascript fu

as seen on Stack Overflow - Search for 'Stack Overflow'
Hi! I have been trying to get this to work for a while, and I suspect there's an easy solution that I just can't find. My head feels like jelly and I would really appreciate any help. My main page.php makes a .post() to backend.php and fetches a list of cities which it echoes in the form of: <li… >>> More
Javascript in XSL that is loaded by Javascript

as seen on Stack Overflow - Search for 'Stack Overflow'
Is there anyway to have javascript run when a XSL sheet has been applied to an XML file by Javascript? I am using a JQuery plugin to apply the sheet to the xml but the javascript that is located inside of the XSL file will not run. I put the Javascript at the bottom of the file and it still does… >>> More

Related posts about regex

Find multiple regex in each line and skip result if one of the regex doesn't match

as seen on Stack Overflow - Search for 'Stack Overflow'
I have a list of variables: variables = ['VariableA', 'VariableB','VariableC'] which I'm going to search for, line by line ifile = open("temp.txt",'r') d = {} match = zeros(len(variables)) for line in ifile: emptyCells=0 for i in range(len(variables)): regex = r'('+variables[i]+r')[:|=|\(](-… >>> More
OWASP Regex Repository: Is this regex correct?

as seen on Stack Overflow - Search for 'Stack Overflow'
I was looking at the regular expression for validating various data types from the (OWASP Regex Repository). One of the regular expressions in there is called safetext and looks like: ^[a-zA-Z0-9\s.\-]+$ My first question is: Is this regular expression correct? complementary question If this… >>> More
Make a Perl-style regex interpreter behave like a basic or extended regex interpreter

as seen on Stack Overflow - Search for 'Stack Overflow'
I am writing a tool to help students learn regular expressions. I will probably be writing it in Java. The idea is this: the student types in a regular expression and the tool shows which parts of a text will get matched by the regex. Simple enough. But I want to support several different regex… >>> More
JS regex isn't matching, even thought it works with a regex tester

as seen on Stack Overflow - Search for 'Stack Overflow'
I'm writing a piece of client-side javascript code that takes a function and finds the derivative of it, however, the regex that's supposed to match with the power rule fails to work in the context of the javascript program, even though it sucessfully matches when it's used with an independent regex… >>> More
c# RegEx with "|"

as seen on Stack Overflow - Search for 'Stack Overflow'
I need to be able to check for a pattern with | in them. For example an expression like d*|*t should return true for a string like "dtest|test". I'm no regex hero so I just tried a couple of things, like: Regex Pattern = new Regex("s*\|*d"); //unable to build because of single backslash Regex Pattern… >>> More