Search Results

Search found 2917 results on 117 pages for 'invoke'.

Page 105/117 | < Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Activity gets killed while executing the camera intent

    - by BlackRider
    In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • android app crashes if keyboard was shown

    - by Jaume
    I have an activity that I force keyboard to appears using, InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.SHOW_FORCED, 0); keyboard appears properly and also obscured when needed. Problem is when I finish the activity, app crashes. If the activity never shows keyboard or shows it without start editing text, it is finished with no errors but if you just write one single character or more, app will crash. How to solve it? thank you. method used to finish activity, boto_back.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.HIDE_IMPLICIT_ONLY, 0); finish(); } }); @Override public void onDestroy() { if (adMob != null) { // Destroy the AdView. adMob.destroy(); } super.onDestroy(); } logcat, 07-07 19:04:25.191: E/AndroidRuntime(8443): FATAL EXCEPTION: main 07-07 19:04:25.191: E/AndroidRuntime(8443): java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.TabBar_iOSActivity}: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.handleDestroyActivity(ActivityThread.java:2711) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.access$2100(ActivityThread.java:121) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:976) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Handler.dispatchMessage(Handler.java:99) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Looper.loop(Looper.java:130) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.main(ActivityThread.java:3701) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invokeNative(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invoke(Method.java:507) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:866) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:624) 07-07 19:04:25.191: E/AndroidRuntime(8443): at dalvik.system.NativeStart.main(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): Caused by: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2603) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.LocalActivityManager.dispatchDestroy(LocalActivityManager.java:622) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityGroup.onDestroy(ActivityGroup.java:85) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.xxxx.projecte1.TabBar_iOSActivity.onDestroy(TabBar_iOSActivity.java:417) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2680) 07-07 19:04:25.191: E/AndroidRuntime(8443): ... 11 more

    Read the article

  • SQL Invalid Object Name 'AddressType'

    - by salvationishere
    I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • functional, bind1st and mem_fun

    - by Neil G
    Why won't this compile? #include <functional> #include <boost/function.hpp> class A { A() { typedef boost::function<void ()> FunctionCall; FunctionCall f = std::bind1st(std::mem_fun(&A::process), this); } void process() {} }; Errors: In file included from /opt/local/include/gcc44/c++/bits/stl_function.h:712, from /opt/local/include/gcc44/c++/functional:50, from a.cc:1: /opt/local/include/gcc44/c++/backward/binders.h: In instantiation of 'std::binder1st<std::mem_fun_t<void, A> >': a.cc:7: instantiated from here /opt/local/include/gcc44/c++/backward/binders.h:100: error: no type named 'second_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:103: error: no type named 'first_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:106: error: no type named 'first_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:111: error: no type named 'second_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:117: error: no type named 'second_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h: In function 'std::binder1st<_Operation> std::bind1st(const _Operation&, const _Tp&) [with _Operation = std::mem_fun_t<void, A>, _Tp = A*]': a.cc:7: instantiated from here /opt/local/include/gcc44/c++/backward/binders.h:126: error: no type named 'first_argument_type' in 'class std::mem_fun_t<void, A>' In file included from /opt/local/include/boost/function/detail/maybe_include.hpp:13, from /opt/local/include/boost/function/detail/function_iterate.hpp:14, from /opt/local/include/boost/preprocessor/iteration/detail/iter/forward1.hpp:47, from /opt/local/include/boost/function.hpp:64, from a.cc:2: /opt/local/include/boost/function/function_template.hpp: In static member function 'static void boost::detail::function::void_function_obj_invoker0<FunctionObj, R>::invoke(boost::detail::function::function_buffer&) [with FunctionObj = std::binder1st<std::mem_fun_t<void, A> >, R = void]': /opt/local/include/boost/function/function_template.hpp:913: instantiated from 'void boost::function0<R>::assign_to(Functor) [with Functor = std::binder1st<std::mem_fun_t<void, A> >, R = void]' /opt/local/include/boost/function/function_template.hpp:722: instantiated from 'boost::function0<R>::function0(Functor, typename boost::enable_if_c<boost::type_traits::ice_not::value, int>::type) [with Functor = std::binder1st<std::mem_fun_t<void, A> >, R = void]' /opt/local/include/boost/function/function_template.hpp:1064: instantiated from 'boost::function<R()>::function(Functor, typename boost::enable_if_c<boost::type_traits::ice_not::value, int>::type) [with Functor = std::binder1st<std::mem_fun_t<void, A> >, R = void]' a.cc:7: instantiated from here /opt/local/include/boost/function/function_template.hpp:153: error: no match for call to '(std::binder1st<std::mem_fun_t<void, A> >) ()'

    Read the article

  • One intent is working, second is giving me a crash

    - by user1480742
    ok, so both intents receiver sides are on the same activite and they are sending from different ones....second one is not working, first one does, dont know why...all 3 activites are ok in manifest and all that //second intent on senders side public void onItemSelected(AdapterView<?> arg0, View users, int i, long l) { FILENAME = (adapter.getItem(i)).toString(); Bundle viewBag2 = new Bundle(); viewBag2.putString("profile_name", FILENAME); Intent b = new Intent(OptionsMenu.this, CoreActivity.class); b.putExtras(viewBag2); startActivity(b); } //second intent on receiver side private void Data_transfer() { Bundle gotbasket2 = getIntent().getExtras(); profileName = gotbasket2.getString("profile_name"); } //first (working intent) on senders side public void onClick(View v) { Bundle viewBag = new Bundle(); viewBag.putString("spinner_result", s); a.putExtras(viewBag); } //first (working intent) on receiver side private void Data_transfer() { // TODO Auto-generated method stub Bundle gotbasket = getIntent().getExtras(); x = gotbasket.getString("spinner_result"); } 06-26 20:22:09.787: D/AndroidRuntime(1802): Shutting down VM 06-26 20:22:09.787: W/dalvikvm(1802): threadid=1: thread exiting with uncaught exception (group=0x40015560) 06-26 20:22:09.847: E/AndroidRuntime(1802): FATAL EXCEPTION: main 06-26 20:22:09.847: E/AndroidRuntime(1802): java.lang.RuntimeException: Unable to start activity ComponentInfo{mioc.diver/mioc.diver.CoreActivity}: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Handler.dispatchMessage(Handler.java:99) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Looper.loop(Looper.java:123) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.main(ActivityThread.java:3683) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invokeNative(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invoke(Method.java:507) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 06-26 20:22:09.847: E/AndroidRuntime(1802): at dalvik.system.NativeStart.main(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): Caused by: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.Data_transfer(CoreActivity.java:189) 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.onCreate(CoreActivity.java:88) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611) 06-26 20:22:09.847: E/AndroidRuntime(1802): ... 11 more

    Read the article

  • Android - exception from an AsynchTask call

    - by GeekedOut
    I have an Activity that makes a remote server call and tries to populate a list. The call to the server works fine, and the call returns some JSON which is good. But then the system throws this exception: 04-06 18:43:19.626: D/AndroidRuntime(2564): Shutting down VM 04-06 18:43:19.626: W/dalvikvm(2564): threadid=1: thread exiting with uncaught exception (group=0x409c01f8) 04-06 18:43:19.686: E/AndroidRuntime(2564): FATAL EXCEPTION: main 04-06 18:43:19.686: E/AndroidRuntime(2564): java.lang.NullPointerException 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ArrayAdapter.createViewFromResource(ArrayAdapter.java:394) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ArrayAdapter.getView(ArrayAdapter.java:362) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.AbsListView.obtainView(AbsListView.java:2033) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ListView.measureHeightOfChildren(ListView.java:1244) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ListView.onMeasure(ListView.java:1155) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureChildBeforeLayout(LinearLayout.java:1369) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureVertical(LinearLayout.java:660) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.onMeasure(LinearLayout.java:553) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.FrameLayout.onMeasure(FrameLayout.java:293) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureVertical(LinearLayout.java:812) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.onMeasure(LinearLayout.java:553) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.FrameLayout.onMeasure(FrameLayout.java:293) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.policy.impl.PhoneWindow$DecorView.onMeasure(PhoneWindow.java:2092) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewRootImpl.performTraversals(ViewRootImpl.java:1064) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewRootImpl.handleMessage(ViewRootImpl.java:2442) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.os.Handler.dispatchMessage(Handler.java:99) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.os.Looper.loop(Looper.java:137) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.app.ActivityThread.main(ActivityThread.java:4424) 04-06 18:43:19.686: E/AndroidRuntime(2564): at java.lang.reflect.Method.invokeNative(Native Method) 04-06 18:43:19.686: E/AndroidRuntime(2564): at java.lang.reflect.Method.invoke(Method.java:511) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:784) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:551) 04-06 18:43:19.686: E/AndroidRuntime(2564): at dalvik.system.NativeStart.main(Native Method) Why would this happen? It doesn't point to any of my code so its a bit strange. the protected void onPostExecute(String result) never gets called on the callback. Thanks!

    Read the article

  • Dynamically loading modules in Python (+ threading question)

    - by morpheous
    I am writing a Python package which reads the list of modules (along with ancillary data) from a configuration file. I then want to iterate through each of the dynamically loaded modules and invoke a do_work() function in it which will spawn a new thread, so that the code runs in a separate thread. At the moment, I am importing the list of all known modules at the beginning of my main script - this is a nasty hack I feel, and is not very flexible, as well as being a maintenance pain. This is the function that spawns the threads. I will like to modify it to dynamically load the module when it is encountered. The key in the dictionary is the name of the module containing the code: def do_work(work_info): for (worker, dataset) in work_info.items(): #import the module defined by variable worker here... t = threading.Thread(target=worker.do_work, args=[dataset]) # I'll NOT dameonize since spawned children need to clean up on shutdown # Since the threads will be holding resources #t.daemon = True t.start() Question 1 When I call the function in my script (as written above), I get the following error: AttributeError: 'str' object has no attribute 'do_work' Which makes sense, since the dictionary key is a string (name of the module to be imported). When I add the statement: import worker before spawning the thread, I get the error: ImportError: No module named worker This is strange, since the variable name rather than the value it holds are being used - when I print the variable, I get the value (as I expect) whats going on? Question 2 As I mentioned in the comments section, I realize that the do_work() function written in the spawned children needs to cleanup after itself. My understanding is to write a clean_up function that is called when do_work() has completed successfully, or an unhandled exception is caught - is there anything more I need to do to ensure resources don't leak or leave the OS in an unstable state? Question 3 If I comment out the t.daemon flag statement, will the code stil run ASYNCHRONOUSLY?. The work carried out by the spawned children are pretty intensive, and I don't want to have to be waiting for one child to finish before spawning another child. BTW, I am aware that threading in Python is in reality, a kind of time sharing/slicing - thats ok Lastly is there a better (more Pythonic) way of doing what I'm trying to do?

    Read the article

  • emacs: how do I use edebug on code that is defined in a macro?

    - by Cheeso
    I don't even know the proper terminology for this lisp syntax, so I don't know if the words I'm using to ask the question, make sense. But the question makes sense, I'm sure. So let me just show you. cc-mode (cc-fonts.el) has things called "matchers" which are bits of code that run to decide how to fontify a region of code. That sounds simple enough, but the matcher code is in a form I don't completely understand, with babckticks and comma-atsign and just comma and so on, and furthermore it is embedded in a c-lang-defcost, which itself is a macro. And I want to run edebug on that code. Look: (c-lang-defconst c-basic-matchers-after "Font lock matchers for various things that should be fontified after generic casts and declarations are fontified. Used on level 2 and higher." t `(;; Fontify the identifiers inside enum lists. (The enum type ;; name is handled by `c-simple-decl-matchers' or ;; `c-complex-decl-matchers' below. ,@(when (c-lang-const c-brace-id-list-kwds) `((,(c-make-font-lock-search-function (concat "\\<\\(" (c-make-keywords-re nil (c-lang-const c-brace-id-list-kwds)) "\\)\\>" ;; Disallow various common punctuation chars that can't come ;; before the '{' of the enum list, to avoid searching too far. "[^\]\[{}();,/#=]*" "{") '((c-font-lock-declarators limit t nil) (save-match-data (goto-char (match-end 0)) (c-put-char-property (1- (point)) 'c-type 'c-decl-id-start) (c-forward-syntactic-ws)) (goto-char (match-end 0))))))) I am reading up on lisp syntax to figure out what those things are and what to call them, but aside from that, how can I run edebug on the code that follows the comment that reads ;; Fontify the identifiers inside enum lists. ? I know how to run edebug on a defun - just invoke edebug-defun within the function's definition, and off I go. Is there a corresponding thing I need to do to edebug the cc-mode matcher code forms?

    Read the article

  • How do I use Ruby metaprogramming to refactor this common code?

    - by James Wenton
    I inherited a project with a lot of badly-written Rake tasks that I need to clean up a bit. Because the Rakefiles are enormous and often prone to bizarre nonsensical dependencies, I'm simplifying and isolating things a bit by refactoring everything to classes. Specifically, that pattern is the following: namespace :foobar do desc "Frozz the foobar." task :frozzify do unless Rake.application.lookup('_frozzify') require 'tasks/foobar' Foobar.new.frozzify end Rake.application['_frozzify'].invoke end # Above pattern repeats many times. end # Several namespaces, each with tasks that follow this pattern. In tasks/foobar.rb, I have something that looks like this: class Foobar def frozzify() # The real work happens here. end # ... Other tasks also in the :foobar namespace. end For me, this is great, because it allows me to separate the task dependencies from each other and to move them to another location entirely, and I've been able to drastically simplify things and isolate the dependencies. The Rakefile doesn't hit a require until you actually try to run a task. Previously this was causing serious issues because you couldn't even list the tasks without it blowing up. My problem is that I'm repeating this idiom very frequently. Notice the following patterns: For every namespace :xyz_abc, there is a corresponding class in tasks/... in the file tasks/[namespace].rb, with a class name that looks like XyzAbc. For every task in a particular namespace, there is an identically named method in the associated namespace class. For example, if namespace :foo_bar has a task :apples, you would expect to see def apples() ... inside the FooBar class, which itself is in tasks/foo_bar.rb. Every task :t defines a "meta-task" _t (that is, the task name prefixed with an underscore) which is used to do the actual work. I still want to be able to specify a desc-description for the tasks I define, and that will be different for each task. And, of course, I have a small number of tasks that don't follow the above pattern at all, so I'll be specifying those manually in my Rakefile. I'm sure that this can be refactored in some way so that I don't have to keep repeating the same idiom over and over, but I lack the experience to see how it could be done. Can someone give me an assist?

    Read the article

  • SharePoint List Service Recursive not working

    - by stranger001
    Hi, I am using the following code to retrieve the documents in a list. Its working fine. However, it only returns documents and folders in root of the doc library. Is there any thing wrong I am doing here? I am looking for files in sub folders with recursive mode. Service service = new Service(); service.setMaintainSession(true); call = (Call) service.createCall(); call.setTargetEndpointAddress( new java.net.URL("<host>/_vti_bin/lists.asmx") ); call.setOperationName(new QName("http://schemas.microsoft.com/sharepoint/soap/","GetListItems")); call.setProperty(Call.SOAPACTION_USE_PROPERTY, new Boolean("true")); call.setProperty(Call.SOAPACTION_URI_PROPERTY,"http://schemas.microsoft.com/sharepoint/soap/GetListItems"); call.addParameter(new javax.xml.namespace.QName("http://schemas.microsoft.com/sharepoint/soap/", "listName"), new javax.xml.namespace.QName("http://www.w3.org/2001/XMLSchema", "string"), java.lang.String.class, javax.xml.rpc.ParameterMode.IN); MessageElement me = new MessageElement(new QName("QueryOptions")); me.addChildElement(new MessageElement(new QName( "IncludeMandatoryColumns"))).addTextNode("true"); me.addChildElement(new MessageElement(new QName( "ViewAttributes"))).addAttribute(javax.xml.soap.SOAPFactory.newInstance().createName("Scope"), "Recursive"); MessageElement[] me1 = {me}; String strMyString = "" + "<Query>" + "<OrderBy><FieldRef Name=\"ows_Modified\" Ascending=\"TRUE\" /></OrderBy>" + "</Query>"; MessageElement[] meArray = { getMeFromString(strMyString) };// Array call.addParameter("query",org.apache.axis.Constants.XSD_SCHEMA, javax.xml.rpc.ParameterMode.IN); call.addParameter("queryOptions",org.apache.axis.Constants.XSD_SCHEMA, javax.xml.rpc.ParameterMode.IN); call.setReturnType(org.apache.axis.Constants.XSD_SCHEMA); Schema ret = (Schema)call.invoke(new Object[] {"listGUID",meArray, me1 }); public org.apache.axis.message.MessageElement getMeFromString(final String strMyString) { DocumentBuilder docBuilder = null; try { docBuilder = DocumentBuilderFactory.newInstance().newDocumentBuilder(); } catch (final ParserConfigurationException e) { e.printStackTrace(); } catch (final FactoryConfigurationError e) { e.printStackTrace(); } final StringReader reader = new StringReader(strMyString); final InputSource inputsource = new InputSource(reader); Document doc = null; try { doc = docBuilder.parse(inputsource); } catch (final SAXException e) { e.printStackTrace(); } catch (final IOException e) { e.printStackTrace(); } final Element ele = doc.getDocumentElement(); final MessageElement msg = new MessageElement(ele); return msg; }

    Read the article

  • My winform application doesn't work on others' pc without vs 2010 installed

    - by wings
    Just like I said, my winform application works properly on computers with VS installed, but on other computers, it will crash due to a FileNotFound Exception. I used using Application = Microsoft.Office.Interop.Excel.Application; in my source code to generate a Excel file, and the problem occurs as soon as the Excel-related function is called. But I don't know what it refers to exactly. Do I have to get some .dll included along with the .exe file? And what DLL is that? Below are part of my codes: private void FileExport(object objTable) { StartWaiting(); string[,] table = null; try { table = (string[,])objTable; } catch (Exception ex) { ShowStatus(ex.Message, StatusType.Warning); } if (table == null) { return; } Application excelApp = new Application { DisplayAlerts = false }; Workbooks workbooks = excelApp.Workbooks; Workbook workbook = workbooks.Add(XlWBATemplate.xlWBATWorksheet); Worksheet worksheet = (Worksheet)workbook.Worksheets[1]; worksheet.Name = "TABLE"; for (int i = 0; i < table.GetLength(0); i++) { for (int j = 0; j < table.GetLength(1); j++) { worksheet.Cells[i + 1, j + 1] = table[i, j]; } } Range range = excelApp.Range["A1", "H1"]; range.Merge(); range.Font.Bold = true; range.Font.Size = 15; range.RowHeight = 50; range.EntireRow.AutoFit(); range = excelApp.Range["A2", "H8"]; range.Font.Size = 11; range = excelApp.Range["A1", "H8"]; range.NumberFormatLocal = "@"; range.RowHeight = 300; range.ColumnWidth = 50; range.HorizontalAlignment = XlHAlign.xlHAlignCenter; range.VerticalAlignment = XlVAlign.xlVAlignCenter; range.EntireRow.AutoFit(); range.EntireColumn.AutoFit(); worksheet.UsedRange.Borders.LineStyle = 1; Invoke(new MainThreadInvokerDelegate(SaveAs), new object[] { worksheet, workbook, excelApp } ); EndWaiting(); }

    Read the article

  • Force close while calling mainactivity from widget (android)

    - by Shaji Thorn Blue
    Iam creating a simple widget, by this widget i want to open my mainactivity. Iam sending a unique key from my widget class to check whether my mainactivity is called via widget or not. But as soon as i clicked on my widget my mainactivity get force close. here is code of my widget class... @Override public void onUpdate(Context context, AppWidgetManager appWidgetManager, int[] widgets) { // TODO Auto-generated method stub int numofWidgets = widgets.length; for(int i=0;i<numofWidgets;i++){ int widget = widgets[i]; Intent in = new Intent(context, EmergencyButton.class); in.putExtra("uniquevalue", "widget"); PendingIntent pendingintent = PendingIntent.getActivity(context, 0, in, 0); RemoteViews views = new RemoteViews(context.getPackageName(), R.layout.widgetlayout); views.setOnClickPendingIntent(R.id.button, pendingintent); appWidgetManager.updateAppWidget(widget, views); } } And Here is my code of mainactivity where iam checking whether called came from widget or not @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.mainactivity); Intent intentwidget = this.getIntent(); if(intentwidget !=null) { String widgetdata = "nothing"; widgetdata = intentwidget.getExtras().getString("uniquevalue"); if(widgetdata.equals("widget")) { et1.setText(widgetdata); } } } And here is my logcat 11-04 14:57:14.361: E/AndroidRuntime(1701): FATAL EXCEPTION: main 11-04 14:57:14.361: E/AndroidRuntime(1701): java.lang.RuntimeException: Unable to start activityComponentInfo{com.appsionlabs.googlemapv2/com.appsionlabs.googlemapv2.EmergencyButton}: java.lang.NullPointerException 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.os.Handler.dispatchMessage(Handler.java:99) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.os.Looper.loop(Looper.java:123) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.main(ActivityThread.java:3683) 11-04 14:57:14.361: E/AndroidRuntime(1701): at java.lang.reflect.Method.invokeNative(Native Method) 11-04 14:57:14.361: E/AndroidRuntime(1701): at java.lang.reflect.Method.invoke(Method.java:507) 11-04 14:57:14.361: E/AndroidRuntime(1701): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 11-04 14:57:14.361: E/AndroidRuntime(1701): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 11-04 14:57:14.361: E/AndroidRuntime(1701): at dalvik.system.NativeStart.main(Native Method) 11-04 14:57:14.361: E/AndroidRuntime(1701): Caused by: java.lang.NullPointerException 11-04 14:57:14.361: E/AndroidRuntime(1701): at com.appsionlabs.googlemapv2.EmergencyButton.onCreate(EmergencyButton.java:29) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611)

    Read the article

  • Different behavior of reflected generic delegates with and without debugger

    - by Andrew_B
    Hello. We have encountered some strange things while calling reflected generic delegates. In some cases with attatched debuger we can make impossible call, while without debugger we cannot catch any exception and application fastfails. Here is the code: using System; using System.Windows.Forms; using System.Reflection; namespace GenericDelegate { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private delegate Class2 Delegate1(); private void button1_Click(object sender, EventArgs e) { MethodInfo mi = typeof (Class1<>).GetMethod("GetClass", BindingFlags.NonPublic | BindingFlags.Static); if (mi != null) { Delegate1 del = (Delegate1) Delegate.CreateDelegate(typeof (Delegate1), mi); MessageBox.Show("1"); try { del(); } catch (Exception) { MessageBox.Show("No, I can`t catch it"); } MessageBox.Show("2"); mi.Invoke(null, new object[] {});//It's Ok, we'll get exception here MessageBox.Show("3"); } } class Class2 { } class Class1<T> : Class2 { internal static Class2 GetClass() { Type type = typeof(T); MessageBox.Show("Type name " + type.FullName +" Type: " + type + " Assembly " + type.Assembly); return new Class1<T>(); } } } } There are two problems: Behavior differs with debugger and without You cannot catch this error without debugger by clr tricks. It's just not the clr exception. There are memory acces vialation, reading zero pointer inside of internal code. Use case: You develop something like plugins system for your app. You read external assembly, find suitable method in some type, and execute it. And we just forgot about that we need to check up is the type generic or not. Under VS (and .net from 2.0 to 4.0) everything works fine. Called function does not uses static context of generic type and type parameters. But without VS application fails with no sound. We even cannot identify call stack attaching debuger. Tested with .net 4.0 The question is why VS catches but runtime do not?

    Read the article

  • c# Lambda Expression built with LinqKit does not compile

    - by Frank Michael Kraft
    This lambda does not compile, but I do not understand why. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Linq.Expressions; using LinqKit; namespace ConsoleApplication2 { class Program { static void Main(string[] args) { var barModel = new BarModel(); string id = "some"; Console.WriteLine(barModel.subFor(id).ToString()); // output: m => (True AndAlso (m.key == value(ConsoleApplication2.Bar`1+<>c__DisplayClass0[ConsoleApplication2.Model]).id)) Console.ReadKey(); var subworkitems = barModel.list.Where(barModel.subFor(id).Compile()); // Exception {"variable 'm' of type 'ConsoleApplication2.Model' referenced from scope '', but it is not defined"} Console.WriteLine(subworkitems.ToString()); Console.ReadKey(); } } class Bar<TModel> { public Bar(Expression<Func<TModel, string>> foreignKeyExpression) { _foreignKeyExpression = foreignKeyExpression; } private Expression<Func<TModel, string>> _foreignKeyExpression { get; set; } public Expression<Func<TModel, bool>> subFor(string id) { var ex = forTargetId(id); return ex; } public Expression<Func<TModel, bool>> forTargetId(String id) { var fc = _foreignKeyExpression; Expression<Func<TModel, bool>> predicate = m => true; var result = predicate.And(m => fc.Invoke(m) == id).Expand(); return result; } } class Model { public string key; public string value; } class BarModel : Bar<Model> { public List<Model> list; public BarModel() : base(m => m.key) { list = new List<Model>(); } } }

    Read the article

  • nodejs async.waterfall method

    - by user1513388
    Update 2 Complete code listing var request = require('request'); var cache = require('memory-cache'); var async = require('async'); var server = '172.16.221.190' var user = 'admin' var password ='Passw0rd' var dn ='\\VE\\Policy\\Objects' var jsonpayload = {"Username": user, "Password": password} async.waterfall([ //Get the API Key function(callback){ request.post({uri: 'http://' + server +'/sdk/authorize/', json: jsonpayload, headers: {'content_type': 'application/json'} }, function (e, r, body) { callback(null, body.APIKey); }) }, //List the credential objects function(apikey, callback){ var jsonpayload2 = {"ObjectDN": dn, "Recursive": true} request.post({uri: 'http://' + server +'/sdk/Config/enumerate?apikey=' + apikey, json: jsonpayload2, headers: {'content_type': 'application/json'} }, function (e, r, body) { var dns = []; for (var i = 0; i < body.Objects.length; i++) { dns.push({'name': body.Objects[i].Name, 'dn': body.Objects[i].DN}) } callback(null, dns, apikey); }) }, function(dns, apikey, callback){ // console.log(dns) var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"CredentialPath": dns[i].dn, "Pattern": null, "Recursive": false} console.log(dns[i].dn) request.post({uri: 'http://' + server +'/sdk/credentials/retrieve?apikey=' + apikey, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { // console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, apikey); console.log(cb) }); } } ], function (err, result) { // console.log(result) // result now equals 'done' }); Update: I'm building a small application that needs to make multiple HTTP calls to a an external API and amalgamates the results into a single object or array. e.g. Connect to endpoint and get auth key - pass auth key to step 2 Connect to endpoint using auth key and get JSON results - create an object containing summary results and pass to step 3. Iterate over passed object summary results and call API for each item in the object to get detailed information for each summary line Create a single JSON data structure that contains the summary and detail information. The original question below outlines what I've tried so far! Original Question: Will the async.waterfall method support multiple callbacks? i.e. Iterate over an array thats passed from a previous item in the chain, then invoke multiple http requests each of which would have their own callbacks. e.g, sync.waterfall([ function(dns, key, callback){ var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"Cred": dns[i].DN, "Pattern": null, "Recursive": false} console.log(dns[i].DN) request.post({uri: 'http://' + vedserver +'/api/cred/retrieve?apikey=' + key, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, key); }); } }

    Read the article

  • Implementing hoverIntent for Drop Down Menu (coming from click_event)

    - by stormeTrooper
    I've just recently started programming, I was hoping for some help. I have a drop down menu that was originally activated by click_event, however I want to now implement hoverIntent in order to make the menu drop. The issue I am having now is being able to use the menu, because whenever I invoke the menu now, once I leave the area that activates the menu, the menu closes. If you could explain to me like I'm five, I'd appreciate it, thanks :) The code I am using as follows: JavaScript: function setupUserConfigMenu() { $('.user_profile_btn').hoverIntent( function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }, function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }) } HTML: <li> <a href="<%= "#" %>" class="user_profile_btn" title="Your profile page"><%= truncate(current_user.full_name || current_user.name, :length => 28) %> <div class="arrow_down"></div></a> <ul id="user_settings_dropdown"> <li> <a href="<%= current_user.get_url(true) %>"> <%= image_tag current_user.get_thumb_url, :size => "30x30" %> <div> <%= truncate(current_user.full_name || current_user.name, :length => 40) %> <br> View profile </div> </a> </li> <div class="grey_line"></div> <li class="settings_list_item"> <%= link_to "Settings", edit_user_registration_path %> </li> <li class="settings_list_item"> <%= link_to "About", "/about" %> </li> <li class="settings_list_item"> <%= link_to "Logout", destroy_user_session_path, :method => :delete %> </li> </ul> </li>

    Read the article

  • In Javascript, a function starts a new scope, but we have to be careful that the function must be in

    - by Jian Lin
    In Javascript, I am sometimes too immerged in the idea that a function creates a new scope, that sometimes I even think the following anonymous function will create a new scope when it is being defined and assigned to onclick: <a href="#" id="link1">ha link 1</a> <a href="#" id="link2">ha link 2</a> <a href="#" id="link3">ha link 3</a> <a href="#" id="link4">ha link 4</a> <a href="#" id="link5">ha link 5</a> <script type="text/javascript"> for (i = 1; i <= 5; i++) { document.getElementById('link' + i).onclick = function() { var x = i; alert(x); return false; } } </script> but in fact, the anonymous function will create a new scope, that's right, but ONLY when it is being invoked, is that so? So the x inside the anonymous function is not created, no new scope is created. When the function was later invoked, there is a new scope alright, but the i is in the outside scope, and the x gets its value, and it is all 6 anyways. The following code will actually invoke a function and create a new scope and that's why the x is a new local variable x in the brand new scope each time, and the invocation of the function when the link is clicked on will use the different x in the different scopes. <a href="#" id="link1">ha link 1</a> <a href="#" id="link2">ha link 2</a> <a href="#" id="link3">ha link 3</a> <a href="#" id="link4">ha link 4</a> <a href="#" id="link5">ha link 5</a> <script type="text/javascript"> for (var i = 1; i <= 5; i++) { (function() { var x = i; document.getElementById('link' + i).onclick = function() { alert(x); return false; } })(); // invoking it now! } </script> If we take away the var in front of x, then it is a global x and so no local variable x is created in the new scope, and therefore, clicking on the links get all the same number, which is the value of the global x.

    Read the article

  • Secure WS client with UsernameToken(SOAP security header)

    - by user79163
    Hi, I'm trying to secure my WS client to be able to call the WS. My code looks like this: SendSmsService smsService = new SendSmsService(); SendSms sendSMS = smsService.getSendSms(); BindingProvider stub = (BindingProvider)sendSMS; //Override endpoint with local copy of wsdl. String URL ="";//here is the wsdl url Map<String,Object> requestContext = stub.getRequestContext(); requestContext.put(BindingProvider.ENDPOINT_ADDRESS_PROPERTY, URL); //Set usernametoken URL fileURL = loader.getResource("client-config.xml"); File file = new File(fileURL.getFile()); FileInputStream clientConfig = null; try { clientConfig = new FileInputStream(file); } catch (FileNotFoundException e) { e.printStackTrace(); } XWSSecurityConfiguration config = null; try { config = SecurityConfigurationFactory.newXWSSecurityConfiguration(clientConfig); } catch (Exception e) { e.printStackTrace(); log.warn("Exception: "+e.getMessage()); } requestContext.put(XWSSecurityConfiguration.MESSAGE_SECURITY_CONFIGURATION, config); //Invoke the web service String requestId = null; try { requestId = sendSMS.sendSms(addresses, senderName, charging, message, receiptRequest); } catch (PolicyException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (ServiceException e) { // TODO Auto-generated catch block e.printStackTrace(); } and the config file looks like this: <xwss:JAXRPCSecurity xmlns:xwss="http://java.sun.com/xml/ns/xwss/config" optimize="true"> <xwss:Service> <xwss:SecurityConfiguration dumpMessages="true" xmlns:xwss="http://java.sun.com/xml/ns/xwss/config"> <xwss:UsernameToken name="username" password="password> </xwss:SecurityConfiguration> </xwss:Service> <xwss:SecurityEnvironmentHandler> util.SecurityEnvironmentHandler </xwss:SecurityEnvironmentHandler> </xwss:JAXRPCSecurity> The SecurityEnviromentHandler is a dummy class that implements javax.security.auth.callback.CallbackHandler. Authentication must be in compliance with Oasis Web Services Security Username Token Profile 1.0. But I'm constantly getting "Security header not valid" error. Where am I going wrong, can anyone tell me. I used wsimport(JAX_WS 2.1 to generate classes for my client) Note:Only thing I know about this WS is WSDL URL and user&pass for authentication

    Read the article

  • PHP resized image functions and S3 upload functions - but how to merge the two?

    - by chocolatecoco
    I am using S3 to store images and I am resizing and compressing images before it gets uploaded using PHP. I'm using this class for storing the images to an S3 bucket - http://undesigned.org.za/2007/10/22/amazon-s3-php-class This all works fine if I'm not doing any file processing before the file is uploaded because it reads the file upload from the $_FILES array. The problem is I am resizing and compressing the image before storing to the S3 bucket. So I'm no longer able to read from the $_FILES array. The functions for resizing: public function resizeImage($newWidth, $newHeight, $option="auto") { // *** Get optimal width and height - based on $option $optionArray = $this->getDimensions($newWidth, $newHeight, $option); $optimalWidth = $optionArray['optimalWidth']; $optimalHeight = $optionArray['optimalHeight']; // *** Resample - create image canvas of x, y size $this->imageResized = imagecreatetruecolor($optimalWidth, $optimalHeight); imagecopyresampled($this->imageResized, $this->image, 0, 0, 0, 0, $optimalWidth, $optimalHeight, $this->width, $this->height); // *** if option is 'crop', then crop too if ($option == 'crop') { $this->crop($optimalWidth, $optimalHeight, $newWidth, $newHeight); } } The script I am using to store the file after resizing and compressing to a local directory: public function saveImage($savePath, $imageQuality="100") { // *** Get extension $extension = strrchr($savePath, '.'); $extension = strtolower($extension); switch($extension) { case '.jpg': case '.jpeg': if (imagetypes() & IMG_JPG) { imagejpeg($this->imageResized, $savePath, $imageQuality); } break; case '.gif': if (imagetypes() & IMG_GIF) { imagegif($this->imageResized, $savePath); } break; case '.png': // *** Scale quality from 0-100 to 0-9 $scaleQuality = round(($imageQuality/100) * 9); // *** Invert quality setting as 0 is best, not 9 $invertScaleQuality = 9 - $scaleQuality; if (imagetypes() & IMG_PNG) { imagepng($this->imageResized, $savePath, $invertScaleQuality); } break; // ... etc default: // *** No extension - No save. break; } imagedestroy($this->imageResized); } with this PHP code to invoke it: $resizeObj = new resize("$images_dir/$filename"); $resizeObj -> resizeImage($thumbnail_width, $thumbnail_height, 'crop'); $resizeObj -> saveImage($images_dir."/tb_".$filename, 90); How do I modify the code above so I can pass it through this function: $s3->putObjectFile($thefile, "s3bucket", $s3directory, S3::ACL_PUBLIC_READ)

    Read the article

  • How to update a TextView on ButtonClick with Spinner(s) values

    - by source.rar
    Hi, I am trying to populate a TextView based on the current selected options in 3 Spinner(s) but cant seem to figure out how to retrieve the selected values from the Spinners to invoke the update function with. Here is my current code (quite messy but I'm just learning Java :)), public class AgeFun extends Activity { private String[] dayNames; private String[] yearArray; private final static int START_YEAR = 1990; private static TextView textDisp; private Button calcButton; private static Spinner spinnerDay, spinnerYear, spinnerMonth; private static ArrayAdapter<?> monthAdapter, dayAdapter, yearAdapter; private int year, month, day; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); year = 2000; month = 1; day = 1; textDisp = (TextView) findViewById(R.id.textView1); calcButton = (Button) findViewById(R.id.button); calcButton.setOnClickListener(new OnClickListener() { public void onClick(View v) { // Perform action on clicks AgeFun.updateAge(year, month, day); } }); // Month spinner spinnerMonth = (Spinner) findViewById(R.id.spinnerFirst); monthAdapter = ArrayAdapter.createFromResource( this, R.array.monthList, android.R.layout.simple_spinner_item); monthAdapter.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); spinnerMonth.setAdapter(monthAdapter); // Day spinner dayNames = new String[31]; for(int i =1; i <= 31; ++i) { dayNames[i-1] = Integer.toString(i); } spinnerDay = (Spinner) findViewById(R.id.spinnerSecond); dayAdapter = new ArrayAdapter<CharSequence>(this, android.R.layout.simple_spinner_item, dayNames); spinnerDay.setAdapter(dayAdapter); // Year spinner yearArray = new String[40]; for(int i =0; i < 40; ++i) { yearArray[i] = Integer.toString(START_YEAR+i); } spinnerYear = (Spinner) findViewById(R.id.spinnerThird); yearAdapter = new ArrayAdapter<CharSequence>(this, android.R.layout.simple_spinner_item, yearArray); spinnerYear.setAdapter(yearAdapter); updateAge(2000,1,1); } private static void updateAge(int year, int month, int day) { Date dob = new GregorianCalendar(year, month, day).getTime(); Date currDate = new Date(); long age = (currDate.getTime() - dob.getTime()) / (1000 * 60 * 60 * 24) / 365; textDisp.setText("Your are " + Long.toString(age) + " years old"); } } Any help with this would be great. TIA

    Read the article

  • Searching a Better Solution with Delegates

    - by spagetticode
    Hey All, I am a newbie in C# and curious about the better solution of my case. I have a method which gets the DataTable as a parameter and creates a List with MyClass's variables and returns it. public static List<Campaigns> GetCampaignsList(DataTable DataTable) { List<Campaigns> ListCampaigns = new List<Campaigns>(); foreach (DataRow row in DataTable.Rows) { Campaigns Campaign = new Campaigns(); Campaign.CampaignID = Convert.ToInt32(row["CampaignID"]); Campaign.CustomerID = Convert.ToInt32(row["CustomerID"]); Campaign.ClientID = Convert.ToInt32(row["ClientID"]); Campaign.Title = row["Title"].ToString(); Campaign.Subject = row["Subject"].ToString(); Campaign.FromName = row["FromName"].ToString(); Campaign.FromEmail = row["FromEmail"].ToString(); Campaign.ReplyEmail = row["ReplyEmail"].ToString(); Campaign.AddDate = Convert.ToDateTime(row["AddDate"]); Campaign.UniqueRecipients = Convert.ToInt32(row["UniqueRecipients"]); Campaign.ClientReportVisible = Convert.ToBoolean(row["ClientReportVisible"]); Campaign.Status = Convert.ToInt16(row["Status"]); ListCampaigns.Add(Campaign); } return ListCampaigns; } And one of my another DataTable method gets the DataTable from the database with given parameters. Here is the method. public static DataTable GetNewCampaigns() { DataTable dtCampaigns = new DataTable(); Campaigns Campaigns = new Campaigns(); dtCampaigns = Campaigns.SelectStatus(0); return dtCampaigns; } But the problem is that, this GetNewCampaigns method doesnt take parameters but other methods can take parameters. For example when I try to select a campaign with a CampaignID, I have to send CampaignID as parameter. These all Database methods do take return type as DataTable but different number of parameters. public static DataTable GetCampaignDetails(int CampaignID) { DataTable dtCampaigns = new DataTable(); Campaigns Campaigns = new Campaigns(); dtCampaigns = Campaigns.Select(CampaignID); return dtCampaigns; } At the end, I want to pass a Delegate to my first GetCampaignList Method as parameter which will decide which Database method to invoke. I dont want to pass DataTable as parameter as it is newbie programming. Could you pls help me learn some more advance features. I searched over it and got to Func< delegate but could not come up with a solution.

    Read the article

< Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >