Search Results

Search found 699 results on 28 pages for 'latex'.

Page 10/28 | < Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Getting the error "Missing $ inserted" in LaTeX

    - by Espenhh
    Hey, I try to write the following in latex: \begin{itemize} \item \textbf{insert(element|text)} inserts the element or text passed at the start of the selection. \item \textbf{insert_after(element|text)} inserts the element or text passed at the end of the selection. \item \textbf{replace(element|text)} replaces the selection with the passed text/element. \item \textbf{delete()} deletes the selected text. \item \textbf{annotate(name,value)} annotates the selected text with the passed name and value-pair. This can either be a hidden meta-data about the selection, or can alter the visible appearance. \item \textbf{clear_annotation()} removes any annotation for this specific selection. \item \textbf{update_element(value)} performs an update of the element at the selection with the passed value. \end{itemize} For some reason, I get a bunch of errors. I think there is something with the use of the word "insert". I get errors like "Missing $ inserted", so it seems like the parses tries to fix some "errors" on my parts. Do I need to escape words like "insert", how do I do that?

    Read the article

  • What packages do I need to compile .tex documents using XeLaTeX?

    - by maria
    Hi I'm aware of the existence of similar threads on this forum. But any of replies mach to my problem. I'm using Ubuntu 10.4 and I hadn't problems with fonts till I've decided to use XeLaTeX instead of LaTeX (cf http://tex.stackexchange.com/questions/12347/typesetting-a-document-using-arabic-script/12358#12358). The problem is that I'm not able to compile any .tex document using XeLaTeX, as well as properly display XeLaTeX documentation. As I've learn thanks to mentioned thread, XeLaTeX uses the fonts availables in general in the system. I was trying yo read fontspec documentation, but it opens in pdf with a lot of white gaps and terminal output (quite long) consist mostly of errors. This are just few lines of it: Error: Missing language pack for 'Adobe-Japan1' mapping Error: Unknown font tag 'F5.1' Error (24124): No font in show Error: Unknown font tag 'F5.1' I was trying to compile simple XeLaTeX file: \documentclass{article} \usepackage{fontspec} \setmainfont{Linux Libertine O} \begin{document} Hello World! \end{document} without succes. This is terminal output of compilation: This is XeTeX, Version 3.1415926-2.2-0.9995.2 (TeX Live 2009/Debian) restricted \write18 enabled. entering extended mode (./ex.tex LaTeX2e <2009/09/24> Babel <v3.8l> and hyphenation patterns for english, usenglishmax, dumylang, noh yphenation, polish, loaded. (/usr/share/texmf-texlive/tex/latex/base/article.cls Document Class: article 2007/10/19 v1.4h Standard LaTeX document class (/usr/share/texmf-texlive/tex/latex/base/size10.clo)) (/usr/share/texmf-texlive/tex/xelatex/fontspec/fontspec.sty (/usr/share/texmf-texlive/tex/generic/ifxetex/ifxetex.sty) (/usr/share/texmf-texlive/tex/latex/tools/calc.sty) (/usr/share/texmf-texlive/tex/latex/xkeyval/xkeyval.sty (/usr/share/texmf-texlive/tex/generic/xkeyval/xkeyval.tex (/usr/share/texmf-texlive/tex/generic/xkeyval/keyval.tex))) (/usr/share/texmf-texlive/tex/latex/base/fontenc.sty (/usr/share/texmf-texlive/tex/xelatex/euenc/eu1enc.def) (/usr/share/texmf-texlive/tex/xelatex/euenc/eu1lmr.fd)) fontspec.cfg loaded. (/usr/share/texmf-texlive/tex/xelatex/fontspec/fontspec.cfg))kpathsea: Invalid fontname `Linux Libertine O', contains ' ' ! Font \zf@basefont="Linux Libertine O" at 10.0pt not loadable: Metric (TFM) fi le or installed font not found. \zf@fontspec ...ntname \zf@suffix " at \f@size pt \unless \ifzf@icu \zf@set@... l.3 \setmainfont{Linux Libertine O} ? I can't find Linux Libertine O. Searching for otf- by aptitude gives as result: maria@maria-laptop:/etc/fonts$ aptitude search otf p emdebian-rootfs - emdebian root filesystem support p libotf-bin - A Library for handling OpenType Font - utilities p libotf-dev - A Library for handling OpenType Font - development i libotf0 - A Library for handling OpenType Font - runtime p libotf0-dbg - The libotf libraries and debugging symbols p libpam-dotfile - A PAM module which allows users to have more than one password p livecd-rootfs - construction script for the livecd rootfs p makebootfat - Utility to create a bootable FAT filesystem p otf-ipaexfont - Japanese OpenType font, IPAexFont (IPAexGothic/Mincho) p otf-ipaexfont-gothic - Japanese OpenType font, IPAexFont (IPAexGothic) p otf-ipaexfont-mincho - Japanese OpenType font, IPAexFont (IPAexMincho) p otf-ipafont - Japanese OpenType font set, IPAfont p otf-ipafont-gothic - Japanese OpenType font set, IPA Gothic font p otf-ipafont-mincho - Japanese OpenType font set, IPA Mincho font p otf-stix - the Scientific and Technical Information eXchange fonts p otf-thai-tlwg - Thai fonts in OpenType format p otf-yozvox-yozfont - Japanese proportional Handwriting OpenType font p otf2bdf - generate BDF bitmap fonts from OpenType outline fonts p robotfindskitten - Zen Simulation of robot finding kitten So font in question is not just uninstalled, but not available, if I'm not wrong. Does it mean that I lack some repositoires? I was trying also to apply solution from the thread How do I reinstall default fonts?, but the result is: maria@maria-laptop:~$ sudo apt-get install msttcorefonts [sudo] password for maria: Reading package lists... Done Building dependency tree Reading state information... Done Note, selecting ttf-mscorefonts-installer instead of msttcorefonts ttf-mscorefonts-installer is already the newest version. 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. maria@maria-laptop:~$ It seems that is not a usual problem for use of XeLaTeX; nobody in the mentioned thread suggested instalation of anything else than TeX Live. Thanks in advance

    Read the article

  • pdflatex reads .eps files saved in OS/X, but not in Ubuntu

    - by David B Borenstein
    Sorry if this is a stupid question; I'm a newbie. I am preparing a manuscript in LaTeX. The journal (Physical Biology, an IOP publication) requires that figures be saved in .eps format, so I am trying to do that. However, I cannot get my LaTeX file to build when I have generated the .eps files on my Ubuntu computer. If I save the images on my Mac, the file build just fine. So far, I have tried saving images in ImageJ, FIJI and Inkscape. The same problem occurs in all three. When using kile, I get the following error: /usr/share/texmf-texlive/tex/latex/oberdiek/epstopdf-base.sty:0: Shell escape feature is not enabled. In TexWorks, the error is different, but still there: Package pdftex.def Error: File `./figures4/figure4a-eps-converted-to.pdf' not found. Now, if I fire up Inkscape, FIJI or ImageJ on OS/X, everything works fine. The Mac also can't build with the Ubuntu-saved images. The images generated on the Ubuntu machine open fine using Document Viewer. I am building the same LaTeX file on both computers, with the exact same results. The header of my LaTeX file is: \documentclass[12pt]{iopart} \usepackage{graphicx} \usepackage{epstopdf} \usepackage{parskip} \usepackage{color} \usepackage{iopams} And then the code for the figure is: \begin{figure} \center{\includegraphics[width=4in] {./figures4/figure4a.eps}} \footnotesize{\caption{ \label{fig:4a} (4a) lorem ipsum dolor sic amet.}} \end{figure} I'd be happy to send an example of both .eps files. Again, sorry if this is a dumb question. I tried everything I could think of before posting here. Thanks, David

    Read the article

  • ! Extra }, or forgotten \endgroup. latex

    - by gzou
    hey, I met these latex format problem, anyone can offer some help? the .tex file: \begin{table}{} \renewcommand{\arraystretch}{1.1} \caption{Cambridge Flow feature definition and description} \label{cambridge-feature}} \centering \begin{tabular}{|c|c|} \hline\bfseries Abbreviation &\bfseries Description\\ \hline serv-port & Server port\\ \hline clnt-port & Client port\\ \hline push-pkts-serv & count of all packets with\\ & push bit set in TCP header (server to client)\\ \hline init-win-bytes-clnt & the total number of bytes \\ & sent in initial window (client to server)\\ \hline init-win-bytes-serv & the total number of bytes sent\\ & in initial window (server to client)\\ \hline avg-seg-size-clnt & average segment size: \\ & data bytes devided by number of packets\\ \hline IP-bytes-med-clnt & median of total bytes in IP packet\\ \hline act-data-pkt-serv & count of packet with at least one byte \\ & of TCP data playload (server to client)\\ \hline data-bytes-var-clnt & variance of total \\ & bytes in packets (client to server)\\ \hline min-seg-size-serv & minimum segment size \\ & observed (server to client)\\ \hline RTT-samples-serv & total number of RTT samples\\ & found (server to client),\\ & {\bf see also \cite{Moore05discriminators}}\\ \hline push-pkts-clnt & count of all packets with push bit set \\ & in TCP header (server to client)\\ \hline \end{tabular} \end{table} and the error message: ! Extra }, or forgotten \endgroup. \@endfloatbox ...pagefalse \outer@nobreak \egroup \color@endbox l.892 \end{table} I've deleted a group-closing symbol because it seems to be spurious, as in $x}$'. But perhaps the } is legitimate and you forgot something else, as in\hbox{$x}'. In such cases the way to recover is to insert both the forgotten and the deleted material, e.g., by typing `I$}'. there is no $ in my table, also this { are matching with the }, and also after I comment the citation, the error remains. anyone can offer help? really appreciate all the comments! ! Extra }, or forgotten \endgroup.

    Read the article

  • No norwegian characters in LaTeX

    - by DreamCodeR
    Hi, I have translated a document from English to Norwegian in the LaTeX format, and while using norwegian special characters, I get an error using \usepackage[utf8x]{inputenc} to try and display the norwegian (scandinavian) special characters in PostScript/PDF/DVI format, saying Package utf8x Error: MalformedUTF-8sequence. So while that didn't work, I tried out another possible solution: \usepackage{ucs} \usepackage[norsk]babel And when I tried to save that in Emacs I get this message: These default coding systems were tried to encode text in the buffer `lol.tex': (utf-8-unix (905 . 4194277) (916 . 4194245) (945 . 4194278) (950 . 4194277) (954 . 4194296) (990 . 4194277) (1010 . 4194277) (1013 . 4194278) (1051 . 4194277) (1078 . 4194296) (1105 . 4194296)) However, each of them encountered characters it couldn't encode: utf-8-unix cannot encode these: \345 \305 \346 \345 \370 \345 \345 \346 \345 \370 ... Thanks to Emacs I have the possibility to check out the properties of those characters and the first one tells me: character: \345 (4194277, #o17777745, #x3fffe5) preferred charset: eight-bit (Raw bytes 128-255) code point: 0xE5 syntax: w which means: word buffer code: #xE5 file code: not encodable by coding system utf-8-unix display: not encodable for terminal Which doesn't tell me much. When I try to build this with texi2dvi --dvipdf filename.text I get a perfectly fine PDF, all without the special norwegian characters. When I am about to save Emacs also ask me: "Select coding system (default raw-text):" And I type in utf-8 to choose its coding system. I have also tried to choose default raw-text to see if I get some different result. But nothing. At last I tried \lstset{inputencoding=utf8x, extendedchars=\true} ... a code I came over while trying to google the solution to this problem. Which gives me this error: Undefined control sequence. So basically, I have tried every encoding option I have been able to find and nothing works. I am desperately trying to make this work since the norwegian translation must be published before the deadline. As an additional information I may add that I found out later on that I only had the en_US.UTF-8 in my locale, so I added nb_NO.UTF-8 and nb_NO.ISO-8859-15 and ran locale-gen + reboot without any changes. I hope I provided enough information to get some assistance, the characters in question is æ ø å.

    Read the article

  • How to Remove Header in LaTex

    - by Tim
    Hi, I would like to not show the name of each chapter on the header of its each page. I also like to have nothing in the headers for abstract, acknowledgement, table of content, list of figures and list of tables. But currently I have header on each page, for example: Here is my code when specifying these parts in my tex file \begin{abstract} ... \end{abstract} \begin{acknowledgement} ... \end{acknowledgement} % generate table of contents \tableofcontents % generate list of tables \listoftables % generate list of figures \listoffigures \chapter{Introduction} \label{chp1} %% REFERENCES \appendix \input{appendiximages.tex} \bibliographystyle{plain} %%\bibliographystyle{abbrvnat} \bibliography{thesis} Here is what I believe to be the definition of the commands. More details can be found in these two files jhu12.clo and thesis.cls. % \chapter: \def\chaptername{Chapter} % ABSTRACT % MODIFIED to include section name in headers \def\abstract{ \newpage \dsp \chapter*{\abstractname\@mkboth{\uppercase{\abstractname}}{\uppercase{\abstractname}}} \fmfont \vspace{8pt} \addcontentsline{toc}{chapter}{\abstractname} } \def\endabstract{\par\vfil\null} % DEDICATION % Modified to make dedication its own section %\newenvironment{dedication} %{\begin{alwayssingle}} %{\end{alwayssingle}} \def\dedication{ \newpage \dsp \chapter*{Dedication\@mkboth{DEDICATION}{DEDICATION}} \fmfont} \def\endacknowledgement{\par\vfil\null} % ACKNOWLEDGEMENTS % MODIFIED to include section name in headers \def\acknowledgement{ \newpage \dsp \chapter*{\acknowledgename\@mkboth{\uppercase{\acknowledgename}}{\uppercase{\acknowledgename}}} \fmfont \addcontentsline{toc}{chapter}{\acknowledgename} } \def\endacknowledgement{\par\vfil\null} \def\thechapter {\arabic{chapter}} % \@chapapp is initially defined to be '\chaptername'. The \appendix % command redefines it to be '\appendixname'. % \def\@chapapp{\chaptername} \def\chapter{ \clearpage \thispagestyle{plain} \if@twocolumn % IF two-column style \onecolumn % THEN \onecolumn \@tempswatrue % @tempswa := true \else \@tempswafalse % ELSE @tempswa := false \fi \dsp % double spacing \secdef\@chapter\@schapter} % TABLEOFCONTENTS % In ucthesis style, \tableofcontents, \listoffigures, etc. are always % set in single-column style. @restonecol \def\tableofcontents{\@restonecolfalse \if@twocolumn\@restonecoltrue\onecolumn\fi %%%%% take care of getting page number in right spot %%%%% \clearpage % starts new page \thispagestyle{botcenter} % Page style of frontmatter is botcenter \global\@topnum\z@ % Prevents figures from going at top of page %%%%% \@schapter{\contentsname \@mkboth{\uppercase{\contentsname}}{\uppercase{\contentsname}}}% {\ssp\@starttoc{toc}}\if@restonecol\twocolumn\fi} \def\l@part#1#2{\addpenalty{-\@highpenalty}% \addvspace{2.25em plus\p@}% space above part line \begingroup \@tempdima 3em % width of box holding part number, used by \parindent \z@ \rightskip \@pnumwidth %% \numberline \parfillskip -\@pnumwidth {\large \bfseries % set line in \large boldface \leavevmode % TeX command to enter horizontal mode. #1\hfil \hbox to\@pnumwidth{\hss #2}}\par \nobreak % Never break after part entry \global\@nobreaktrue %% Added 24 May 89 as \everypar{\global\@nobreakfalse\everypar{}}%% suggested by %% Jerry Leichter \endgroup} % LIST OF FIGURES % % Single-space list of figures, add it to the table of contents. \def\listoffigures{\@restonecolfalse \if@twocolumn\@restonecoltrue\onecolumn\fi %%%%% take care of getting page number in right spot %%%%% \clearpage \thispagestyle{botcenter} % Page style of frontmatter is botcenter \global\@topnum\z@ % Prevents figures from going at top of page. \@schapter{\listfigurename\@mkboth{\uppercase{\listfigurename}}% {\uppercase{\listfigurename}}} \addcontentsline{toc}{chapter}{\listfigurename} {\ssp\@starttoc{lof}}\if@restonecol\twocolumn\fi} \def\l@figure{\@dottedtocline{1}{1.5em}{2.3em}} % bibliography \def\thebibliography#1{\chapter*{\bibname\@mkboth {\uppercase{\bibname}}{\uppercase{\bibname}}} \addcontentsline{toc}{chapter}{\bibname} \list{\@biblabel{\arabic{enumiv}}}{\settowidth\labelwidth{\@biblabel{#1}}% \leftmargin\labelwidth \advance\leftmargin\labelsep \usecounter{enumiv}% \let\p@enumiv\@empty \def\theenumiv{\arabic{enumiv}}}% \def\newblock{\hskip .11em plus.33em minus.07em}% \sloppy\clubpenalty4000\widowpenalty4000 \sfcode`\.=\@m} Thanks and regards! EDIT: I just replaced \thispagestyle{botcenter} with \thispagestyle{plain}. The latter is said to clear the header (http://en.wikibooks.org/wiki/LaTeX/Page_Layout), but it does not. How shall I do? Thanks!

    Read the article

  • Typing math formulas in LaTex and getting them in MathType format?

    - by Tim
    I am asked to type some math formulas that can work in Microsoft Office and MathType equation editor. But I only have access to Ubuntu 12.04 near me, there is LibreOffice available under Ubuntu as well, but I am used to type math formulas in LaTex. So I wonder how to provide math formulas that will work in Microsoft Office and MathType, if I work under Ubuntu, preferably with LaTex but LibreOffice being also acceptable since it is still under Ubuntu? Thanks and regards!

    Read the article

  • Problem with adding Appendix in Latex

    - by Andrew
    Hi all, I tried the first time to add an appendix to my thesis, here are the commands that I used. \appendix \chapter{Appendices} \input{appendix} The output looks than as follows: Appendix A Appendices A.1 My first appendix ..... It does not look to bad, but what is irritating is the Appendices entry after Appendix A. Is there any possibilty I could get rid of it? If I try the following commands: \appendix \input{appendix} The output looks than as follows: .1 My first appendix ... Also not how it is intended. Ideally, it would look like this here: Appendix A A.1 My first appendix ..... Any idea how to do that? Andrew

    Read the article

  • fresh installation of PGF/TikZ crashes, why?

    - by Vincenzo
    I have a clean CentOS 5.5 machine with tetex installed. Next, I installed PGF/TikZ: wget http://media.texample.net/pgf/builds/pgfCVS2010-06-02_TDS.zip unzip pgfCVS2010-06-02_TDS.zip \cp -r tex /usr/share/texmf texhash I'm trying to compile a simple document and this is what I'm getting: $ latex test.tex This is pdfeTeX, Version 3.141592-1.21a-2.2 (Web2C 7.5.4) entering extended mode (./test.tex LaTeX2e <2003/12/01> .. skipped .. (/usr/share/texmf/tex/latex/pgf/frontendlayer/tikz.sty (/usr/share/texmf/tex/latex/pgf/pgf.sty (/usr/share/texmf/tex/latex/graphics/graphicx.sty (/usr/share/texmf/tex/latex/graphics/graphics.sty (/usr/share/texmf/tex/latex/graphics/trig.sty) (/usr/share/texmf/tex/latex/graphics/graphics.cfg)))) (/usr/share/texmf/tex/latex/pgf/utilities/pgffor.sty (/usr/share/texmf/tex/latex/pgf/utilities/pgfrcs.sty (/usr/share/texmf/tex/generic/pgf/utilities/pgfutil-common.tex) (/usr/share/texmf/tex/generic/pgf/utilities/pgfutil-latex.def) (/usr/share/texmf/tex/generic/pgf/utilities/pgfrcs.code.tex)) (/usr/share/texmf/tex/latex/pgf/utilities/pgfkeys.sty (/usr/share/texmf/tex/generic/pgf/utilities/pgfkeys.code.tex (/usr/share/texmf/tex/generic/pgf/utilities/pgfkeysfiltered.code.tex))) (/usr/share/texmf/tex/generic/pgf/utilities/pgffor.code.tex)) (/usr/share/texmf/tex/generic/pgf/frontendlayer/tikz/tikz.code.tex (/usr/share/texmf/tex/generic/pgf/libraries/pgflibraryplothandlers.code.tex ! Undefined control sequence. \pgfsetplottension ...ttension {\pgf@sys@tonumber \pgf@x } l.104 \pgfsetplottension{0.5} ? I failed to find any clues in the net about this problem. On other servers I don't such a problem. Could anyone help please? Thanks! ps. Btw, I tried another build of PGF/TikZ, the older one, no luck :(

    Read the article

  • Latex Inverse search from a pdf in Okular to TexMaker

    - by Kayton
    I am using TexMaker of Karmic Ubuntu with Okular. I use pdfLatex to compile and I view the PDFs in Okular. How can I configure Okular to inverse search with TexMaker? I have tried the following code: texmaker %f -line %l but it does not work. I have tried double clicking, ctrl+click, shift+click, ctrl+shift+click, ctrl+alt+click, alt+shift+click, still nothing. Perhaps I simply don't know what the action is to initiate the inverse search from within Okular. How can I configure Okular to inverse search with TexMaker?

    Read the article

  • lscape and supertabular in Latex

    - by Tim
    Hi, I would like to put pictures into a supertabular table within lscape enviroment. The code is: \newcounter{themenumber} \newcounter{classnumber} \newcounter{imagenumber} \tablefirsthead{ \hline \backslashbox{Concept}{Class} &\multicolumn{3}{|c|}{Class 0} & \multicolumn{3}{|c|}{Class 1} \\ %\textbf{A} & \textbf{B}\\ \hline} \tablehead{ \hline \multicolumn{7}{|l|}{\small\sl continued from previous page}\\ \hline \backslashbox{Concept}{Class} &\multicolumn{3}{|c|}{Class 0} & \multicolumn{3}{|c|}{Class 1} \\ %\textbf{A} & \textbf{B}\\ \hline} \tabletail{ %\hline \multicolumn{7}{|l|}{\small\sl continued on next page}\\ \hline} \tablelasttail{} %\tablelasttail{\hline} \begin{landscape} \begin{supertabular}{| c || c | c | c || c | c | c |} \topcaption{Examples of All the Concepts. \label{tab:conceptsimgs}} \forloop{themenumber}{1}{\value{themenumber} < 24}{ \arabic{themenumber} \forloop{classnumber}{0}{\value{classnumber} < 2}{ \forloop{imagenumber}{1}{\value{imagenumber} < 4}{ & \includegraphics[scale=0.5]{../\arabic{themenumber}/\arabic{classnumber}_\arabic{imagenumber}.eps} } } \\ \hline } \end{supertabular} \end{landscape} However there is something wrong with the result: no caption is shown, the height of the part of table in each page exceeds the page height and there is something extra unwanted at the last page. See images below: page1 page2 page3 page4 How to fix the problems? Thanks and regards!

    Read the article

  • Latex newenvironment

    - by Alex
    There's something wrong with this code: \newenvironment{Tbl} {\begin{tabularx}{\textwidth}{|l|X|} \hline} {\end{tabularx}} but this is fine: \newenvironment{Tbl} {\begin{tabular}{|l|l|} \hline} {\end{tabular}} Why? And how can I get the first to work?

    Read the article

  • latex tabular vertical alignment to top?

    - by shoosh
    I'm trying to create a simple tabular with two cells of text and two images below them like so: \begin{tabular}[h]{ c | c} \emph{Normal} & \emph{Cone} \\ \includegraphics[width=0.39\textwidth]{images/pipe1} & \includegraphics[width=0.61\textwidth]{images/pipe2} \end{tabular} The first image is shorter than the second and I want it to be aligned at the top of the cell but for some reason it gets aligned to the bottom of the cell instead. I've tried using the array package and do this: \begin{tabular}[h]{ p{0.39\textwidth} | p{0.61\textwidth} } \emph{Normal} & \emph{Cone} \\ \includegraphics[width=0.39\textwidth]{images/pipe1} & \includegraphics[width=0.61\textwidth]{images/pipe2} \end{tabular} But this doesn't change anything. The first image is still aligned to the bottom. Why is that? Could there be something else going on which forces the alignment to stick to the bottom?

    Read the article

  • Latex: Listings with monospace fonts

    - by Nils
    This is what the code looks in Xcode. And this in my listing created with texlive. And yes I used basicstyle=\ttfamily . Having looked at the manual of listings I haven't found anything about fixed-with or monospace fonts.. Example to reproduce \documentclass[ article, a4paper, a4wide, %draft, smallheadings ]{book} % Packages below \usepackage{graphicx} \usepackage{verbatim} % used to display code \usepackage{hyperref} \usepackage{fullpage} \usepackage[ansinew]{inputenc} % german umlauts \usepackage[usenames,dvipsnames]{color} \usepackage{float} \usepackage{subfig} \usepackage{tikz} \usetikzlibrary{calc,through,backgrounds} \usepackage{fancyvrb} \usepackage{acronym} \usepackage{amsthm} % Uuhhh yet another package \VerbatimFootnotes % Required, otherwise verbatim does not work in footnotes! \usepackage{listings} \definecolor{Brown}{cmyk}{0,0.81,1,0.60} \definecolor{OliveGreen}{cmyk}{0.64,0,0.95,0.40} \definecolor{CadetBlue}{cmyk}{0.62,0.57,0.23,0} \definecolor{lightlightgray}{gray}{0.9} \begin{document} \lstset{ language=C, % Code langugage basicstyle=\ttfamily, % Code font, Examples: \footnotesize, \ttfamily keywordstyle=\color{OliveGreen}, % Keywords font ('*' = uppercase) commentstyle=\color{gray}, % Comments font numbers=left, % Line nums position numberstyle=\tiny, % Line-numbers fonts stepnumber=1, % Step between two line-numbers numbersep=5pt, % How far are line-numbers from code backgroundcolor=\color{lightlightgray}, % Choose background color frame=none, % A frame around the code tabsize=2, % Default tab size captionpos=b, % Caption-position = bottom breaklines=true, % Automatic line breaking? breakatwhitespace=false, % Automatic breaks only at whitespace? showspaces=false, % Dont make spaces visible showtabs=false, % Dont make tabls visible columns=flexible, % Column format morekeywords={__global__, __device__}, % CUDA specific keywords } \begin{lstlisting} As[threadRow][threadCol] = A[ threadCol + threadRow * Awidth // Adress of the thread in the current block + i * BLOCK_SIZE // Pick a block further left for i+1 + blockRow * BLOCK_SIZE * Awidth // for blockRow +1 go one blockRow down ]; \end{lstlisting} \end{document}

    Read the article

  • Showing labels in BibTex [LaTeX]

    - by Shahin
    Hi, I'm currently using the apalike style for my bibliography, using natbib for author-year, however when I generate the bibliography I lose the labels that normally precede the reference, i.e. [S. Rostami, 2010] Shahin Rostami (2010) http://stackoverflow.com/questions/ask etc etc.. I read apalike.bst and it seems this is intended, my quesiton is, how do I get them back? Something I can include in the preamble? Otherwise is there a similar style that shows labels?

    Read the article

  • Latex \hline spacing

    - by vigilant
    How do you add spacing after an \hline in a tabular? I can add spacing before it using \vspace, however if I try to add spacing after the \hline, the spacing will come after the next line of text. Here is what I have so far: \multicolumn{2}{Hello!} \vspace{4pt} \\ \hline \textit{Hi!} & \textit{Ho!} I don't want to add a line break after the \hline and do something like \vspace{-xxpt} or use \rule because the generated HTML document from Hevea will be ugly.

    Read the article

  • latex large division sign in a math formula

    - by Anna
    Hi, I have been looking for an answer for some time now, hope you could give me a quick tip. I have an equation with many divisions inside. i.e: $\frac{\frac{a_1}{a_2}} {\frac{b_1}{b_2}}$ To make it more readable, I decided to change the large fraction into "/" sign. i.e. $\frac{a_1}{a_2} / \frac{b_1}{b_2}$ The problem is that the "/" sign remains small, and it is quite ugly. How do I change the "/" sign to have a big font? How do I make it more readable? Thanks.

    Read the article

  • Need hekp with font in latex

    - by laspal
    Hi, Mine tex file looks like \documentclass[a4paper,twoside]{article}` \usepackage{graphics} \usepackage{color} \usepackage{hyperref} \usepackage{multirow} \usepackage{longtable} \usepackage{fullpage} \usepackage[pdftex]{graphicx} \usepackage{fancyhdr} \oddsidemargin 0cm \evensidemargin 0cm \pagestyle{fancy} \renewcommand{\headrulewidth}{0.0pt} \rfoot{Raval, Ketan R -13223} \textwidth 15.5cm \topmargin -1cm \parindent 0cm \textheight 26.5cm \parskip 1mm \begin{document} \fontencoding{\encodingdefault} \renewcommand{\familydefault}{\sfdefault} \fontshape{\shapedefault} \selectfont So how can I improve my overall look and feel of the pdf. Right now all fonts are coming too dim. Is there any thing I can do to try out differnt look and feel of the pdfs. Thanks

    Read the article

  • noweb dpp filter and latex not printing curly braces

    - by Dervin Thunk
    Hello. Well, this smells like a tumbleweed, but I will ask it anyway. Suppose you have a noweb file with some c# code. You also have the c++ pretty-print filter dpp. If you run the command noweave -filter ./dpp -x test.nw > csharp.tex on the file below, it will print everything except for the curly braces. Instead of them, I get an em-dash and a closing quotations marks (i.e. ?) in the dvi. The tex source looks fine... Any ideas? @ C\# test file <<test.c>>= while( (a[right] >= pivot) && (left < right) ) { right--; }

    Read the article

  • Changing the colour of \textbullet in LaTeX Beamer

    - by Seamus
    I don't want to use Beamer's standard blue colour theme. I want to use beaver, which is deep reds. Everything looks nice, except that if I use itemize the bullet points are still blue. Is there a nice way to have the bullets vary with what colour theme I was using? (If I were to opt for a yellowish colour theme, I'd expect the bullets to go yellow too.) If there isn't, what is the brute force way to change the bullet points red? Or at the very least, make them go back to black again.

    Read the article

  • How do I make multi-page landscape tables in LaTeX

    - by Tim
    The title is pretty much the extent of my question. I am trying to insert a large table into a document using the xtabular environment. If I wrap the xtabular environment in a landscape environment, then the bottom of my table gets chopped off. Does anyone have any better suggestions? Thanks \begin{landscape} \singlespace \begin{xtabular}{|c|c|c|c|c|} \hline some & stuff & ... & \\ \end{xtabular} \end{landscape} Tim

    Read the article

  • LaTeX hyperref link goes to wrong page

    - by ecto
    I am trying to create a reference to a float that doesn't use a caption. If I include \label{foo} within the float and reference it using \pageref{foo}, the correct page number is displayed in my pdf document but the hyperlink created by the hyperref package links to a different page (the first page of the section). If I include a caption before the label in the float, the hyperref link goes to the correct page. Is there a way to get the hyperref link to work correctly without including a caption in the float? Or else is there a way to suppress the display of a caption so I can include one without it being shown? Below is a minimal example. If I process it using pdflatex, I get three pages. The "figure" is shown on the second page, and the third page says "See figure on page 2." But the hyperlink on the '2' says "Go to page 1", and if I click it it takes me to page 1. If I put an empty \caption{} before the \label{foo}, then the hyperlink works correctly, but I don't want to show a caption for my float. \documentclass[11pt]{memoir} \usepackage{hyperref} \begin{document} some text \clearpage \begin{figure} a figure \label{foo} \end{figure} more text \clearpage See figure on page \pageref{foo}. \end{document}

    Read the article

< Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >