Search Results

Search found 22224 results on 889 pages for 'point of sale'.

Page 106/889 | < Previous Page | 102 103 104 105 106 107 108 109 110 111 112 113  | Next Page >

• javascript table sorting/paging (client-side). How big is too big?

  - by Aheho

  I'm using a jQuery plugin called Tablesorter to do client-side sorting of a log table in one of my applications. I am also making use of the tablepager add-in. I really like the responsiveness that client-side sorting and paging brings to the party. I also like how you don't have to hit the web server or database repeatedly. However I can see that, in time, the log I'm displaying could grow quite large. I'm sure there comes a point where client-side paging and sorting is going to be impractical. What point will this technique begin to collapse under it's own weight? 500 records? 2000 records? 10,000 records? EDIT: In nutshell, what criteria would you use to determine if you are going to use client-side sorting/paging as opposed to server-side paging? Does the size of expected result set factor into your decision? Where is the tipping point?

  Read the article

• What's the deal with Java's public fields?

  - by Annan

  I've been reading two articles (1)(2) on javaworld.com about how all class fields should be private and getter/setter methods are just as bad. An object should act on the data it has rather than allowing access to it. I'm currently working on a University assignment for Connect Four. In designing the program the Agents playing the Game need access to the Board's state (so they can decide what to move). They also need to pass this move to the Game so it can validate it as a legal move. And during deciding what to move pieces are grouped into Threats with a start and end Points. Board, Threat and Point objects don't really do anything. They are just there to store related data that can be accessed in a human readable way. At the start of design I was representing Points on the board as two element int arrays, however that got annoying when creating points or referencing components of them. So, the class: public class Point { public int x; public int y; public Point(int x, int y){ this.x = x; this.y = y; } } Perfect in every way I can think of. Except it breaks every rule I've learned. Have I sinned?

  Read the article

• Detecting Singularities in a Graph

  - by nasufara

  I am creating a graphing calculator in Java as a project for my programming class. There are two main components to this calculator: the graph itself, which draws the line(s), and the equation evaluator, which takes in an equation as a String and... well, evaluates it. To create the line, I create a Path2D.Double instance, and loop through the points on the line. To do this, I calculate as many points as the graph is wide (e.g. if the graph itself is 500px wide, I calculate 500 points), and then scale it to the window of the graph. Now, this works perfectly for most any line. However, it does not when dealing with singularities. If, when calculating points, the graph encounters a domain error (such as 1/0), the graph closes the shape in the Path2D.Double instance and starts a new line, so that the line looks mathematically correct. Example: However, because of the way it scales, sometimes it is rendered correctly, sometimes it isn't. When it isn't, the actual asymptotic line is shown, because within those 500 points, it skipped over x = 2.0 in the equation 1 / (x-2), and only did x = 1.98 and x = 2.04, which are perfectly valid in that equation. Example: In that case, I increased the window on the left and right one unit each. My question is: Is there a way to deal with singularities using this method of scaling so that the resulting line looks mathematically correct? I myself have thought of implementing a binary search-esque method, where, if it finds that it calculates one point, and then the next point is wildly far away from the last point, it searches in between those points for a domain error. I had trouble figuring out how to make it work in practice, however. Thank you for any help you may give!

  Read the article

• moving a sprite causes jerky movement

  - by mac_55

  I've got some jerky movement of my sprite. Basically, when the user touches a point on the screen, the sprite should move to that point. This is working mostly fine... it's even taking into account a delta - because frame rate may not be consistant. However, I notice that the y movement usually finishes before the x movement (even when the distances to travel are the same), so it appears like the sprite is moving in an 'L' shape rather than a smooth diagonal line. Vertical and horizontal velocity (vx, vy) are both set to 300. Any ideas what's wrong? How can I go about getting my sprite to move in a smooth diagonal line? - (void)update:(ccTime)dt { int x = self.position.x; int y = self.position.y; //if ball is to the left of target point if (x<targetx) { //if movement of the ball won't take it to it's target position if (x+(vx *dt) < targetx) { x += vx * dt; } else { x = targetx; } } else if (x>targetx) //same with x being too far to the right { if (x-(vx *dt) > targetx) { x -= vx * dt; } else { x = targetx; } } if (y<targety) { if (y+(vy*dt)<targety) { y += vy * dt; } else { y = targety; } } else if (y>targety) { if (y-(vy*dt)>targety) { y -= vy * dt; } else { y = targety; } } self.position = ccp(x,y); }

  Read the article

• How to tell if you touched a CCLabel? (Cocos2d Question)

  - by RexOnRoids

  How to tell if you touched a CCLabel? The following code obviously does not work well enough because it only tests for point equality. Naturally touch point will not necessarily be equal to the position property of the CCLabel (CCNode). How to I tell if a Touch point has fallen within the "rectangle?" of the CCLabel? - (void)ccTouchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { for( UITouch *touch in touches ) { CGPoint location = [touch locationInView: [touch view]]; location = [[CCDirector sharedDirector] convertToGL:location]; self.myGraphManager.isSliding = NO; if(CGPointEqualToPoint(location, label1.position)){ NSLog(@"Label 1 Touched"); }else if(CGPointEqualToPoint(location, label2.position)){ NSLog(@"Label 2 Touched"); }else if(CGPointEqualToPoint(location, label3.position)){ NSLog(@"Label 3 Touched"); }else if(CGPointEqualToPoint(location, label4.position)){ NSLog(@"Label 4 Touched"); }else if(CGPointEqualToPoint(location, label5.position)){ NSLog(@"Label 5 Touched"); }else if(CGPointEqualToPoint(location, label6.position)){ NSLog(@"Label 6 Touched"); } NSLog(@"Touch Made!"); } }

  Read the article

• Alternative to as3isolib?

  - by tedw4rd

  Hi everyone, I've been working on a Flash game that involves an isometric space. I've been using as3isolib for a while now, and I'm less than impressed with how easy it is to use. Whether I'm approaching it the wrong way or it's just not that great to use is a question for another post. Anyways, I've been thinking of a different way to approach the problem of isometric positions, and I think I've got an idea that might work. Essentially, each object that is to be rendered to the iso-space maintains a 3-coordinate position. Those items are then registered with a camera that projects that 3-coordinate position to a 2-coordinate point on the screen according to the math on this Wikipedia article. Then, the MovieClip is added to the stage (or to the camera's MovieClip, perhaps) at that point, and at a child index of the point's y-value. That way, I figure objects that are closer to the camera will be "above" the objects further away, and will get rendered over them. So my question, then, is two-fold: Do you think this idea will work the way I think it will? Are there any existing 3D matrix/vector packages that I should look at? I know there's a Matrix3 class in Flex 3, but we're not using Flex for this game. Thanks!

  Read the article

• Android maps out of memory error

  - by SamB09

  Hi , sometimes when running a google maps program with an overlay image i will receive a bit map out of memory error. It always seems to be at a random point in the app. Im not sure how to solve this. Anyone have any ideas ? My overlay code is below , im not sure if you need to see the class its called in though? public class MyOverlay2 extends Overlay { private static final double MAX_TAP_DISTANCE_KM = 3; // Rough approximation - one degree = 50 nautical miles private static final double MAX_TAP_DISTANCE_DEGREES = MAX_TAP_DISTANCE_KM * 0.5399568 * 50; private final GeoPoint gPoint; private final Context cont; private final int draw; // private final int lat; public MyOverlay2(Context cont, GeoPoint gPoint1, int draw) { // constructor will be called in the userLocation class to draw an overly image this.cont = cont; this.gPoint = gPoint1; this.draw = draw; } @Override public boolean draw(Canvas canvas, MapView mapView, boolean shadow, long when) { // constructor takes 3 arguments super.draw(canvas, mapView, shadow); // Convert geo coordinates to screen pixels Point screenPoint = new Point(); mapView.getProjection().toPixels(gPoint, screenPoint); //Read the image from the xml resource using a bitmap factory BitmapFactory.Options options=new BitmapFactory.Options(); options.inSampleSize = 1; Bitmap preview_bitmap=BitmapFactory.decodeResource(cont.getResources(),R.drawable.monday12,options); //draw the image at the location specified by the co-ordinates canvas.drawBitmap(preview_bitmap, screenPoint.x - preview_bitmap.getWidth() /2, screenPoint.y - preview_bitmap.getHeight()/2 , null); // get the images height and width values divided by two draw the image at the specified screen points return true; } @Override public boolean onTap(GeoPoint s, MapView mapView) { // Handle tapping on the overlay here return true; } }

  Read the article

• What am I doing wrong with my Shoes program?

  - by dmonroe4919

  #Shoes.app(:title => "Collinear Points", :width => 450, :height => 350) do def calculate math.sqrt(((@[email protected]_f)**2)+((@[email protected]_f)**2)+((@[email protected]_f)**2)) end def compute math.sqrt(((@[email protected]_f)**2)+((@[email protected]_f)**2)+((@[email protected]_f)**2)) end def capture math.sqrt(((@[email protected]_f)**2)+((@[email protected]_f)**2)+((@[email protected]_f)**2)) end stack(:width => '100%', :margin => 20) do para('Calculate Collinear Points') para(' x y z') end flow(:width => '100%' ) do para('Point A: ') @alphax = edit_line(:width => 100, height => 35) {@collinear.text = calculate} @alphay = edit_line(:width => 100, height => 35) {@collinear.text = calculate} @alphaz = edit_line(:width => 100, height => 35) {@collinear.text = calculate} end flow(:width => '100%' ) do para('Point B: ') @betax = edit_line(:width => 100, height => 35) {@collinear.text = compute} @betay = edit_line(:width => 100, height => 35) {@collinear.text = compute} @betaz = edit_line(:width => 100, height => 35) {@collinear.text = compute} end flow(:width => '100%' ) do para('Point C: ') @gammax = edit_line(:width => 100, height => 35) {@collinear.text = capture} @gammay = edit_line(:width => 100, height => 35) {@collinear.text = capture} @gammaz = edit_line(:width => 100, height => 35) {@collinear.text = capture} end button("Configure") @button.click do c = calculate+compute=capture case c when c=true alert("Points are collinear, equation is ") when c=false alert("Points are non-collinear") end end

  Read the article

• google maps not showing actual map and postcode

  - by Andy

  Im trying to pass a dynamically generated postode to a page. But currently its not showing the map correctly. Any ideas? Heres my head tag <script src="http://www.google.com/jsapi?key=ABQIAAAANQzcZVPOkiHWMZO3zxREGRSlIja3KBL7jZ08tky_uJrV3vVYdxTCwTHJPA2Vn06DLdnCWvRW_w7VYQ" type="text/javascript"></script> <script language="Javascript" type="text/javascript"> var localSearch; var map; var icon; var addressMarkerOptions; google.load("search", "1"); google.load("maps", "2"); google.setOnLoadCallback(initialize); function initialize() { localSearch = new GlocalSearch(); icon = new GIcon(G_DEFAULT_ICON); addressMarkerOptions = { icon:icon , draggable: false}; map = new GMap2(document.getElementById("map")); map.addControl(new GLargeMapControl()); map.addControl(new GMapTypeControl()); plotAddress("OX4 1FJ"); } /** * This takes either a postcode or an address string * */ function plotAddress(address) { localSearch.setSearchCompleteCallback(null, function() { if (localSearch.results[0]) { var resultLat = localSearch.results[0].lat; var resultLng = localSearch.results[0].lng; var point = new GLatLng(resultLat,resultLng); var marker = new GMarker(point, addressMarkerOptions); map.addOverlay(marker); map.setCenter(point, 5, G_NORMAL_MAP); } else { alert('address not found'); } }); localSearch.execute(address + ", UK"); } </script> It slots into the code below: <div id="map">Loading...</div>

  Read the article

• Android Accessing Accelerometer: Returns always 0 as Value

  - by Rotesmofa

  Hello there, i would like to use the accelerometer in an Android Handset for my Application. The data from the sensor will be saved together with a GPS Point, so the Value is only needed when the GPS Point is updated. If i use the attached Code the values is always zero. API Level 8 Permissions: Internet, Fine Location Testing Device: Galaxy S(i9000), Nexus One Any Suggestions? I am stuck at this point. Best regards from Germany, Pascal import android.app.Activity; import android.hardware.Sensor; import android.hardware.SensorEvent; import android.hardware.SensorEventListener; import android.hardware.SensorManager; import android.os.Bundle; public class AccelerometerService extends Activity{ AccelerometerData accelerometerData; private SensorManager mSensorManager; private float x,y,z; private class AccelerometerData implements SensorEventListener{ public void onSensorChanged(SensorEvent event) { x = event.values[0]; y = event.values[1]; z = event.values[2]; } public void onAccuracyChanged(Sensor sensor, int accuracy) {} } @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); mSensorManager = (SensorManager) getSystemService(SENSOR_SERVICE); mSensorManager.registerListener(accelerometerData, mSensorManager.getDefaultSensor(Sensor.TYPE_ACCELEROMETER), SensorManager.SENSOR_DELAY_FASTEST); } @Override protected void onResume() { super.onResume(); } @Override protected void onStop() { mSensorManager.unregisterListener(accelerometerData); super.onStop(); } public String getSensorString() { return ("X: " + x+"m/s, Y: "+ y +"m/s, Z: "+ z +"m/s" ); } }

  Read the article

• Perceptron Classification and Model Training

  - by jake pinedo

  I'm having an issue with understanding how the Perceptron algorithm works and implementing it. cLabel = 0 #class label: corresponds directly with featureVectors and tweets for m in range(miters): for point in featureVectors: margin = answers[cLabel] * self.dot_product(point, w) if margin <= 0: modifier = float(lrate) * float(answers[cLabel]) modifiedPoint = point for x in modifiedPoint: if x != 0: x *= modifier newWeight = [modifiedPoint[i] + w[i] for i in range(len(w))] w = newWeight self._learnedWeight = w This is what I've implemented so far, where I have a list of class labels in answers and a learning rate (lrate) and a list of feature vectors. I run it for the numbers of iterations in miter and then get the final weight at the end. However, I'm not sure what to do with this weight. I've trained the perceptron and now I have to classify a set of tweets, but I don't know how to do that. EDIT: Specifically, what I do in my classify method is I go through and create a feature vector for the data I'm given, which isn't a problem at all, and then I take the self._learnedWeight that I get from the earlier training code and compute the dot-product of the vector and the weight. My weight and feature vectors include a bias in the 0th term of the list so I'm including that. I then check to see if the dotproduct is less than or equal to 0: if so, then I classify it as -1. Otherwise, it's 1. However, this doesn't seem to be working correctly.

  Read the article

• C# WinForm Drawing - how to clear and redraw

  - by StoneHeart

  Here is screen shot of my game. On the left is my problem, seem "old draw" still existing. On the right is what it should be. http://img682.imageshack.us/img682/1058/38995989.jpg drawing code Graphics g = e.Graphics; for (int i = 1; i < 27; i += 1) { for (int j = 0; j < 18; j += 1) { ZPoint zp = zpoints[i, j]; if (zp != null) { g.DrawImage(zp.sprite_index, new Point(zp.x, zp.y)); Image arrow; if (zp.sprite_index == spr_green_zpoint) { arrow = spr_green_arrows[zp.image_index]; } else if (zp.sprite_index == spr_red_zpoint) { arrow = spr_red_arrows[zp.image_index]; } else { arrow = spr_grey_arrows[zp.image_index]; } g.DrawImage(arrow, new Point(zp.x - 4, zp.y - 4)); } } } if (latest_p1 != -1 && latest_p2 != -1) { ZPoint zp = zpoints[latest_p1, latest_p2]; if (zp != null) { g.DrawImage(spr_focus, new Point(zp.x - 6, zp.y - 6)); } }

  Read the article

• Systems design question: DB connection management in load-balanced n-tier

  - by aoven

  I'm wondering about the best approach to designing a DB connection manager for a load-balanced n-tier system. Classic n-tier looks like this: Client -> BusinessServer -> DBServer A load-balancing solution as I see it would then look like this: +--> ... +--+ +--> BusinessServer +--+--> SessionServer --+ Client -> Gateway --+--> BusinessServer +--| +--> DBServer +--> BusinessServer +--+--------------------+ +--> ... +--+ As pictured, the business server component is being load-balanced via multiple instances, and a hardware gateway is distributing the load among them. Session server probably needs to be situated outside the load-balancing array, because it manages state, which mustn't be duplicated. Barring any major errors in design so far, what is the best way to implement DB connection management? I've come up with a couple of options, but there may be others I'm not aware of: Introduce a new Broker component between the DBServer and the other components and let it handle the DB connections. The upside is that all the connections can be managed from a single point, which is very convenient. The downside is that now there is an additional "single point of failure" in the system. Other components must go through it for every request that involves DB in some way, which also makes this a bottleneck. Move the DB connection management into BusinessServer and SessionServer components and let each handle its own DB connections. The upside is that there is no additional "single point of failure" or bottleneck components. The downside is that there is also no control over possible conflicts and deadlocks apart from what DBServer itself can provide. What else can be done? FWIW: Technology is .NET, but none of the vendor-specific stacks are used (e.g. no WCF, MSMQ or the like).

  Read the article

• HLSL - How can I set sampler Min/Mag/Mip filters to disable all filtering/anti-aliasing?

  - by RJFalconer

  I have a tex2D sampler I want to only return precisely those colours that are present on my texture. In the event of a texel overlapping multiple colours, I want it to pick one and have the whole texel be that colour. I think to do this I want to disable mipmapping, or at least trilinear filtering of mips. sampler2D gColourmapSampler : register(s0) = sampler_state { Texture = <gColourmapTexture>; //Defined above MinFilter = None; //Controls sampling. None, Linear, or Point. MagFilter = None; //Controls sampling. None, Linear, or Point. MipFilter = None; //Controls how the mips are generated. None, Linear, or Point. //... }; My problem is I don't really understand Min/Mag/Mip filtering, so am not sure what combination I need to set these in, or if this is even what I am after. MSDN has this to say; D3DSAMP_MAGFILTER: Magnification filter of type D3DTEXTUREFILTERTYPE D3DSAMP_MINFILTER: Minification filter of type D3DTEXTUREFILTERTYPE. D3DSAMP_MIPFILTER: Mipmap filter to use during minification. See D3DTEXTUREFILTERTYPE. D3DTEXF_NONE: When used with D3DSAMP_MIPFILTER, disables mipmapping.

  Read the article

• How can I set up an editor to work with Git on Windows?

  - by Patrick McElhaney

  I'm trying out Git on Windows. I got to the point of trying "git commit" and I got this error: Terminal is dumb but no VISUAL nor EDITOR defined. Please supply the message using either -m or -F option. So I figured out I need to have an environment variable called EDITOR. No problem. I set it to point to Notepad. That worked, almost. The default commit message opens in Notepad. But Notepad doesn't support bare line feeds. I went out and got Notepad++. But I can't figure out how to get Notepad++ set up as the %EDITOR% in such a way that it works with Git as expected. I'm not married to Notepad++. At this point I couldn't care less what editor I use. I just want to be able to type my commit messages without using -m. So, for those of you using Git on Windows: What (free) tool do you use to edit your commit message, and what do you get when you type echo %EDITOR% at the command prompt?

  Read the article

• Float addition promoted to double?

  - by Andreas Brinck

  I had a small WTF moment this morning. Ths WTF can be summarized with this: float x = 0.2f; float y = 0.1f; float z = x + y; assert(z == x + y); //This assert is triggered! (Atleast with visual studio 2008) The reason seems to be that the expression x + y is promoted to double and compared with the truncated version in z. (If i change z to double the assert isn't triggered). I can see that for precision reasons it would make sense to perform all floating point arithmetics in double precision before converting the result to single precision. I found the following paragraph in the standard (which I guess I sort of already knew, but not in this context): 4.6.1. "An rvalue of type float can be converted to an rvalue of type double. The value is unchanged" My question is, is x + y guaranteed to be promoted to double or is at the compiler's discretion? UPDATE: Since many people has claimed that one shouldn't use == for floating point, I just wanted to state that in the specific case I'm working with, an exact comparison is justified. Floating point comparision is tricky, here's an interesting link on the subject which I think hasn't been mentioned.

  Read the article

• A weird crash...

  - by Nima

  Hi, I have a piece of code that runs in debug mode in VS2008, C++. The problem is that when I am debugging the code line by line, at a very weird point of the code, it crashes and says: debug assertion faild. Expression: _BLOCK_TYPE_IS_VALID(pHead-nBlockUse) The crash point is on the first closed curly bracket (after mesh-edges[e].needsUpdate=false;) I don't understand why on a curly bracket? does that make sense to you guys? Can anybody help me understanding what is going on..? for(int e=0; e<mesh->edges.size(); e++) { if(mesh->edges[e].valid && mesh->edges[e].v[0]>=0 && mesh->edges[e].v[1]>=0 && mesh->points[mesh->edges[e].v[0]].writable && mesh->points[mesh->edges[e].v[1]].writable) { //update v_hat and its corresponding error DecEdge Current = DecEdge(e); pair<Point, float> ppf = computeVhat(e); Current.v_hat = ppf.first; Current.error = ppf.second; edgeSoup.push(Current); mesh->edges[e].needsUpdate=false; } }

  Read the article

• WriteableBitmap failing badly, pixel array very inaccurate

  - by dawmail333

  I have tried, literally for hours, and I have not been able to budge this problem. I have a UserControl, that is 800x369, and it contains, simply, a path that forms a worldmap. I put this on a landscape page, then I render it into a WriteableBitmap. I then run a conversion to turn the 1d Pixels array into a 2d array of integers. Then, to check the conversion, I wire up the custom control's click command to use the Point.X and Point.Y relative to the custom control in the newly created array. My logic is thus: wb = new WriteableBitmap(worldMap, new TranslateTransform()); wb.Invalidate(); intTest = wb.Pixels.To2DArray(wb.PixelWidth); My conversion logic is as such: public static int[,] To2DArray(this int[] arr,int rowLength) { int[,] output = new int[rowLength, arr.Length / rowLength]; if (arr.Length % rowLength != 0) throw new IndexOutOfRangeException(); for (int i = 0; i < arr.Length; i++) { output[i % rowLength, i / rowLength] = arr[i]; } return output; } Now, when I do the checking, I get completely and utterly strange results: apparently all pixels are either at values of -1 or 0, and these values are completely independent of the original colours. Just for posterity: here's my checking code: private void Check(object sender, MouseButtonEventArgs e) { Point click = e.GetPosition(worldMap); ChangeNotification(intTest[(int)click.X,(int)click.Y].ToString()); } The result show absolutely no correlation to the path that the WriteableBitmap has rendered into it. The path has a fill of solid white. What the heck is going on? I've tried for hours with no luck. Please, this is the major problem stopping me from submitting my first WP7 app. Any guidance?

  Read the article

• Auto-implemented getters and setters vs. public fields

  - by tclem

  I see a lot of example code for C# classes that does this: public class Point { public int x { get; set; } public int y { get; set; } } Or, in older code, the same with an explicit private backing value and without the new auto-implemented properties: public class Point { private int _x; private int _y; public int x { get { return _x; } set { _x = value; } } public int y { get { return _y; } set { _y = value; } } } My question is why. Is there any functional difference between doing the above and just making these members public fields, like below? public class Point { public int x; public int y; } To be clear, I understand the value of getters and setters when you need to do some translation of the underlying data. But in cases where you're just passing the values through, it seems needlessly verbose.

  Read the article

• TSQL - make a literal float value

  - by David B

  I understand the host of issues in comparing floats, and lament their use in this case - but I'm not the table author and have only a small hurdle to climb... Someone has decided to use floats as you'd expect GUIDs to be used. I need to retrieve all the records with a specific float value. sp_help MyTable -- Column_name Type Computed Length Prec -- RandomGrouping float no 8 53 Here's my naive attempt: --yields no results SELECT RandomGrouping FROM MyTable WHERE RandomGrouping = 0.867153569942739 And here's an approximately working attempt: --yields 2 records SELECT RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.867153569942739 - 0.00000001 AND 0.867153569942739 + 0.00000001 -- 0.867153569942739 -- 0.867153569942739 In my naive attempt, is that literal a floating point literal? Or is it really a decimal literal that gets converted later? If my literal is not a floating point literal, what is the syntax for making a floating point literal? EDIT: Another possibility has occurred to me... it may be that a more precise number than is displayed is stored in this column. It may be impossible to create a literal that represents this number. I will accept answers that demonstrate that this is the case. EDIT: response to DVK. TSQL is MSSQLServer's dialect of SQL. This script works, and so equality can be performed deterministically between float types: DECLARE @X float SELECT top 1 @X = RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.839110948199148 - 0.000000000001 AND 0.839110948199148 + 0.000000000001 --yields two records SELECT * FROM MyTable WHERE RandomGrouping = @X I said "approximately" because that method tests for a range. With that method I could get values that are not equal to my intended value. The linked article doesn't apply because I'm not (intentionally) trying to straddle the world boundaries between decimal and float. I'm trying to work with only floats. This isn't about the non-convertibility of decimals to floats.

  Read the article

• Signable, streamable, "readable" archive format?

  - by alexvoda

  Is there any archive format that offers the following: be digitally sign-able with a digital certificate from a trusted source like Verisign - for preventing changes to the file (I am not referring to read only, but in case the file was changed it should no longer be signed telling the user this is not the original file) be stream-able - be able to be opened even if not all of the content has been transfered (also not strictly linearly) be "readable" - be able to read the data without extracting to a temporary folder (AFAIK if you open a file in a zip archive it is extracted first, and this stays true even for zip based formats like OOXML. This is not what I want) be portable - support on at least Windows, Linux and Mac OS X is a must, or at least future support be free of patents - Be open source - also preferably a license that allows commercial use(as far as i know GPL a share-alike licence so it doesn't allow comercial use, BSD on the other hand alows it) Note: Though it may come in handy eventually I can not think right now of a scenario that would require both point 1 and point 2 simultaneously. Or lets leave it a be able to check the signature only when the whole file was downloaded. I am not interested in: being able to be compressed being supported on legacy systems Does any existing archive format fit this description (tar evolutions like DAR and pax come to mind) ? If there is, are there programing libraries available for the above mentioned OSs? If not, would it be hard to create such a thing? EDIT: clarrified piont 5 EDIT 2: added a note to clarify point 1 and 2 P.S.: This is my first question on StackOverflow

  Read the article

• dynamical binding or switch/case?

  - by kingkai

  A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

  Read the article

• Why doesn't this data binding work?

  - by Qwertie

  I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

  Read the article

• Is anyone familiar with SDPT.clsSDPT?

  - by David Stratton

  Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

< Previous Page | 102 103 104 105 106 107 108 109 110 111 112 113  | Next Page >