Search Results

Search found 480 results on 20 pages for 'jamis charles'.

Page 1/20 | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Customer Spotlight - CSX: Charles Pack

    - by cwarticki
    A couple of weeks ago, I had the distinct privilege of facilitating a training session with CSX.  CSX is a wonderful customer.  They've been a dedicated Oracle customer for many years. They have quite an extensive Oracle footprint including Server Technologies, Fusion Middleware and E-Business Suite products.  They also utilize Oracle's Solution Support Center offering from Advanced Customer Services, for their Database products. I'm always on the lookout for Oracle gems and I discovered one at CSX. Before my session began, I met with Charles Pack.  In my view, he's an Oracle guru.  Don't take my word for it, just read any of the books he's authored or co-authored and the one soon to be released.  Just looking at his bookshelf, I saw titles going back to Oracle 7 & 8, as well as a Solaris 2.x book.  Remember those?   Anyway, Charles is a technologist and a manager (and wears numerous other hats too).  I had a wonderful time talking with Charles and getting to know him.  What do you consider keys to your personal success?  Inability to quit.  When I decide that I will accomplish something, I will, regardless of the nature of the challenge.  Never quitting means a perpetual drive for change and progress and setting examples for others to follow.  The reason I write OCP books is because I can provide a path for people to improve their knowledge of the product, gain a certification, and reach their professional goals. What do you consider the most important part of your job?  Negotiations.  We all have competing goals, incentives and finite resources, but we should all have the same common goal – progress.  So finding the way for all parties to progress is the most important thing we do. What is the most important part of your relationship with Oracle?  Oracle provides solutions – not just products - that are critical to our business success.  So continuous communication regarding education, services, product roadmaps and shared goals is the most important part of our ongoing relationship. Charles is an Oracle loyalist.  His career has been based on using our products and he's passionate about the products he works with.  You can tell, just by talking with him.  I appreciate Charles and other customers like him.  He's an expert in his field and an Oracle evangelist.  He is an asset to CSX and to their success.  He's an advocate for Oracle and an asset to our customers.  You can also friend and follow Charles on Twitter @charlesapack It was a pleasure meeting you Charles! -Chris Warticki Global Customer Management

    Read the article

  • Charles Barkley syndrome

    - by dacracot
    Charles Barkley was an excellent basketball player, a hall of fame, and a dream team member. He played for the 76ers, Suns, and Rockets. Yet he never won an NBA championship. Some might argue this was because he was never surrounded by other players of his caliber, and in the NBA, you can't win on your own. So what does this have to do with programming? How many of you out there feel like Sir Charles? Leading your team in every category, KLOCs, bugs fixed, systems configured... Always the one pushing for improvements, upgrading systems, negotiating with customers... Feeling like you are carrying the team. Anger just under the surface. Only to retire eventually, without "the ring"1. 1: Keep in mind, Charles never blamed his team. He just performed at his best.

    Read the article

  • Talking JavaOne with Rock Star Charles Nutter

    - by Janice J. Heiss
    JavaOne Rock Stars, conceived in 2005, are the top rated speakers from the JavaOne Conference. They are awarded by their peers who through conference surveys recognize them for their outstanding sessions and speaking ability. Over the years many of the world’s leading Java developers have been so recognized.We spoke with distinguished Rock Star, Charles Nutter. A JRuby Update from Charles NutterCharles Nutter of Red Hat is well known as a lead developer of JRuby, a Ruby implementation of Java that is tightly integrated with Java to allow for the embedding of the interpreter into any Java application with full two-way access between the Java and the Ruby code. Nutter is giving the following sessions at this year’s JavaOne: CON7257 – “JVM Bytecode for Dummies (and the Rest of Us Too)” CON7284 – “Implementing Ruby: The Long, Hard Road” CON7263 – “JVM JIT for Dummies” BOF6682 – “I’ve Got 99 Languages, but Java Ain’t One” CON6575 – “Polyglot for Dummies” (Both with Thomas Enebo) I asked Nutter, to give us the latest on JRuby. “JRuby seems to have hit a tipping point this past year,” he explained, “moving from ‘just another Ruby implementation’ to ‘the best Ruby implementation for X,’ where X may be performance, scaling, big data, stability, reliability, security, and a number of other features important for today's applications. We're currently wrapping up JRuby 1.7, which improves support for Ruby 1.9 APIs, solves a number of user issues and concurrency challenges, and utilizes invokedynamic to outperform all other Ruby implementations by a wide margin. JRuby just gets better and better.” When asked what he thought about the rapid growth of alternative languages for the JVM, he replied, “I'm very intrigued by efforts to bring a high-performance JavaScript runtime to the JVM. There's really no reason the JVM couldn't be the fastest platform for running JavaScript with the right implementation, and I'm excited to see that happen.”And what is Nutter working on currently? “Aside from JRuby 1.7 wrap-up,” he explained, “I'm helping the Hotspot developers investigate invokedynamic performance issues and test-driving their new invokedynamic code in Java 8. I'm also starting to explore ways to improve the general state of dynamic languages on the JVM using JRuby as a guide, and to help the JVM become a better platform for all kinds of languages.”

    Read the article

  • Talking JavaOne with Rock Star Charles Nutter

    - by Janice J. Heiss
    JavaOne Rock Stars, conceived in 2005, are the top rated speakers from the JavaOne Conference. They are awarded by their peers who through conference surveys recognize them for their outstanding sessions and speaking ability. Over the years many of the world’s leading Java developers have been so recognized.We spoke with distinguished Rock Star, Charles Nutter. A JRuby Update from Charles NutterCharles Nutter of Red Hat is well known as a lead developer of JRuby, a Ruby implementation of Java that is tightly integrated with Java to allow for the embedding of the interpreter into any Java application with full two-way access between the Java and the Ruby code. Nutter is giving the following sessions at this year’s JavaOne: CON7257 – “JVM Bytecode for Dummies (and the Rest of Us Too)” CON7284 – “Implementing Ruby: The Long, Hard Road” CON7263 – “JVM JIT for Dummies” BOF6682 – “I’ve Got 99 Languages, but Java Ain’t One” CON6575 – “Polyglot for Dummies” (Both with Thomas Enebo) I asked Nutter, to give us the latest on JRuby. “JRuby seems to have hit a tipping point this past year,” he explained, “moving from ‘just another Ruby implementation’ to ‘the best Ruby implementation for X,’ where X may be performance, scaling, big data, stability, reliability, security, and a number of other features important for today's applications. We're currently wrapping up JRuby 1.7, which improves support for Ruby 1.9 APIs, solves a number of user issues and concurrency challenges, and utilizes invokedynamic to outperform all other Ruby implementations by a wide margin. JRuby just gets better and better.” When asked what he thought about the rapid growth of alternative languages for the JVM, he replied, “I'm very intrigued by efforts to bring a high-performance JavaScript runtime to the JVM. There's really no reason the JVM couldn't be the fastest platform for running JavaScript with the right implementation, and I'm excited to see that happen.”And what is Nutter working on currently? “Aside from JRuby 1.7 wrap-up,” he explained, “I'm helping the Hotspot developers investigate invokedynamic performance issues and test-driving their new invokedynamic code in Java 8. I'm also starting to explore ways to improve the general state of dynamic languages on the JVM using JRuby as a guide, and to help the JVM become a better platform for all kinds of languages.” Originally published on blogs.oracle.com/javaone.

    Read the article

  • Apprentissage de PySide, le binding Qt de Nokia pour Python, un article de Charles-Elie Gentil

    Bonjour, Vous trouverez ci-dessous le lien vers un tutoriel destiné à aider le programmeur Python à l'apprentissage de PySide, le binding Qt de Nokia pour Python. Il part de la présentations des widgets de bases jusqu'à la conception d'un programme minimaliste. Bonne lecture à tous et n'hésitez pas à poster vos commentaires. Apprentissage de PySide, le binding Qt de Nokia pour Python et création d'une première application...

    Read the article

  • Compat Wireless Drivers Centrino N-2230

    - by user2699451
    So I am using linux and am having trouble installing the Compat Wireless drivers Hardware: Intel Centrino N-2230 OS: Linux Mint 64bit (kernel 13.08-generic) I followed this link http://www.mathyvanhoef.com/2012/09/compat-wireless-injection-patch-for.html Output: apt-get install linux-headers-$(uname -r) Reading package lists... Done Building dependency tree Reading state information... Done linux-headers-3.8.0-19-generic is already the newest version. 0 upgraded, 0 newly installed, 0 to remove and 19 not upgraded. charles-W55xEU compat-wireless-2010-10-16 # cd ~ charles-W55xEU ~ # dir adt-bundle-linux-x86_64-20130917.zip Desktop known_hosts_backup charles-W55xEU ~ # wget http://www.orbit-lab.org/kernel/compat-wireless-3-stable/v3.6/compat-wireless-3.6.2-1-snp.tar.bz2 --2013-10-29 10:28:23-- http://www.orbit-lab.org/kernel/compat-wireless-3-stable/v3.6/compat-wireless-3.6.2-1-snp.tar.bz2 Resolving www.orbit-lab.org (www.orbit-lab.org)... 128.6.192.131 Connecting to www.orbit-lab.org (www.orbit-lab.org)|128.6.192.131|:80... connected. HTTP request sent, awaiting response... 200 OK Length: 4443700 (4,2M) [application/x-bzip2] Saving to: ‘compat-wireless-3.6.2-1-snp.tar.bz2’ 100%[======================================>] 4 443 700 13,5KB/s in 11m 3s 2013-10-29 10:39:27 (6,55 KB/s) - ‘compat-wireless-3.6.2-1-snp.tar.bz2’ saved [4443700/4443700] charles-W55xEU ~ # tar -xf compat-wireless-3.6.2-1-snp.tar.bz2 charles-W55xEU ~ # cd compat-wireless-3.6-rc6-1 bash: cd: compat-wireless-3.6-rc6-1: No such file or directory charles-W55xEU ~ # dir adt-bundle-linux-x86_64-20130917.zip Desktop compat-wireless-3.6.2-1-snp known_hosts_backup compat-wireless-3.6.2-1-snp.tar.bz2 charles-W55xEU ~ # cd compat-wireless-3.6.2-1-snp/ charles-W55xEU compat-wireless-3.6.2-1-snp # dir code-metrics.txt defconfigs linux-next-pending pending-stable compat drivers MAINTAINERS README config.mk enable-older-kernels Makefile scripts COPYRIGHT include net udev crap linux-next-cherry-picks patches charles-W55xEU compat-wireless-3.6.2-1-snp # wget http://patches.aircrack-ng.org/mac80211.compat08082009.wl_frag+ack_v1.patch --2013-10-29 10:40:52-- http://patches.aircrack-ng.org/mac80211.compat08082009.wl_frag+ack_v1.patch Resolving patches.aircrack-ng.org (patches.aircrack-ng.org)... 213.186.33.2, 2001:41d0:1:1b00:213:186:33:2 Connecting to patches.aircrack-ng.org (patches.aircrack-ng.org)|213.186.33.2|:80... connected. HTTP request sent, awaiting response... 200 OK Length: 1049 (1,0K) [text/plain] Saving to: ‘mac80211.compat08082009.wl_frag+ack_v1.patch’ 100%[======================================>] 1 049 --.-K/s in 0s 2013-10-29 10:40:56 (180 MB/s) - ‘mac80211.compat08082009.wl_frag+ack_v1.patch’ saved [1049/1049] charles-W55xEU compat-wireless-3.6.2-1-snp # patch -p1 < mac80211.compat08082009.wl_frag+ack_v1.patch patching file net/mac80211/tx.c Hunk #1 succeeded at 792 (offset 115 lines). charles-W55xEU compat-wireless-3.6.2-1-snp # wget -Ocompatwireless_chan_qos_frag.patch http://pastie.textmate.org/pastes/4882675/download --2013-10-29 10:43:18-- http://pastie.textmate.org/pastes/4882675/download Resolving pastie.textmate.org (pastie.textmate.org)... 178.79.137.125 Connecting to pastie.textmate.org (pastie.textmate.org)|178.79.137.125|:80... connected. HTTP request sent, awaiting response... 301 Moved Permanently Location: http://pastie.org/pastes/4882675/download [following] --2013-10-29 10:43:20-- http://pastie.org/pastes/4882675/download Resolving pastie.org (pastie.org)... 96.126.119.119 Connecting to pastie.org (pastie.org)|96.126.119.119|:80... connected. HTTP request sent, awaiting response... 200 OK Length: 2036 (2,0K) [application/octet-stream] Saving to: ‘compatwireless_chan_qos_frag.patch’ 100%[======================================>] 2 036 --.-K/s in 0,001s 2013-10-29 10:43:21 (3,35 MB/s) - ‘compatwireless_chan_qos_frag.patch’ saved [2036/2036] charles-W55xEU compat-wireless-3.6.2-1-snp # patch -p1 < compatwireless_chan_qos_frag.patch patching file drivers/net/wireless/rtl818x/rtl8187/dev.c patching file net/mac80211/tx.c Hunk #1 succeeded at 1495 (offset 8 lines). patching file net/wireless/chan.c charles-W55xEU compat-wireless-3.6.2-1-snp # make ./scripts/gen-compat-autoconf.sh /root/compat-wireless-3.6.2-1-snp/.config /root/compat-wireless-3.6.2-1-snp/config.mk > include/linux/compat_autoconf.h make -C /lib/modules/3.8.0-19-generic/build M=/root/compat-wireless-3.6.2-1-snp modules make[1]: Entering directory `/usr/src/linux-headers-3.8.0-19-generic' CC [M] /root/compat-wireless-3.6.2-1-snp/compat/main.o LD [M] /root/compat-wireless-3.6.2-1-snp/compat/compat.o CC [M] /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.o In file included from /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma.h:8:0, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/bcma_private.h:8, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:8: /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma_driver_pci.h:217:23: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_core_pci_init’ In file included from /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma.h:10:0, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/bcma_private.h:8, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:8: /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma_driver_gmac_cmn.h:95:23: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_core_gmac_cmn_init’ In file included from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:8:0: /root/compat-wireless-3.6.2-1-snp/drivers/bcma/bcma_private.h:25:15: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_bus_register’ /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:152:15: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_bus_register’ /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:17:21: warning: ‘bcma_bus_next_num’ defined but not used [-Wunused-variable] /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:93:12: warning: ‘bcma_register_cores’ defined but not used [-Wunused-function] make[3]: *** [/root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.o] Error 1 make[2]: *** [/root/compat-wireless-3.6.2-1-snp/drivers/bcma] Error 2 make[1]: *** [_module_/root/compat-wireless-3.6.2-1-snp] Error 2 make[1]: Leaving directory `/usr/src/linux-headers-3.8.0-19-generic' make: *** [modules] Error 2 charles-W55xEU compat-wireless-3.6.2-1-snp # make install Warning: You may or may not need to update your initframfs, you should if any of the modules installed are part of your initramfs. To add support for your distribution to do this automatically send a patch against ./scripts/update-initramfs. If your distribution does not require this send a patch against the '/usr/bin/lsb_release -i -s': LinuxMint tag for your distribution to avoid this warning. make -C /lib/modules/3.8.0-19-generic/build M=/root/compat-wireless-3.6.2-1-snp modules make[1]: Entering directory `/usr/src/linux-headers-3.8.0-19-generic' CC [M] /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.o In file included from /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma.h:8:0, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/bcma_private.h:8, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:8: /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma_driver_pci.h:217:23: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_core_pci_init’ In file included from /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma.h:10:0, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/bcma_private.h:8, from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:8: /root/compat-wireless-3.6.2-1-snp/include/linux/bcma/bcma_driver_gmac_cmn.h:95:23: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_core_gmac_cmn_init’ In file included from /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:8:0: /root/compat-wireless-3.6.2-1-snp/drivers/bcma/bcma_private.h:25:15: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_bus_register’ /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:152:15: error: expected ‘=’, ‘,’, ‘;’, ‘asm’ or ‘__attribute__’ before ‘bcma_bus_register’ /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:17:21: warning: ‘bcma_bus_next_num’ defined but not used [-Wunused-variable] /root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.c:93:12: warning: ‘bcma_register_cores’ defined but not used [-Wunused-function] make[3]: *** [/root/compat-wireless-3.6.2-1-snp/drivers/bcma/main.o] Error 1 make[2]: *** [/root/compat-wireless-3.6.2-1-snp/drivers/bcma] Error 2 make[1]: *** [_module_/root/compat-wireless-3.6.2-1-snp] Error 2 make[1]: Leaving directory `/usr/src/linux-headers-3.8.0-19-generic' make: *** [modules] Error 2 charles-W55xEU compat-wireless-3.6.2-1-snp # It keeps giving errors, same with other sites, I get the same errors??? I am lost, help needed

    Read the article

  • Is it still worth reading Programming Windows by Charles Petzold?

    - by Morke
    I've been wanting to delve a bit deeper in win32 programming, and I was wondering what the best book on this subject is. Most people seem to recommend Programming Windows by Charles Petzold, however, the latest version of this book is from 1998 and deals with windows 98. Is it still worth reading or should I try other books? If so, which ones?

    Read the article

  • Formatting data from management database

    - by bVector
    I've got some data that goes like this: Config_Name Question Answer Cisco WAN Sensitivity: High Cisco WAN Authorized Users: Brent, Charles Cisco WAN Last Audited: n/a Cisco WAN Next Audit: 3/30/2012 Cisco WAN Audit Signature: Cisco WAN Username: MYCOMPANY Cisco WAN Password: Cisco WAN Encrypted-A ENCRYPTED DATA Cisco WAN Encrypted-B Cisco WAN Encrypted-C vCenter server Sensitivity: High vCenter server Authorized Users: Brent, Charles vCenter server Last Audited: vCenter server Next Audit: 3/30/2012 vCenter server Audit Signature: ENCRYPTED DATA vCenter server Username: administrator vCenter server Password: vCenter server Encrypted-A ENCRYPTED DATA vCenter server Encrypted-B vCenter server Encrypted-C AKSC-NE01 IPMI Sensitivity: High AKSC-NE01 IPMI Authorized Users: Brent, Charles AKSC-NE01 IPMI Last Audited: AKSC-NE01 IPMI Next Audit: 3/30/2012 AKSC-NE01 IPMI Audit Signature: ENCRYPTED DATA AKSC-NE01 IPMI Username: MYCOMPANY AKSC-NE01 IPMI Password: AKSC-NE01 IPMI Encrypted-A ENCRYPTED DATA AKSC-NE01 IPMI Encrypted-B AKSC-NE01 IPMI Encrypted-C and I need it to be in this format: Config_Name Sensitivity: Authorized Users: Last Audited: Next Audit: Audit Signature: Username: Password: Encrypted-A Encrypted-B Encrypted-C AKSC-NE01 IPMI High Brent, Charles 3/30/2012 ENCRYPTED DATA MYCOMPANY ENCRYPTED DATA Cisco ASA5505 WAN High Brent, Charles n/a 3/30/2012 ENCRYPTED DATA MYCOMPANY ENCRYPTED DATA vCenter server High Brent, Charles 3/30/2012 ENCRYPTED DATA administrator ENCRYPTED DATA the tabs get messed up on here but hopefully you get my drift. does anyone know an easy way to do this? I haven't found one with excel just yet.

    Read the article

  • linux mint VIA sound issue

    - by user2699451
    So I installed linux Mint 15 "Olivia" 64 bit on my Mecer W550EU laptop I have HD Audio with a VIA chipset charles-W55xEU charles # lsmod | grep snd snd_hda_codec_hdmi 36913 1 snd_hda_codec_via 51018 1 snd_hda_intel 39619 5 snd_hda_codec 136453 3 snd_hda_codec_hdmi,snd_hda_codec_via,snd_hda_intel snd_hwdep 13602 1 snd_hda_codec snd_pcm 97451 4 snd_hda_codec_hdmi,snd_hda_codec,snd_hda_intel snd_page_alloc 18710 2 snd_pcm,snd_hda_intel snd_seq_midi 13324 0 snd_seq_midi_event 14899 1 snd_seq_midi snd_rawmidi 30180 1 snd_seq_midi snd_seq 61554 2 snd_seq_midi_event,snd_seq_midi snd_seq_device 14497 3 snd_seq,snd_rawmidi,snd_seq_midi snd_timer 29425 2 snd_pcm,snd_seq snd 68876 19 snd_hwdep,snd_timer,snd_hda_codec_hdmi,snd_hda_codec_via,snd_pcm,snd_seq,snd_rawmidi,snd_hda_codec,snd_hda_intel,snd_seq_device soundcore 12680 1 snd And my sound card charles-W55xEU charles # aplay -l **** List of PLAYBACK Hardware Devices **** card 0: PCH [HDA Intel PCH], device 0: VT1802 Analog [VT1802 Analog] Subdevices: 1/1 Subdevice #0: subdevice #0 card 0: PCH [HDA Intel PCH], device 2: VT1802 HP [VT1802 HP] Subdevices: 1/1 Subdevice #0: subdevice #0 card 0: PCH [HDA Intel PCH], device 3: HDMI 0 [HDMI 0] Subdevices: 1/1 Subdevice #0: subdevice #0 and my audio device charles-W55xEU charles # lspci -v | grep -A7 -i "audio" 00:1b.0 Audio device: Intel Corporation 7 Series/C210 Series Chipset Family High `Definition Audio Controller (rev 04)` Subsystem: CLEVO/KAPOK Computer Device 0550 Flags: bus master, fast devsel, latency 0, IRQ 47 Memory at f7c10000 (64-bit, non-prefetchable) [size=16K] Capabilities: [50] Power Management version 2 Capabilities: [60] MSI: Enable+ Count=1/1 Maskable- 64bit+ Capabilities: [70] Express Root Complex Integrated Endpoint, MSI 00 Capabilities: [100] Virtual Channel Sometimes when I boot up, soundworks, other times it doenst, it is completely random, so far, no-one on xchat linux help or linux mint forums was able to help me, I have always had issues with sound on VIA chipsets I have: sudo apt-get upgrade && apt-get install mint-meta-cinnamon it seemed to help but after 2-3 reboots, the problem came back, btw, everytime I checked, pulse audio is selected to Duplex Audio Input & Output and alsa mixer is always unmuted!

    Read the article

  • Ada and 'The Book'

    - by Phil Factor
    The long friendship between Charles Babbage and Ada Lovelace created one of the most exciting and mysterious of collaborations ever to have resulted in a technological breakthrough. The fireworks that created by the collision of two prodigious mathematical and creative talents resulted in an invention, the Analytical Engine, which went on to change society fundamentally. However, beyond that, we just don't know what the bulk of their collaborative work was about:;  it was done in strictest secrecy. Even the known outcome of their friendship, the first programmable computer, was shrouded in mystery. At the time, nobody, except close friends and family, had any idea of Ada Byron's contribution to the invention of the ‘Engine’, and how to program it. Her great insight was published in August 1843, under the initials AAL, standing for Ada Augusta Lovelace, her title then being the Countess of Lovelace. It was contained in a lengthy ‘note’ to her translation of a publication that remains the best description of Babbage's amazing Analytical Engine. The secret identity of the person behind those enigmatic initials was finally revealed by Prince de Polignac who, seventy years later, wrote to Ada's daughter to seek confirmation that her mother had, indeed, been the author of the brilliant sentences that described so accurately how Babbage's mechanical computer could be programmed with punch-cards. L.F. Menabrea's paper on the Analytical Engine first appeared in the 'Bibliotheque Universelle de Geneve' in October 1842, and Ada translated it anonymously for Taylor's 'Scientific Memoirs'. Charles Babbage was surprised that she had not written an original paper as she already knew a surprising amount about the way the machine worked. He persuaded her to at least write some explanatory notes. These notes ended up extending to four times the length of the original article and represented the first published account of how a machine could be programmed to perform any calculation. Her example of programming the Bernoulli sequence would have worked on the Analytical engine had the device’s construction been completed, and gave Ada an unassailable claim to have invented the art of programming. What was the reason for Ada's secrecy? She was the only legitimate child of Lord Byron, who was probably the best known celebrity of the age, so she was already famous. She was a senior aristocrat, with titles, a fortune in money and vast estates in the Midlands. She had political influence, and was the cousin of Lord Melbourne, who was the Prime Minister at that time. She was friendly with the young Queen Victoria. Her mathematical activities were a pastime, and not one that would be considered by others to be in keeping with her roles and responsibilities. You wouldn't dare to dream up a fictional heroine like Ada. She was dazzlingly beautiful and talented. She could speak several languages fluently, and play some musical instruments with professional skill. Contemporary accounts refer to her being 'accomplished in science, art and literature'. On top of that, she was a brilliant mathematician, a talent inherited from her mother, Annabella Milbanke. In her mother's circle of literary and scientific friends was Charles Babbage, and Ada's friendship with him dates from her teenage zest for Mathematics. She was one of the first people he'd ever met who understood what he had attempted to achieve with the 'Difference Engine', and with whom he could converse as intellectual equals. He arranged for her to have an education from the most talented academics in the country. Ada melted the heart of the cantankerous genius to the point that he became a faithful and loyal father-figure to her. She was one of the very few who could grasp the principles of the later, and very different, ‘Analytical Engine’ which was designed from the start to tackle a variety of tasks. Sadly, Ada Byron's life ended less than a decade after completing the work that assured her long-term fame, in November 1852. She was dying of cancer, her gambling habits had caused her to run up huge debts, she'd had more than one affairs, and she was being blackmailed. Her brilliant but unempathic mother was nursing her in her final illness, destroying her personal letters and records, and repaying her debts. Her husband was distraught but helpless. Charles Babbage, however, maintained his steadfast paternalistic friendship to the end. She appointed her loyal friend to be her executor. For years, she and Babbage had been working together on a secret project, known only as 'The Book'. We have a clue to what it was in a letter written by her nine years earlier, on 11th August 1843. It was a joint project by herself and Lord Lovelace, her husband, and was intended to involve Babbage's 'undivided energies'. It involved 'consulting your Engine' (it required Babbage’s computer). The letter gives no hint about the project except for the high-minded nature of its purpose, and its highly mathematical nature.  From then on, the surviving correspondence between the two gives only veiled references to 'The Book'. There isn't much, since Babbage later destroyed any letters that could have damaged her reputation within the Establishment. 'I cannot spare the book today, which I am very sorry for. At the moment I want it for constant reference, but I think you can have it tomorrow' (Oct 1844)  And 'I will send you the book directly, and you can say, when you receive it, how long you will want to keep it'. (Nov 1844)  The two of them were obviously intent on the work: She writes, four years later, 'I have an engagement for Wednesday which will prevent me from attending to your wishes about the book' (Dec 1848). This was something that they both needed to work on, but could not do in parallel: 'I will send the book on Tuesday, and it can be left with you till Friday' (11 Feb 1849). After six years work, it had been so well-handled that it was beginning to fall apart: 'Don't forget the new cover you promised for the book. The poor book is very shabby and wants one' (20 Sept 1849). So what was going on? The word 'book' was not a code-word: it was a real book, probably a 'printer's blank', plain paper, but properly bound so printers and publishers could show off how the published work might look. The hints from the correspondence are of advanced mathematics. It is obvious that the book was travelling between them, back and forth, each one working on it for less than a week before passing it back. Ada and her husband were certainly involved in gambling large sums of money on the horses, and so most biographers have concluded that the three of them were trying to calculate the mathematical odds on the horses. This theory has three large problems. Firstly, Ada's original letter proposing the project refers to its high-minded nature. Babbage was temperamentally opposed to gambling and would scarcely have given so much time to the project, even though he was devoted to Ada. Secondly, Babbage would have very soon have realized the hopelessness of trying to beat the bookies. This sort of betting never attracts his type of intellectual background. The third problem is that any work on calculating the odds on horses would not need a well-thumbed book to pass back and forth between them; they would have not had to work in series. The original project was instigated by Ada, along with her husband, William King-Noel, 1st Earl of Lovelace. Charles Babbage was invited to join the project after the couple had come up with the idea. What could William have contributed? One might assume that William was a Bertie Wooster character, addicted only to the joys of the turf, but this was far from the truth. He was a scientist, a Cambridge graduate who was later elected to be a Fellow of the Royal Society. After Eton, he went to Trinity College, Cambridge. On graduation, he entered the diplomatic service and acted as secretary under Lord Nugent, who was Lord Commissioner of the Ionian Islands. William was very friendly with Babbage too, able to discuss scientific matters on equal terms. He was a capable engineer who invented a process for bending large timbers by the application of steam heat. He delivered a paper to the Institution of Civil Engineers in 1849, and received praise from the great engineer, Isambard Kingdom Brunel. As well as being Lord Lieutenant of the County of Surrey for most of Victoria's reign, he had time for a string of scientific and engineering achievements. Whatever the project was, it is unlikely that William was a junior partner. After Ada's death, the project disappeared. Then, two years later, Babbage, through one of his occasional outbursts of temper, demonstrated that he was able to decrypt one of the most powerful of secret codes, Vigenère's autokey cipher.  All contemporary diplomatic and military messages used a variant of this cipher. Babbage had made three important discoveries, namely, the mathematical law of this cipher, the principle of the key periodicity, and the technique of the symmetry of position. The technique is now known as the Kasiski examination, also called the Kasiski test, but Babbage got there first. At one time, he listed amongst his future projects, the writing of a book 'The Philosophy of Decyphering', but it never came to anything. This discovery was going to change the course of history, since it was used to decipher the Russians’ military dispatches in the Crimean war. Babbage himself played a role during the Crimean War as a cryptographical adviser to his friend, Rear-Admiral Sir Francis Beaufort of the Admiralty. This is as much as we can be certain about in trying to make sense of the bulk of the time that Charles Babbage and Ada Lovelace worked together. Nine years of intensive work, involving the 'Engine' and a great deal of mathematics and research seems to have been lost: or has it? I've argued in the past http://www.simple-talk.com/community/blogs/philfactor/archive/2008/06/13/59614.aspx that the cracking of the Vigenère autokey cipher, was a fundamental motive behind the British Government's support and funding of the 'Difference Engine'. The Duke of Wellington, whose understanding of the military significance of being able to read enemy dispatches, was the most steadfast advocate of the project. If the three friends were actually doing the work of cracking codes by mathematical techniques that used the techniques of key periodicity, and symmetry of position (the use of a book being passed quickly to and fro is very suggestive), intending to then use the 'Engine' to do the routine cracking of each dispatch, then this is a rather different story. The project was Ada and William's idea. (William had served in the diplomatic service and would be familiar with the use of codes). This makes Ada Lovelace the initiator of a project which, by giving both Britain, and probably the USA, a diplomatic and military advantage in the second part of the Nineteenth century, changed world history. Ada would never have wanted any credit for cracking the cipher, and developing the method that rendered all contemporary military and diplomatic ciphering techniques nugatory; quite the reverse. And it is clear from the gaps in the record of the letters between the collaborators that the evidence was destroyed, probably on her request by her irascible but intensely honorable executor, Charles Babbage. Charles Babbage toyed with the idea of going public, but the Crimean war put an end to that. The British Government had a valuable secret, and intended to keep it that way. Ada and Charles had quite often discussed possible moneymaking projects that would fund the development of the Analytic Engine, the first programmable computer, but their secret work was never in the running as a potential cash cow. I suspect that the British Government was, even then, working on the concealment of a discovery whose value to the nation depended on it remaining so. The success of code-breaking in the Crimean war, and the American Civil war, led to the British and Americans  subsequently giving much more weight and funding to the science of decryption. Paradoxically, this makes Ada's contribution even closer to the creation of Colossus, the first digital computer, at Bletchley Park, specifically to crack the Nazi’s secret codes.

    Read the article

  • Setting up a transparent SSL proxy

    - by badunk
    I've got a linux box set up with 2 network cards to inspect traffic going through port 80. One card is used to go out to the internet, the other one is hooked up to a networking switch. The point is to be able to inspect all HTTP and HTTPS traffic on devices hooked up to that switch for debugging purposes. I've written the following rules for iptables: nat -A PREROUTING -i eth1 -p tcp -m tcp --dport 80 -j DNAT --to-destination 192.168.2.1:1337 -A PREROUTING -i eth1 -p tcp -m tcp --dport 80 -j REDIRECT --to-ports 1337 -A POSTROUTING -s 192.168.2.0/24 -o eth0 -j MASQUERADE On 192.168.2.1:1337, I've got a transparent http proxy using Charles (http://www.charlesproxy.com/) for recording. Everything's fine for port 80, but when I add similar rules for port 443 (SSL) pointing to port 1337, I get an error about invalid message through Charles. I've used SSL proxying on the same computer before with Charles (http://www.charlesproxy.com/documentation/proxying/ssl-proxying/), but have been unsuccessful with doing it transparently for some reason. Some resources I've googled say its not possible - I'm willing to accept that as an answer if someone can explain why. As a note, I have full access to the described set up including all the clients hooked up to the subnet - so I can accept self-signed certs by Charles. The solution doesn't have to be Charles-specific since in theory, any transparent proxy will do. Thanks! Edit: After playing with it a little, I was able to get it working for a specific host. When I modify my iptables to the following (and open 1338 in charles for reverse proxy): nat -A PREROUTING -i eth1 -p tcp -m tcp --dport 80 -j DNAT --to-destination 192.168.2.1:1337 -A PREROUTING -i eth1 -p tcp -m tcp --dport 80 -j REDIRECT --to-ports 1337 -A PREROUTING -i eth1 -p tcp -m tcp --dport 443 -j DNAT --to-destination 192.168.2.1:1338 -A PREROUTING -i eth1 -p tcp -m tcp --dport 443 -j REDIRECT --to-ports 1338 -A POSTROUTING -s 192.168.2.0/24 -o eth0 -j MASQUERADE I am able to get a response, but with no destination host. In the reverse proxy, if I just specify that everything from 1338 goes to a specific host that I wanted to hit, it performs the hand shake properly and I can turn on SSL proxying to inspect the communication. The setup is less than ideal because I don't want to assume everything from 1338 goes to that host - any idea why the destination host is being stripped? Thanks again

    Read the article

  • Silverlight Cream for June 16, 2010 -- #884

    - by Dave Campbell
    In this Issue: Zoltan Arvai, Emiel Jongerius, Charles Petzold, Adam Kinney, Deepesh Mohnani, Timmy Kokke, and Damon Payne. Shoutouts: Andy Beaulieu reported his Coding4Fun: Shuffleboard Game for WP7 has been posted -- Big ol' Tutorial and 6 videos of WP7 goodness Karl Shifflett announced Three New WPF and Silverlight Designer Videos Posted Charles Petzold has a cool Flip-Number Clock in Silverlight posted... cool demo, and the source. From SilverlightCream.com: Data Driven Applications with MVVM Part II: Messaging, Unit Testing, and Live Data Sources Zoltan Arvai has part 2 of his Data-Driven Apps with MVVM up, and this one is also including Messaging, Unit Testing, and Live WCF Data... good tutorial and all the code. Silverlight DataContext Changed Event and Trigger Emiel Jongerius takes a hard swing at the lack of DataContextChanged... his solution involves two attached properties instead of one... check it out and see what you think! Orientation Strategies for Windows Phone 7 Charles Petzold is discussing WP7 Orientation... showing the problems you can get involved in, and how to work through them... and you might be surprised at how he does it :) ... pretty cool as usual, Charles! Debugging the TranslateZoomRotate WPF Behavior in Blend Adam Kinney talks through a bug reported about the WPF TranslateZoomRotate Behavior. Again, it's WPF, but it's in Blend, and ya never know when the solution might apply. I want my app to look like the Zune client Deepesh Mohnani demonstrates using the Cosmopolitan theme to get his app to have the same look as the Zune client. MVVM Project and Item Templates Timmy Kokke is continuing with his cool SilverAmp media player, using it to expand upon the new Blend and Silverlight 4 features. This episode touches very lightly on cranking up a new MVVM project in Blend. Great Features for MVVM Friendly Objects Part 0: Favor Composition Over Inheritance Damon Payne has the first part up of a series he's working on with 'MVVM Friendly' features... he's building out a lot of the infrastructure in this post for the ones that follow... all good stuff. Stay in the 'Light! Twitter SilverlightNews | Twitter WynApse | WynApse.com | Tagged Posts | SilverlightCream Join me @ SilverlightCream | Phoenix Silverlight User Group Technorati Tags: Silverlight    Silverlight 3    Silverlight 4    Windows Phone MIX10

    Read the article

  • Un e-Book pour se familiariser avec Windows Phone 7 Series propose six chapitres en avant-première g

    Microsoft : un e-Book pour se familiariser avec Windows Phone 7 Series Six chapitres en avant-première gratuite font déjà beaucoup parler de lui Au cas où vous ne le connaîtriez pas, Charles Petzold est un MVP de Microsoft auteur d'une liste longue comme le bras de livres renommés sur les technologies de Redmond. [IMG]http://ftp-developpez.com/gordon-fowler/Tattoo.jpg[/IMG] Charles Petzold et son tatouage Windows Avec la sortie de la platef...

    Read the article

  • Sonicwall - dual WAN ports - switch from one to another

    - by Charles
    Hi, Folks! I'm using a SonicWall NSA 240 which has two WAN ports (T1 and Comcast) and the LAN port has a cable which connects to a switch. From the switch, several cables connect to other switches. The SonicWall doesn't have DHCP enabled; one of our domain controllers running Windows Server 2003 also functions as a DHCP server. Is there a way for a user in our network to change connection from T1 to Comcast as their ISP or vice versa? In other words, if a user is connected via the T1, can he/she somehow connect via Comcast instead? Thanks, in advance, for your help! Sincerely, Charles

    Read the article

  • AIIM Best Practice Awards to Two Oracle Customers

    - by [email protected]
    On Tuesday night at the AIIM Awards Banquet, two Oracle customers and their implementation partners won awards for their Oracle Enterprise 2.0 implementations. The Bureau of Indian Affairs, a division of the Department of Interior, won a Carl E. Nelson Best Practices Award for their implementation of Oracle WebCenter and Oracle Content Management to provide an interactive social media environment to engage and inform their constituent communities. The BIA Citizen Portal provides all the services of the Bureau of Indian Affairs to the community of 564 federally recognized tribes that include over 1.9 million American Indians and Alaska Natives. This integration was achieved with the support of Oracle partner Mythics. The Charles Town Police Department integrated Oracle Content Management to integrate with and support their police evidence system. This integration was created in partnership with Oracle partner EDAC Systems Inc. Diane Hoppe of EDAC Systems Inc. was on hand to receive the award for Charles Town Police Department. You can see pictures of our award winners here: Linus Chow, Oracle; John Mancini, President of AIIM; and Diane Hoppe, EDACS - Charles Town Police: John Mancini, President of AIIM; Linus Chow, Oracle; Chris Baker, Mythics; and Bureau of Indian Affairs Oracle, EDACS, Mythics, BIA You can read more in the AIIM press release.

    Read the article

  • Reference to undeclared entity 'nbsp' - why?

    - by Charles
    I have the following line of code: XDocument formConfiguration = XDocument.Load(ConfigurationManager.AppSettings["XMLFileURL"]); I get the following exception message: Reference to undeclared entity 'nbsp' There are no   sequences in the XML. There are no "&" characters in the XML. Where could this be coming from? Thanks, Charles

    Read the article

  • Excel 2007 floating format toolbar customisation

    - by Charles
    Is it possible in Excel 2007 to customise the floating format bar that is shown when you right-click on a cell? To avoid confusion, I don't mean the "Cell" commandbar menu, but the second floating toolbar with formatting buttons. e.g. is it possible to add a Styles dropdown, or have any other text alignment option than centre? Thanks in advance, Charles

    Read the article

  • Can't connect to MS SQL Server database using SSMS

    - by Charles
    I have a database on line with Godaddy (who uses SQL Server 2005). They provide basic management tools, but tell you that for more advanced tools you can connect directly using SSMS. I followed their instructions to ensure my online database will accept remote connections, and can apparently log in using SSMS with success (after giving my hostname and access data). However: Now from in SSMS, when attempting to expand the "Databases" folder tree, I get the following error: Failed to retrieve data for this request. (Microsoft.SqlServer.Management.Sdk.Sfc) An exception occurred while executing a Transact-SQL statement or batch. (Microsoft.SqlServer.ConnectionInfo) The server principal "cmitchell" is not able to access the database "3pointdb" under the current security context. (Microsoft SQL Server, Error: 916) The irony is that 3pointdb isn't my database. It is just another in a long list of databases that show up when I access my Godaddy backend. From SSMS, I selected the default database to be the name of my database, which it did locate on the list when I browsed. Still same error message. It is trying to connect to a database that isn't mine! :( Godaddy support, after a bit of testing, said the problem isn't on their end. it's on mine. – Charles

    Read the article

  • Compile error on action for iPhone app: "error:expected ')' before ';' token"

    - by Jamis Charles
    I'm working through the tutorials in the "Beginning iPhone Development" book. I'm on chapter 4 and I'm getting the following compile error on the "if (segment == kShowSegmentIndex)" line: error:expected ')' before ';' token Here's my code: - (IBAction)toggleShowHide:(id)sender{ UISegmentedControl *segmentedControl = (UISegmentedControl *)sender; NSInteger segment = segmentedControl.selectedSegmentIndex; if (segment == kShowSegmentIndex) [switchView setHidden:NO]; else [switchView setHidden:YES]; } I've compared it with the code in the book several times and have retyped it. Sounds like this error is caused by improper brace placement. Any thoughts?

    Read the article

  • Routing error when trying to use same view for update and create flows (Rails 3)

    - by Jamis Charles
    My overall use case: I have a Listing model that has many images. The Listing detail page lists all the fields that can be updated inline (through ajax). I want to be able to use the same view for both update listing and create new listing. My listing controller looks as follows: def detail @listing = Listing.find(params[:id]) @image = Image.new #should this link somewhere else? respond_to do |format| format.html # show.html.erb format.xml { render :xml => @listing } end end def create # create a new listing and save it immediately. Assign it to guest, with a status of "draft" @listing = Listing.new(:price_id => 1) # Default price id # save it to db # TODO add validation that it has to have a price ID, on record creation. So the view doesn't break. @listing.save @image = Image.new # redirect_to "/listings/detail/@listing.id" #this didn't work respond_to do |format| format.html # show.html.erb format.xml { render :xml => @listing } end end The PROBLEM I'm using a partial that shows the same form for the create view and the detail view. This works perfectly except for one thing: When I pull up http://0.0.0.0:3000/listings/detail/7, it works perfectly. When I pull up http://0.0.0.0:3000/listings/new, I get the following error: Showing /Applications/MAMP/htdocs/rails_testing/feedbackd/app/views/listings/_edit_form.html.erb where line #100 raised: No route matches {:action="show", :controller="images"} Extracted source (around line #100): 97: <!-- Form for new images --> 98: <div class="span-20 append-bottom"> 99: <!-- <%# form_for :image, @image, :url => image_path, :html => { :multipart => true } do |f| %> --> 100: <%= form_for @image, :url => image_path, :html => { :multipart => true } do |f| %> 101: <%= f.text_field :description %><br /> 102: <%= f.file_field :photo %> 103: <%= submit_tag "Upload" %> What I think the issue is: When I upload a new image (I'm using Paperclip), it requires the listing_id to create the image record. Since the listing_id isn't passed in with listings/new it can't find the listing_id. How can I pass in the id? Via a redirect? What's the best way to solve this? Thank you.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • With paperclip, how can I change the image location to a ":parent_model_id/:id" folder format?

    - by Jamis Charles
    Given that I have a Listing model that has many images and each image has one attachment, how can I have the listing_id be part of the folder structure? Like so: system/photos/[listing_id]/:id I know that using :id will output the id of the image record. Here's what I currently have: class Image < ActiveRecord::Base belongs_to :listing #Rails ActiveRecord Relation. An image belongs to a post. # paperclip data has_attached_file :photo, :styles => { :medium => "300x300>", :thumb => "100x100>" }, :url => "/public/system/:class/:attachment/:id/:style_:filename" end

    Read the article

  • Windows 7 Administrator HomeUsers Account

    - by Charles Carrington
    I'm trying to login to my Windows 7 PC from another PC so that I can transfer files to the Windows 7 PC. I've just installed Visual Studio 2008 on my new PC, and I wan't to transfer all of my work from my old machine to my new one. When I first set up a user on the Windows 7 PC after a reformat, the account created had a Group field that read "HomeUsers; Administrators" when viewing it from the User Accounts screen. You get to this screen by typing "netplwiz" in the search field of the Start Menu. I changed the Group of this account to Administrators before I realized that it was assigned to two Groups -- "HomeUsers; Administrators" as I mentioned above. I was trying to make sure that it was an Administrator account so I didn't have to type in a password everytime I wanted to install software. I can use this computer normally without being asked for an administrator password all the time when I want to install new software, but I can't log in to this PC from another PC because I don't have an account that has a Group of "HomeUsers". I should have left the account alone; everything would've been fine. But there doesn't seem to be a way to assign it to two groups after the initial assignment that take place automatically when you are setting up your computer for the first time. If you assign "HomeUsers" to the account, the Group field on the User Accounts screen will just read "HomeUsers". If you assign "Administrators" to the account, the Group field on the User Accounts screen will just read "Administrators". There's no way to make it read "HomeUsers; Administrators" again. If you don't have at least one account that is a "HomeUsers" account, you cannot log in to the PC from another PC on the network. If you don't have an account that is an "Administrators" account, you cannot install software on your machine without being asked for an Administrator password all the time, which is very annoying. I want an account on my Windows 7 PC that I can use to install software without being asked for a password AND that I can log into from another PC on the network to transfer files. If I could make the Group field read "HomeUsers; Administrators" of my primary account on the Windows 7 PC when I go to the User Accounts screen by typing "netplwiz" in the search field of the Start Menu, my primary account would do what I want it to do. Does anybody know how to make an account in Windows 7 a "HomeUsers" account AND an "Administrators" account? As I said before, Windows 7 does this for you automatically when you first set up your computer. But if you change it inadvertently, there is no way to change it back. At least I don't know how to do it. If anybody has any ideas on how to fix this, I would greatly appreciate it. Thanks, Charles Carrington

    Read the article

1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >