Search Results

Search found 12 results on 1 pages for 'hyphenation'.

Page 1/1 | 1 

  • MikTeX 2.8 doesn't add hyphenation support for pdfLaTeX

    - by SztupY
    I'm using MikTeX 2.8 edition, and installed the hungarian language support and hyphenation files. Using the standard LaTeX command they work fine, but when I try to use pdfLaTeX, they don't get loaded and I get the (C:\stuff\miktex\tex\generic\babel\magyar.ldf (C:\stuff\miktex\tex\generic\babel\babel.def) Package babel /b/c12/cWarning:/b/c0/c No hyphenation patterns were loaded for (babel) the language `Magyar' (babel) I will use the patterns loaded for \language=0 instead. message. Using latex it works fine: (C:\stuff\miktex\tex\latex\00miktex\bblopts.cfg) (C:\stuff\miktex\tex\generic\babel\magyar.ldf (C:\stuff\miktex\tex\generic\babel\babel.def))) I tried updating the FNDB and the Formats, but to no avail. Thanks.

    Read the article

  • Anyone able to translate sIFR into AS3 (for hyphenation and with the help of a converter)?

    - by Murat Bezel
    One thing asked for a lot with sIFR is hyphenation. Now I almost solved it with integrating Hyphenator.as http://vis4.net/blog/2010/05/as3-hyphenation/. The only problem is that Hyphenator.as is written in AcionScript 3, while sIFR is in ActionScript 2. I found an AS2 to AS3 converter www.5etdemi.com/blog/archives/2006/11/as2-to-as3-converter-createtextfield-geturl-handling/ but the result examples.bezel.be/sIFR-as3.as is not working yet. Anyone able to contribute to making hyphenation work in sIFR? (Sorry for the links, but weirdly I am only allowed to post one link. Really weird.)

    Read the article

  • how to get latex to hyphenate a word that contains a dash ?

    - by Gyom
    In a latex document I'm writing, I get an overfull hbox warning because of the word "multi-disciplinary", which happens to be rendered at the end of a line. I can get rid of this particular warning by changing it into multi-discipli\-nary, but the same problem will happen elsewhere, since this word is used a lot in the paper. I'd like to use the \hyphenation{} command instead, but obviously my tentative \hyphenation{multi-disci-pli-na-ry} does not work, because it does not understand the first dash correctly. What incantation do I need to get correct indentation in a word that already contains a dash ? Bonus question: where could I have found the answer to that question myself ?

    Read the article

  • Detecting syllables in a word

    - by user50705
    I need to find a fairly efficient way to detect syllables in a word. E.g., invisible - in-vi-sib-le There are some syllabification rules that could be used: V CV VC CVC CCV CCCV CVCC *where V is a vowel and C is a consonant. e.g., pronunciation (5 Pro-nun-ci-a-tion; CV-CVC-CV-V-CVC) I've tried few methods, among which were using regex (which helps only if you want to count syllables) or hard coded rule definition (a brute force approach which proves to be very inefficient) and finally using a finite state automata (which did not result with anything useful). The purpose of my application is to create a dictionary of all syllables in a given language. This dictionary will later be used for spell checking applications (using Bayesian classifiers) and text to speech synthesis. I would appreciate if one could give me tips on an alternate way to solve this problem besides my previous approaches. I work in Java, but any tip in C/C++, C#, Python, Perl... would work for me.

    Read the article

  • LibreOffice english spelling dictionary missing

    - by rossouwap
    I've got two machines, same OS (Ubuntu 11.10 x86_64), same LibreOffice ppa's (ppa:libreoffice/ppa). One has the "English spelling dictionaries, hyphenation rules, thesaurus..." extension in the extension manager, the other doesn't. Each upgraded using the ppa from 3.5.0 to 3.5.1. Can anyone provide some insight as to how to get this extension onto the second machine? I can remove LibreOffice from the second machine and install the packages from the LibreOffice site, but would prefer to keep the ppa - as I don't then need to remember to upgrade.

    Read the article

  • Need Help to fix hmtl.sty not found error

    - by GGS
    I installed texlive 2012 on ubuntu 12.04 LTS 64 bit machine following the instructions given in the following web How do I install the latest TeX Live 2012? After, a successful installation( I think), I got the following error when I do a pdflatex to compile a give tex file This is pdfTeX, Version 3.1415926-2.4-1.40.13 (TeX Live 2012/Debian) restricted \write18 enabled. entering extended mode (./user_guide.tex LaTeX2e <2011/06/27 Babel and hyphenation patterns for english, dumylang, nohyphenation, lo aded. (/usr/share/texlive/texmf-dist/tex/latex/base/article.cls Document Class: article 2007/10/19 v1.4h Standard LaTeX document class (/usr/share/texlive/texmf-dist/tex/latex/base/size12.clo)) ! LaTeX Error: File `html.sty' not found. Type X to quit or to proceed, or enter new name. (Default extension: sty) so would you help me in getting a solution? Thank you in advance

    Read the article

  • [LaTeX] How to remove \hyphenpenalty & \pretolerance influence on section/subsection headers

    - by oleg-strikov
    Hi there, In my latex document i've set \hyphenpenalty=15000 and \pretolerance=10000 to remove word hyphenation and make text bounds even. But I can't disable this effect for section/subsection headers. All headers looks badly due to big spaces between words (image). Are there any solution to disable \hyphenpenalty=15000 and \pretolerance=10000 effect for headers? Thank you!

    Read the article

  • LaTeX: Left aligning without extra space between words in tables

    - by goldfrapp04
    Here is the illustrating code: \documentclass[letterpaper, 10pt]{article} \usepackage[margin=1in]{geometry} \usepackage{array} \usepackage[none]{hyphenat} \begin{document} \begin{center} \begin{tabular}{|m{4.5cm}|m{1.2cm}<{\centering}|m{8cm}|c|} \hline \centering \textbf{Course Name} & \centering \textbf{Date} & \centering \textbf{Textbook} & \centering \textbf{Grade} \tabularnewline \hline C Programming Language \& Lab & 09/2009 - 12/2009 & Brian W. Kernighan, and Dennis M. Ritchie, \textit{The C Programming Language}, 2nd ed. ISBN:9780131103627 & 89 \\ \hline Integrative Practice on Courses & 07/2011 & LUPA, \textit{Linux Software Engineer}, ISBN:9787030199645 & 87 \\ \hline \end{tabular} \end{center} \end{document} As shown in the pdf generated, there are too much space between some words because I disabled automatic hyphenation. I'd like to leave only single space between words, without justify align. THANK YOU!

    Read the article

  • What packages do I need to compile .tex documents using XeLaTeX?

    - by maria
    Hi I'm aware of the existence of similar threads on this forum. But any of replies mach to my problem. I'm using Ubuntu 10.4 and I hadn't problems with fonts till I've decided to use XeLaTeX instead of LaTeX (cf http://tex.stackexchange.com/questions/12347/typesetting-a-document-using-arabic-script/12358#12358). The problem is that I'm not able to compile any .tex document using XeLaTeX, as well as properly display XeLaTeX documentation. As I've learn thanks to mentioned thread, XeLaTeX uses the fonts availables in general in the system. I was trying yo read fontspec documentation, but it opens in pdf with a lot of white gaps and terminal output (quite long) consist mostly of errors. This are just few lines of it: Error: Missing language pack for 'Adobe-Japan1' mapping Error: Unknown font tag 'F5.1' Error (24124): No font in show Error: Unknown font tag 'F5.1' I was trying to compile simple XeLaTeX file: \documentclass{article} \usepackage{fontspec} \setmainfont{Linux Libertine O} \begin{document} Hello World! \end{document} without succes. This is terminal output of compilation: This is XeTeX, Version 3.1415926-2.2-0.9995.2 (TeX Live 2009/Debian) restricted \write18 enabled. entering extended mode (./ex.tex LaTeX2e <2009/09/24> Babel <v3.8l> and hyphenation patterns for english, usenglishmax, dumylang, noh yphenation, polish, loaded. (/usr/share/texmf-texlive/tex/latex/base/article.cls Document Class: article 2007/10/19 v1.4h Standard LaTeX document class (/usr/share/texmf-texlive/tex/latex/base/size10.clo)) (/usr/share/texmf-texlive/tex/xelatex/fontspec/fontspec.sty (/usr/share/texmf-texlive/tex/generic/ifxetex/ifxetex.sty) (/usr/share/texmf-texlive/tex/latex/tools/calc.sty) (/usr/share/texmf-texlive/tex/latex/xkeyval/xkeyval.sty (/usr/share/texmf-texlive/tex/generic/xkeyval/xkeyval.tex (/usr/share/texmf-texlive/tex/generic/xkeyval/keyval.tex))) (/usr/share/texmf-texlive/tex/latex/base/fontenc.sty (/usr/share/texmf-texlive/tex/xelatex/euenc/eu1enc.def) (/usr/share/texmf-texlive/tex/xelatex/euenc/eu1lmr.fd)) fontspec.cfg loaded. (/usr/share/texmf-texlive/tex/xelatex/fontspec/fontspec.cfg))kpathsea: Invalid fontname `Linux Libertine O', contains ' ' ! Font \zf@basefont="Linux Libertine O" at 10.0pt not loadable: Metric (TFM) fi le or installed font not found. \zf@fontspec ...ntname \zf@suffix " at \f@size pt \unless \ifzf@icu \zf@set@... l.3 \setmainfont{Linux Libertine O} ? I can't find Linux Libertine O. Searching for otf- by aptitude gives as result: maria@maria-laptop:/etc/fonts$ aptitude search otf p emdebian-rootfs - emdebian root filesystem support p libotf-bin - A Library for handling OpenType Font - utilities p libotf-dev - A Library for handling OpenType Font - development i libotf0 - A Library for handling OpenType Font - runtime p libotf0-dbg - The libotf libraries and debugging symbols p libpam-dotfile - A PAM module which allows users to have more than one password p livecd-rootfs - construction script for the livecd rootfs p makebootfat - Utility to create a bootable FAT filesystem p otf-ipaexfont - Japanese OpenType font, IPAexFont (IPAexGothic/Mincho) p otf-ipaexfont-gothic - Japanese OpenType font, IPAexFont (IPAexGothic) p otf-ipaexfont-mincho - Japanese OpenType font, IPAexFont (IPAexMincho) p otf-ipafont - Japanese OpenType font set, IPAfont p otf-ipafont-gothic - Japanese OpenType font set, IPA Gothic font p otf-ipafont-mincho - Japanese OpenType font set, IPA Mincho font p otf-stix - the Scientific and Technical Information eXchange fonts p otf-thai-tlwg - Thai fonts in OpenType format p otf-yozvox-yozfont - Japanese proportional Handwriting OpenType font p otf2bdf - generate BDF bitmap fonts from OpenType outline fonts p robotfindskitten - Zen Simulation of robot finding kitten So font in question is not just uninstalled, but not available, if I'm not wrong. Does it mean that I lack some repositoires? I was trying also to apply solution from the thread How do I reinstall default fonts?, but the result is: maria@maria-laptop:~$ sudo apt-get install msttcorefonts [sudo] password for maria: Reading package lists... Done Building dependency tree Reading state information... Done Note, selecting ttf-mscorefonts-installer instead of msttcorefonts ttf-mscorefonts-installer is already the newest version. 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. maria@maria-laptop:~$ It seems that is not a usual problem for use of XeLaTeX; nobody in the mentioned thread suggested instalation of anything else than TeX Live. Thanks in advance

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Exam 70-480 Study Material: Programming in HTML5 with JavaScript and CSS3

    - by Stacy Vicknair
    Here’s a list of sources of information for the different elements that comprise the 70-480 exam: General Resources http://www.w3schools.com (As pointed out in David Pallmann’s blog some of this content is unverified, but it is a decent source of information. For more about when it isn’t decent, see http://www.w3fools.com ) http://www.bloggedbychris.com/2012/09/19/microsoft-exam-70-480-study-guide/ (A guy who did a lot of what I did already, sadly I found this halfway through finishing my resources list. This list is expertly put together so I would recommend checking it out.) http://davidpallmann.blogspot.com/2012/08/microsoft-certification-exam-70-480.html http://pluralsight.com/training/Courses (Yes, this isn’t free, but if you look at the course listing there is an entire section on HTML5, CSS3 and Javascript. You can always try the trial!)   Some of the links I put below will overlap with the other resources above, but I tried to find explanations that looked beneficial to me on links outside those already mentioned.   Test Breakdown Implement and Manipulate Document Structures and Objects (24%) Create the document structure. o This objective may include but is not limited to: structure the UI by using semantic markup, including for search engines and screen readers (Section, Article, Nav, Header, Footer, and Aside); create a layout container in HTML http://www.w3schools.com/html/html5_new_elements.asp   Write code that interacts with UI controls. o This objective may include but is not limited to: programmatically add and modify HTML elements; implement media controls; implement HTML5 canvas and SVG graphics http://www.w3schools.com/html/html5_canvas.asp http://www.w3schools.com/html/html5_svg.asp   Apply styling to HTML elements programmatically. o This objective may include but is not limited to: change the location of an element; apply a transform; show and hide elements   Implement HTML5 APIs. o This objective may include but is not limited to: implement storage APIs, AppCache API, and Geolocation API http://www.w3schools.com/html/html5_geolocation.asp http://www.w3schools.com/html/html5_webstorage.asp http://www.w3schools.com/html/html5_app_cache.asp   Establish the scope of objects and variables. o This objective may include but is not limited to: define the lifetime of variables; keep objects out of the global namespace; use the “this” keyword to reference an object that fired an event; scope variables locally and globally http://robertnyman.com/2008/10/09/explaining-javascript-scope-and-closures/ http://www.quirksmode.org/js/this.html   Create and implement objects and methods. o This objective may include but is not limited to: implement native objects; create custom objects and custom properties for native objects using prototypes and functions; inherit from an object; implement native methods and create custom methods http://www.javascriptkit.com/javatutors/object.shtml http://www.crockford.com/javascript/inheritance.html http://stackoverflow.com/questions/1635116/javascript-class-method-vs-class-prototype-method http://www.javascriptkit.com/javatutors/proto.shtml     Implement Program Flow (25%) Implement program flow. o This objective may include but is not limited to: iterate across collections and array items; manage program decisions by using switch statements, if/then, and operators; evaluate expressions http://www.javascriptkit.com/jsref/looping.shtml http://www.javascriptkit.com/javatutors/varshort.shtml http://www.javascriptkit.com/javatutors/switch.shtml   Raise and handle an event. o This objective may include but is not limited to: handle common events exposed by DOM (OnBlur, OnFocus, OnClick); declare and handle bubbled events; handle an event by using an anonymous function http://dev.w3.org/2006/webapi/DOM-Level-3-Events/html/DOM3-Events.html http://javascript.info/tutorial/bubbling-and-capturing   Implement exception handling. o This objective may include but is not limited to: set and respond to error codes; throw an exception; request for null checks; implement try-catch-finally blocks http://www.javascriptkit.com/javatutors/trycatch.shtml   Implement a callback. o This objective may include but is not limited to: receive messages from the HTML5 WebSocket API; use jQuery to make an AJAX call; wire up an event; implement a callback by using anonymous functions; handle the “this” pointer http://www.w3.org/TR/2011/WD-websockets-20110419/ http://www.html5rocks.com/en/tutorials/websockets/basics/ http://api.jquery.com/jQuery.ajax/   Create a web worker process. o This objective may include but is not limited to: start and stop a web worker; pass data to a web worker; configure timeouts and intervals on the web worker; register an event listener for the web worker; limitations of a web worker https://developer.mozilla.org/en-US/docs/DOM/Using_web_workers http://www.html5rocks.com/en/tutorials/workers/basics/   Access and Secure Data (26%) Validate user input by using HTML5 elements. o This objective may include but is not limited to: choose the appropriate controls based on requirements; implement HTML input types and content attributes (for example, required) to collect user input http://diveintohtml5.info/forms.html   Validate user input by using JavaScript. o This objective may include but is not limited to: evaluate a regular expression to validate the input format; validate that you are getting the right kind of data type by using built-in functions; prevent code injection http://www.regular-expressions.info/javascript.html http://msdn.microsoft.com/en-us/library/66ztdbe6(v=vs.94).aspx https://developer.mozilla.org/en-US/docs/JavaScript/Reference/Operators/typeof http://blog.stackoverflow.com/2008/06/safe-html-and-xss/ http://stackoverflow.com/questions/942011/how-to-prevent-javascript-injection-attacks-within-user-generated-html   Consume data. o This objective may include but is not limited to: consume JSON and XML data; retrieve data by using web services; load data or get data from other sources by using XMLHTTPRequest http://www.erichynds.com/jquery/working-with-xml-jquery-and-javascript/ http://www.webdevstuff.com/86/javascript-xmlhttprequest-object.html http://www.json.org/ http://stackoverflow.com/questions/4935632/how-to-parse-json-in-javascript   Serialize, deserialize, and transmit data. o This objective may include but is not limited to: binary data; text data (JSON, XML); implement the jQuery serialize method; Form.Submit; parse data; send data by using XMLHTTPRequest; sanitize input by using URI/form encoding http://api.jquery.com/serialize/ http://www.javascript-coder.com/javascript-form/javascript-form-submit.phtml http://stackoverflow.com/questions/327685/is-there-a-way-to-read-binary-data-into-javascript https://developer.mozilla.org/en-US/docs/JavaScript/Reference/Global_Objects/encodeURI     Use CSS3 in Applications (25%) Style HTML text properties. o This objective may include but is not limited to: apply styles to text appearance (color, bold, italics); apply styles to text font (WOFF and @font-face, size); apply styles to text alignment, spacing, and indentation; apply styles to text hyphenation; apply styles for a text drop shadow http://www.w3schools.com/css/css_text.asp http://www.w3schools.com/css/css_font.asp http://nicewebtype.com/notes/2009/10/30/how-to-use-css-font-face/ http://webdesign.about.com/od/beginningcss/p/aacss5text.htm http://www.w3.org/TR/css3-text/ http://www.css3.info/preview/box-shadow/   Style HTML box properties. o This objective may include but is not limited to: apply styles to alter appearance attributes (size, border and rounding border corners, outline, padding, margin); apply styles to alter graphic effects (transparency, opacity, background image, gradients, shadow, clipping); apply styles to establish and change an element’s position (static, relative, absolute, fixed) http://net.tutsplus.com/tutorials/html-css-techniques/10-css3-properties-you-need-to-be-familiar-with/ http://www.w3schools.com/css/css_image_transparency.asp http://www.w3schools.com/cssref/pr_background-image.asp http://ie.microsoft.com/testdrive/graphics/cssgradientbackgroundmaker/default.html http://www.w3.org/TR/CSS21/visufx.html http://www.barelyfitz.com/screencast/html-training/css/positioning/ http://davidwalsh.name/css-fixed-position   Create a flexible content layout. o This objective may include but is not limited to: implement a layout using a flexible box model; implement a layout using multi-column; implement a layout using position floating and exclusions; implement a layout using grid alignment; implement a layout using regions, grouping, and nesting http://www.html5rocks.com/en/tutorials/flexbox/quick/ http://www.css3.info/preview/multi-column-layout/ http://msdn.microsoft.com/en-us/library/ie/hh673558(v=vs.85).aspx http://dev.w3.org/csswg/css3-grid-layout/ http://dev.w3.org/csswg/css3-regions/   Create an animated and adaptive UI. o This objective may include but is not limited to: animate objects by applying CSS transitions; apply 3-D and 2-D transformations; adjust UI based on media queries (device adaptations for output formats, displays, and representations); hide or disable controls http://www.bloggedbychris.com/2012/09/19/microsoft-exam-70-480-study-guide/   Find elements by using CSS selectors and jQuery. o This objective may include but is not limited to: choose the correct selector to reference an element; define element, style, and attribute selectors; find elements by using pseudo-elements and pseudo-classes (for example, :before, :first-line, :first-letter, :target, :lang, :checked, :first-child) http://www.bloggedbychris.com/2012/09/19/microsoft-exam-70-480-study-guide/   Structure a CSS file by using CSS selectors. o This objective may include but is not limited to: reference elements correctly; implement inheritance; override inheritance by using !important; style an element based on pseudo-elements and pseudo-classes (for example, :before, :first-line, :first-letter, :target, :lang, :checked, :first-child) http://www.bloggedbychris.com/2012/09/19/microsoft-exam-70-480-study-guide/   Technorati Tags: 70-480,CSS3,HTML5,HTML,CSS,JavaScript,Certification

    Read the article

1