Search Results

Search found 8593 results on 344 pages for 'regular expression'.

Page 103/344 | < Previous Page | 99 100 101 102 103 104 105 106 107 108 109 110  | Next Page >

  • Extract IP address from an html string (python)

    - by GoJian
    My Friends, I really want to extract a simple IP address from a string (actually an one-line html) using Python. But it turns out that 2 hours passed I still couldn't come up with a good solution. >>> s = "<html><head><title>Current IP Check</title></head><body>Current IP Address: 165.91.15.131</body></html>" -- '165.91.15.131' is what I want! I tried using regular expression, but so far I can only get to the first number. >>> import re >>> ip = re.findall( r'([0-9]+)(?:\.[0-9]+){3}', s ) >>> ip ['165'] In fact, I don't feel I have a firm grasp on reg-expression and the above code was found and modified from elsewhere on the web. Seek your input and ideas!

    Read the article

  • Problem using Conditional Operation with Nullable Int

    - by Rajarshi
    A small problem. Any idea guys why this does not work? int? nullableIntVal = (this.Policy == null) ? null : 1; I am trying to return 'null' if the left hand expression is True, else 1. Seems simple but gives compilation error - Type of conditional expression cannot be determined because there is no implicit conversion between 'null' and 'int' If I replace the " ? null : 1 " with any valid int, then there is no problem.

    Read the article

  • Haskell: Why is it saying my function type is off?

    - by linkmaster03
    I wrote a little Haskell program to find the area of a triangle, primarily to practice custom types, but it keeps throwing the following error on compile: areafinder.hs:7:4: Couldn't match expected type 'Triangle' against inferred type 'm b' In a stmt of a 'do' expression: putStr "Base: " In the expression: do { putStr "Base: "; baseStr I'm not sure where 'm b' comes from, so I'm at a loss here. Why is it throwing this error, and what can I do to fix it? Here is my code: module Main where data Triangle = Triangle Double Double -- base, height getTriangle :: Triangle getTriangle = do putStr "Base: " baseStr Double calcTriangle (Triangle base height) = base * height main = putStrLn ("Area = " ++ show (calcTriangle getTriangle)) Thanks. :)

    Read the article

  • How to replace all the blanks within square brackets with an underscore using sed?

    - by Ringerrr
    I figured out that in order to turn [some name] into [some_name] I need to use the following expression: s/\(\[[^ ]*\) /\1_/ i.e. create a backreference capture for anything that starts with a literal '[' that contains any number of non space characters, followed by a space, to be replaced with the non space characters followed by an underscore. What I don't know yet though is how to alter this expression so it works for ALL underscores within the braces e.g. [a few words] into [a_few_words]. I sense that I'm close, but am just missing a chunk of knowledge that will unlock the key to making this thing work an infinite number of times within the constraints of the first set of []s contained in a line (of SQL Server DDL in this case). Any suggestions gratefully received....

    Read the article

  • How to generate random strings that match a given regexp?

    - by Pies
    Duplicate: Random string that matches a regexp No, it isn't. I'm looking for an easy and universal method, one that I could actually implement. That's far more difficult than randomly generating passwords. I want to create an application that takes a regular expression, and shows 10 randomly generated strings that match that expression. It's supposed to help people better understand their regexps, and to decide i.e. if they're secure enough for validation purposes. Does anyone know of an easy way to do that? One obvious solution would be to write (or steal) a regexp parser, but that seems really over my head. I repeat, I'm looking for an easy and universal way to do that. Edit: Brute force approach is out of the question. Assuming the random strings would just be [a-z0-9]{10} and 1 million iterations per second, it would take 65 years to iterate trough the space of all 10-char strings.

    Read the article

  • How do you add < or > to a summary tag in Visual studio?

    - by Tony
    How do you add < (less than) or (greater than) to a summary comment in visual studio? I am in Visual Studio 2008. I have a generic method: public bool IsMemberProtected<T>(Expression<Func<T, object>> expression) Would love to have a summary tag of something like this /// <summary> /// Determines whether a member is protected. /// /// Usage: IsMemberProtected<ExampleType>(x => x.Member) /// </summary> But when I do that, the tooltip for the property no longer works when a developer hovers over the method in code to view the summary tag. Thoughts?

    Read the article

  • RegularExpressionValidator always fails, but ValidationExpression works in testing

    - by Jerph
    I found the answer to this, but it's a bit of a gotcha so I wanted to share it here. I have a regular expression that validates passwords. They should be 7 to 60 characters with at least one numeric and one alpha character. Pretty standard. I used positive lookaheads (the (?= operator) to implement it: (?=^.{7,60}$)(?=.*[0-9].*)(?=.*[a-zA-Z].*) I checked this expression in my unit tests using Regex.IsMatch(), and it worked fine. However, when I use it in a RegularExpressionValidator, it always fails. Why?

    Read the article

  • How to get all captures of subgroup matches with preg_match_all()?

    - by hakre
    Update/Note: I think what I'm probably looking for is to get the captures of a group in PHP. Referenced: PCRE regular expressions using named pattern subroutines. (Read carefully:) I have a string that contains a variable number of segments (simplified): $subject = 'AA BB DD '; // could be 'AA BB DD CC EE ' as well I would like now to match the segments and return them via the matches array: $pattern = '/^(([a-z]+) )+$/i'; $result = preg_match_all($pattern, $subject, $matches); This will only return the last match for the capture group 2: DD. Is there a way that I can retrieve all subpattern captures (AA, BB, DD) with one regex execution? Isn't preg_match_all suitable for this? This question is a generalization. Both the $subject and $pattern are simplified. Naturally with such the general list of AA, BB, .. is much more easy to extract with other functions (e.g. explode) or with a variation of the $pattern. But I'm specifically asking how to return all of the subgroup matches with the preg_...-family of functions. For a real life case imagine you have multiple (nested) level of a variant amount of subpattern matches. Example This is an example in pseudo code to describe a bit of the background. Imagine the following: Regular definitions of tokens: CHARS := [a-z]+ PUNCT := [.,!?] WS := [ ] $subject get's tokenized based on these. The tokenization is stored inside an array of tokens (type, offset, ...). That array is then transformed into a string, containing one character per token: CHARS -> "c" PUNCT -> "p" WS -> "s" So that it's now possible to run regular expressions based on tokens (and not character classes etc.) on the token stream string index. E.g. regex: (cs)?cp to express one or more group of chars followed by a punctuation. As I now can express self-defined tokens as regex, the next step was to build the grammar. This is only an example, this is sort of ABNF style: words = word | (word space)+ word word = CHARS+ space = WS punctuation = PUNCT If I now compile the grammar for words into a (token) regex I would like to have naturally all subgroup matches of each word. words = (CHARS+) | ( (CHARS+) WS )+ (CHARS+) # words resolved to tokens words = (c+)|((c+)s)+c+ # words resolved to regex I could code until this point. Then I ran into the problem that the sub-group matches did only contain their last match. So I have the option to either create an automata for the grammar on my own (which I would like to prevent to keep the grammar expressions generic) or to somewhat make preg_match working for me somehow so I can spare that. That's basically all. Probably now it's understandable why I simplified the question. Related: pcrepattern man page Get repeated matches with preg_match_all()

    Read the article

  • [iOS] How to catch cancallation of UIScrollView or others?

    - by kyu
    Sometimes, interruptions such as phone call occur and disturb a regular behavior of an app in iPhone or iPad. For example, I created one UIScrollView instance and implemented UIScrollView delegate methods: scrollViewWillBeginDragging and scrollViewDidEndDragging(and scrollViewDidEndDecelerating). A scrollViewWillBeginDragging method deactivated all custom buttons in my app. Then scrollViewDidEndDragging and scrollViewDidEndDecelerating methods activated these custom buttons. That is, while the user scrolled, all custom buttons became deactivated for a while. The problem was that while the user started to drag and just held an UIScrollView instance, if I took a screenshot by pressing a home button and a power button, then any of scrollViewDidEndDragging and scrollViewDidEndDecelerating didn't get called. So the app became messed up. I implemented a UIApplicationWillResignActiveNotification method in my UIViewController, but it didn't get called after taking a screenshot. How can I catch any kind of interruption that disturbs a regular flow of events? Sometimes, touchesEnd and touchesCanceled didn't get called too due to an interruption. Thank you.

    Read the article

  • Allow alphanumeric, punctuation, and spaces

    - by bccarlso
    I'm pretty new to regular expressions, and MAN do they give me a headache. They are so intimidating! For an email campaign I'm doing, a user will click a link out of the email with a few URL parameters filled in for them, to make filling out a form easier. I want to prevent any injection hacks or whatever it's called, but need to allow the $_GET parameters to be alphanumeric, have punctuation, and have spaces. If someone has a good method for this, I'd appreciate it, but right now I have: foreach($_GET as $m=>$n) { $get[$m] = preg_replace('(^[a-z0-9 \-\_\.]+)i',' ',$n); } I would like to be able to replace all characters NOT found with this regular expression, which I believe I use ?!, but I can't get that to work either. Any help in getting this to work would be appreciated!

    Read the article

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • OSGI bundle (or service)- how to register for a given time period?

    - by Alec
    Hello, all! Search did not give me a hint, how can i behave with the following situation: I'd love to have 2 OSGI implementations of the same interface: one is regular, the other should work (be active/present/whatever) on the given time period (f.e for Christmas weeks :)) The main goal is to call the same interface without specifying any flags/properties/without manual switching of ranking. Application should somehow switch implementation for this special period, doing another/regular job before and after :) I'm a newbie, maybe i do not completely understand OSGI concept somewhere, sorry for that of give me a hint or link, sorry for my English. Using Felix/Equinox with Apache Aries.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • How do I get regex support in excel via a function, or custom function?

    - by blunders
    It appears that regex (as in regular expressions) is not supported in excel, except via VBA. Is this so, and is it is, are there any "open source" custom VBA functions that support regex. In this case I'm looking to extract complex pattern within a string, but any implementation of a custom VBA function that expose support of regex within the function itself would be of use. If you know of semi-related function such as the IS function, feel feel to comment, though I'm really looking for a full regular expression implementation that is exposed via functions. Might even be open to a pay to use add-in if the implementation is good. If you have questions, please comment.

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Returning a href within a string

    - by user701254
    How can I return a href within a string, I can access the start position but not sure how to get last position : Here is what I have so far : String str = "sadf ad fas dfa http:\\www.google.com sdfa sadf as dfas"; int index = str.indexOf("http"); String href = str.substring(index , ???); What should the end index be ? Note, this is targeted at j2me & I need to minimise download footprint so I cannot use regular expressions or third party regular expressions libraries.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

< Previous Page | 99 100 101 102 103 104 105 106 107 108 109 110  | Next Page >