Search Results

Search found 25886 results on 1036 pages for 'color key'.

Page 102/1036 | < Previous Page | 98 99 100 101 102 103 104 105 106 107 108 109  | Next Page >

  • GetDeviceGammaRamp to adjust colors

    - by peter
    Hi, I overlay an OpenGL application (c++), this openGL application uses SetDeviceGammaRamp to set the brightness of the desktop to very high (dont know why). This application is fullscreen and looks good, but my overlay is very bright. Instead of the orange color with normal brightness, I get yellow because of the high gamma. What I want to do: Get the gamma that is currently set (using GetDeviceGammaRamp), and then use this to adjust the colors I set. Like; glColor4f(r, g, b, a) becomes glColor4f(r / gamma, g / gamma, b / gamma, a); So if the brightness of the desktop is very high, the r g and b values will be lower (darker) and will look like they should. How can I accomplish this? GetDeviceGammaRamp fills a table, how can I use it to modify my colors? Thanks

    Read the article

  • How to color HTML elements based on a user command string

    - by Anonymous the Great
    When you type something like "red:Hi:" it will type "Hi" in red. The following script does not work and I do not know why, (The one who made the sorting PHP function is Graphain, thanks again!) <?php function getit($raw) { # If the value was posted $raw = isset($raw) ? $raw : ""; # Split it based on ':' $parsed = explode(':', $raw); $colorClass = ""; $text = ""; if (count($parsed) >= 2) { $colorClass = $parsed[0]; $text = $parsed[1]; $text = "~~~" . $text . "~~~" . $colorClass; return $text; } } ?> <script type="text/javascript"> function postit() { var preview = document.getElementById("preview").value; var submit = document.getElementById("post").value; var text = <?php getit(submit); ?> var t = text[0]; preview = t; } </script> <textarea id="preview" cols=70 rows=5 readonly>Preview box</textarea> <p> <textarea id="post" cols=70 rows=5/>Submit box</textarea> <p> <input type="button" onclick="postit();" value="Submit"/>

    Read the article

  • jQuery AJAX Loading Page Content Only After I Press Shift Key

    - by Cosmin
    My ajax + jquery loading page only after holding shift key and duplicate new empty window. If I press the loading button nothing hapen, only after I press shift key I get to load the page correctly... this is my ajax script: $(document).ready(function () { $(".getUsersA").click(function () { $.ajax({ beforeSend: function () { $(".gridD").html(spinner) }, url: 'lib/some_url.php', type: 'POST', data: ({ data1:'2013-09-01' }), success: function (results) {$(".gridD").html(results);} }); }); }); I have a second js file with just this line of code for spinner var spinner = "<img src='images/spinner.gif' border='0'>"; html code: <html> <head> <title>Title</title> <script type="text/javascript" src="js/jquery-1.10.2.js"></script> <script type="text/javascript" src="js/ajax.js"></script> <script type="text/javascript" src="js/general.js"></script> </head> <body> <h1>Putting it all tugether ... with jQuery</h1> <div class="thedivD"><a href="" class="buttonA getUsersA">Get Users</a></div> <h3>jQuery results</h3> <div class="gridD"></div> </body> </html>

    Read the article

  • Dynamically changing background color of a UIView

    - by EricM
    Hello- Here's my setup. I have a viewcontroller that I'm creating and adding as a subview. The viewcontroller presents some options that a user can chose from. The viewcontroller is being pushed in response to a "long press" gesture. Within the viewcontroller, I added a child UIView to group some other controls together so I can move them around the screen as a unit and, when they are displayed, center them on the location of the long press. Here is the code that instantiates the view controller, changes its location, and adds it as a subview: UserOptions *opts = [[UserOptions alloc] initWithNibName:@"UserOptions" bundle:nil]; [opts recenterOptions:location]; [self.view addSubview:opts.view]; That bit of code does create and push the viewcontroller, but the call to recenterOptions doesn't do anything. Here is that method: - (void) recenterOptions:(CGPoint)location { CGRect oldFrame = self.optionsView.frame; CGFloat newX = location.x; // + oldFrame.size.width / 2.0; CGFloat newY = location.y; // + oldFrame.size.height / 2.0; CGRect newFrame = CGRectMake(newX, newY, oldFrame.size.width, oldFrame.size.height); self.optionsView.frame = newFrame; } Note that self.optionsView is the child UIView that I added to the viewcontroller's nib. Does anyone know why I'm unable to change the location of the UIView? Regards, Eric

    Read the article

  • Evaluation of jQuery function variable value during definition of that function

    - by thesnail
    I have a large number of rows in a table within which I wish to attach a unique colorpicker (jQuery plugin) to each cell in a particular column identified by unique ids. Given this, I want to automate the generation of instances of the colorpicker as follows: var myrows={"a","b","c",.....} var mycolours={"ffffff","fcdfcd","123123"...} for (var i=0;i<myrows.length;i++) { $("#"+myrows[i]+"colour").ColorPicker({flat: false, color: mycolours[i], onChange: function (hsb, hex, rgb) { $("#"+myrows[i]+"currentcolour").css('backgroundColor', '#' + hex); } }); Now this doesn't work because the evaluation of the $("#"+myrows[i]+"currentcolour") component occurs at the time the function is called, not when it is defined (which is want I need). Given that this plugin javascript appends its code to the level and not to the underlying DOM component that I am accessing above so can't derive what id this pertains to, how can I evaluate the variable during function declaration/definition? Thanks for any help/insight anyone can give. Brian.

    Read the article

  • implementing cryptographic algorithms, specifically the key expansion part

    - by masseyc
    Hey, recently I picked up a copy of Applied Cryptography by Bruce Schneier and it's been a good read. I now understand how several algorithms outlined in the book work, and I'd like to start implementing a few of them in C. One thing that many of the algorithms have in common is dividing an x-bit key, into several smaller y-bit keys. For example, blowfish's key, X, is 64-bits, but you are required to break it up into two 32-bit halves; Xl and Xr. This is where I'm getting stuck. I'm fairly decent with C, but I'm not the strongest when it comes to bitwise operators and the like. After some help on IRC, I managed to come up with these two macros: #define splitup(a, b, c) {b = a >> 32; c = a & 0xffffffff; } #define combine(a, b, c) {a = (c << 32) | a;} Where a is 64 bits and b and c are 32 bits. However, the compiler warns me about the fact that I'm shifting a 32 bit variable by 32 bits. My questions are these: what's bad about shifting a 32-bit variable 32 bits? I'm guessing it's undefined, but these macros do seem to be working. Also, would you suggest I go about this another way? As I said, I'm fairly familiar with C, but bitwise operators and the like still give me a headache.

    Read the article

  • How to test if a doctrine records has any relations that are used

    - by murze
    Hi, I'm using a doctrine table that has several optional relations (of types Doctrine_Relation_Association and Doctrine_Relation_ForeignKey) with other tables. How can I test if a record from that table has connections with records from the related table. Here is an example to make my question more clear. Assume that you have a User and a user has a many to many relation with Usergroups and a User can have one Userrole How can I test if a give user is part of any Usergroups or has a role. The solution starts I believe with $relations = Doctrine_Core::getTable('User')->getRelations(); $user = Doctrine_Core::getTable('User')->findOne(1); foreach($relations as $relation) { //here should go a test if the user has a related record for this relation if ($relation instanceof Doctrine_Relation_Association) { //here the related table probably has more then one foreign key (ex. user_id and group_id) } if ($relation instanceof Doctrine_Relation_ForeignKey) { //here the related table probably has the primary key of this table (id) as a foreign key (user_id) } } //true or false echo $result I'm looking for a general solution that will work no matter how many relations there are between user and other tables. Thanks!

    Read the article

  • Imagick: gifs, and background color

    - by TheButch3r
    Hi, I have 2 questions about using the php imagick class that I can't get working properly... 1.) I tried resizing / cropping a gif, and treated it as a normal image. It seemed to work, except that a few frames in the middle of the animation contained a small patch of artifacts. Is there a setting that should be used when working with multi-frame gifs? 2.) Is there a simple command to resize images if they are too small by just adding a background? For instance, if an image is 10x10, could I add a white background, and have a 100x100px image with the original in the upper left corner? Thanks for any help!

    Read the article

  • NHibernate query against the key field of a dictionary (map)

    - by Carl Raymond
    I have an object model where a Calendar object has an IDictionary<MembershipUser, Perms> called UserPermissions, where MembershipUser is an object, and Perms is a simple enumeration. This is in the mapping file for Calendar as <map name="UserPermissions" table="CalendarUserPermissions" lazy="true" cascade="all"> <key column="CalendarID"/> <index-many-to-many class="MembershipUser" column="UserGUID" /> <element column="Permissions" type="CalendarPermission" not-null="true" /> </map> Now I want to execute a query to find all calendars for which a given user has some permission defined. The permission is irrelevant; I just want a list of the calendars where a given user is present as a key in the UserPermissions dictionary. I have the username property, not a MembershipUser object. How do I build that using QBC (or HQL)? Here's what I've tried: ISession session = SessionManager.CurrentSession; ICriteria calCrit = session.CreateCriteria<Calendar>(); ICriteria userCrit = calCrit.CreateCriteria("UserPermissions.indices"); userCrit.Add(Expression.Eq("Username", username)); return calCrit.List<Calendar>(); This constructed invalid SQL -- the WHERE clause contained WHERE membership1_.Username = @p0 as expected, but the FROM clause didn't include the MemberhipUsers table. Also, I really had to struggle to learn about the .indices notation. I found it by digging through the NHibernate source code, and saw that there's also .elements and some other dotted notations. Where's a reference to the allowed syntax of an association path? I feel like what's above is very close, and just missing something simple.

    Read the article

  • "Special case" records for foreign key constraints

    - by keithjgrant
    Let's say I have a mysql table, called foo with a foreign key option_id constrained to the option table. When I create a foo record, the user may or may not have selected an option, and 'no option' is a viable selection. What is the best way to differentiate between 'null' (i.e. the user hasn't made a selection yet) and 'no option' (i.e. the user selected 'no option')? Right now, my plan is to insert a special record into the option table. Let's say that winds up with an id of 227 (this table already has a number of records at this point, so '1' isn't available). I have no need to access this record at a database level, and it would act as nothing more than a placeholder that the foreign key in the foo table can reference. So do I just hard-code '227' in my codebase when I'm creating 'foo' records where the user has selected 'no option'? The hard-coded id seems sloppy, and leaves room for error as the code is maintained down the road, but I'm not really sure of another approach.

    Read the article

  • Going "behind Hibernate's back" to update foreign key values without an associated entity

    - by Alex Cruise
    Updated: I wound up "solving" the problem by doing the opposite! I now have the entity reference field set as read-only (insertable=false updatable=false), and the foreign key field read-write. This means I need to take special care when saving new entities, but on querying, the entity properties get resolved for me. I have a bidirectional one-to-many association in my domain model, where I'm using JPA annotations and Hibernate as the persistence provider. It's pretty much your bog-standard parent/child configuration, with one difference being that I want to expose the parent's foreign key as a separate property of the child alongside the reference to a parent instance, like so: @Entity public class Child { @Id @GeneratedValue Long id; @Column(name="parent_id", insertable=false, updatable=false) private Long parentId; @ManyToOne(cascade=CascadeType.ALL) @JoinColumn(name="parent_id") private Parent parent; private long timestamp; } @Entity public class Parent { @Id @GeneratedValue Long id; @OrderBy("timestamp") @OneToMany(mappedBy="parent", cascade=CascadeType.ALL, fetch=FetchType.LAZY) private List<Child> children; } This works just fine most of the time, but there are many (legacy) cases when I'd like to put an invalid value in the parent_id column without having to create a bogus Parent first. Unfortunately, Hibernate won't save values assigned to the parentId field due to insertable=false, updatable=false, which it requires when the same column is mapped to multiple properties. Is there any nice way to "go behind Hibernate's back" and sneak values into that field without having to drop down to JDBC or implement an interceptor? Thanks!

    Read the article

  • Convert image color space and output separate channels in OpenCV

    - by Victor May
    I'm trying to reduce the runtime of a routine that converts an RGB image to a YCbCr image. My code looks like this: cv::Mat input(BGR->m_height, BGR->m_width, CV_8UC3, BGR->m_imageData); cv::Mat output(BGR->m_height, BGR->m_width, CV_8UC3); cv::cvtColor(input, output, CV_BGR2YCrCb); cv::Mat outputArr[3]; outputArr[0] = cv::Mat(BGR->m_height, BGR->m_width, CV_8UC1, Y->m_imageData); outputArr[1] = cv::Mat(BGR->m_height, BGR->m_width, CV_8UC1, Cr->m_imageData); outputArr[2] = cv::Mat(BGR->m_height, BGR->m_width, CV_8UC1, Cb->m_imageData); split(output,outputArr); But, this code is slow because there is a redundant split operation which copies the interleaved RGB image into the separate channel images. Is there a way to make the cvtColor function create an output that is already split into channel images? I tried to use constructors of the _OutputArray class that accepts a vector or array of matrices as an input, but it didn't work.

    Read the article

  • Reverse alphabetic sort multidimensional PHP array maintain key

    - by useyourillusiontoo
    I'm dying here, any help would be great. I've got an array that I can sort a-z on the value of a specific key but cannot sort in reverse z-a. sample of my array which i'd like to sort by ProjectName (z-a): Array ( [0] => Array ( [count] => 1 [ProjectName] => bbcjob [Postcode] => 53.471922,-2.2996078 [Sector] => Public ) [1] => Array ( [count] => 1 [ProjectName] => commercial enterprise zone [Postcode] => 53.3742081,-1.4926439 [Sector] => Public ) [2] => Array ( [count] => 1 [ProjectName] => Monkeys eat chips [Postcode] => 51.5141492,-0.2271227 [Sector] => Private the desired results would be to maintain the entire array key - value structure but with the order: Monkeys eat chips Commericial enterprise zone bbcjob I hope this makes sense

    Read the article

  • How to load an RSA key from binary data to an RSA structure using the OpenSSL C Library?

    - by Andreas Bonini
    Currently I have my private key saved in a file, private.key, and I use the following function to load it: RSA *r = PEM_read_RSAPrivateKey("private.key", NULL, NULL, NULL); This works perfectly but I'm not happy with the file-based format; I want to save my key in pure binary form (ie, no base64 or similar) in a char* variable and load/save the key from/to it. This way I have much more freedom: I'll be able to store the key directly into the application const char key[] { 0x01, 0x02, ... };, send it over a network socket, etc. Unfortunately though I haven't found a way to do that. The only way to save and load a key I know of reads/saves it to a file directly.

    Read the article

  • change color of red box on tri-state checkbox

    - by Adam S
    Hi all. I'm trying to get the green box that appears on the second click of a tri-state checkbox to be red, and also to fill up the box. I found an article here that demonstrates a little bit about using templates to do this: http://social.msdn.microsoft.com/Forums/en-US/wpf/thread/98cf8a65-f4ca-4ff5-9851-c2989b91a013 However, I can't figure out how to interpret all that. I only understand a few of the things in that template and don't know how to get my red box. Can anyone help, and also tell me how you knew what to do?

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • Background color of the main content on the html page disappears

    - by Denis
    It just makes me go mad. I can't realize what the problem is. Please have a look at the pixeli.ca/glass. There is a home page that looks good - white background of the main content and looks good. But all the other pages don't have white background so they look not the way they should look. All the pages have the same style sheet and the same layout elements taken from 960.gs framework. It's just some kind of mystery there. What I need is to make all page look like the home page - having white background. Thanks.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 98 99 100 101 102 103 104 105 106 107 108 109  | Next Page >