Search Results

Search found 12376 results on 496 pages for 'active pattern'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 109/496 | < Previous Page | 105 106 107 108 109 110 111 112 113 114 115 116  | Next Page >

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • LDAP Query with sub result

    - by StefanE
    I have been banging my head for quite a while with this and can't get it to work. I have a LDAP Query I do have working in AD Users and Computers but dont know how to do it programatically in C#. Here are my LDAP Query that works fine in the AD Tool: (memberOf=CN=AccRght,OU=Groups,OU=P,OU=Server,DC=mydomain,DC=com)(objectCategory=user)(objectClass=user)(l=City) I have used this code to get the user accounts to get members of CN=AccRght but I'm not succeeding on limiting users belonging to a specific city. public StringCollection GetGroupMembers(string strDomain, string strGroup) { StringCollection groupMemebers = new StringCollection(); try { DirectoryEntry ent = new DirectoryEntry("LDAP://DC=" + strDomain + ",DC=com"); DirectorySearcher srch = new DirectorySearcher("(CN=" + strGroup + ")"); SearchResultCollection coll = srch.FindAll(); foreach (SearchResult rs in coll) { ResultPropertyCollection resultPropColl = rs.Properties; foreach( Object memberColl in resultPropColl["member"]) { DirectoryEntry gpMemberEntry = new DirectoryEntry("LDAP://" + memberColl); System.DirectoryServices.PropertyCollection userProps = gpMemberEntry.Properties; object obVal = userProps["sAMAccountName"].Value; if (null != obVal) { groupMemebers.Add(obVal.ToString()); } } } } catch (Exception ex) { Console.Write(ex.Message); } return groupMemebers; } Thanks for any help!

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • need help passing multiple variables from foreach loop to test in switch case statement

    - by Brad
    $list_of_groups = array("FACULTY","STAFF"); foreach ($list_of_groups as $i => $group) { $user_in_group = $adldap->user_ingroup($username,$group); print "<h2>Group: ".$group." user in group? ".$user_in_group."</h2>"; // if 1, means yes } Need to print run the appropriate function based on what returns true. There are user's that are members of both FACULTY and STAFF groups, so I want to check for those users and display the appropriate content for them. So if the user is both faculty and staff, then display this, if they are only of staff, display that, same for faculty, might not make sense, but I will write out some code "in theory" that will help you understand what I am trying to do switch(Get group membership of user) { case "FACULTY": print "Faculty group member"; break; case "STAFF": print "Staff group member"; break; case "FACULTY and STAFF": print "Member of both faculty and staff"; break; } I am unsure on how it will check if they are members of both groups and run that thru the case statement to display the appropriate message. The foreach look currently runs thru every group the user belongs to, prints out the ones from the $list_of_groups and the number 1 to the right of it, signifying they belong to it. The problem I have is trying to use that information to run thru the case statement, I am unsure of how to go about that. This is what it prints out for the user currently passed thru the foreach loop: Group: FACULTY user in group? 1 Group: STAFF user in group? 1 Any help is appreciated.

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • System.DirectoryServices.AccountManagement not working on the server

    - by mlsteeves
    I am using System.DirectoryServices.AccountManagement to find the logged-in user's AD entry. It is working great in the VS2008 WebDev server on developers machines. But when we installed the code on the development server (windows server 2008), we get an access error. Both the developer's machine and the development server are members of the same domain. We have Impersonation turned on, so we are connecting to AD with the same user credentials. What are we missing here? Why is it working on the developer's machine, but not the development server? The actual exception that we were receiving was "An operations error occurred".

    Read the article

  • Does DefaultAppPool run with special elevated privilegs on IIS?

    - by Leeks and Leaks
    I'm running a piece of code within a web page that queries the IIS metabase using ADSI. The code is as simple as this: DirectoryEntry iisNode = new DirectoryEntry("/LM/W3SVC/1/ROOT/MyAspWebsite-1-128886021498831845"); foreach (DirectoryEntry de in iisNode.Parent.Children) { System.Console.WriteLine(de.Name); } This works fine when I run the page/site under the DefaultAppPool on IIS7/W2K8. However when I create my own app pool and leave the properties the same as the default app pool, this code fails with the following error: Caught: System.Runtime.InteropServices.COMException Failed to parse virtual directory: /LM/W3SVC/1/ROOT/MyAspWebsite-1-128889542757187500 System.Runtime.InteropServices.COMException (0x80070005): Access is denied. What special privileges does the DefaultAppPool have? I don't see any documented. I need this to work in non default app pools, but without giving the entire worker process elevated privileges. I've also tried using the username and password parameters of the DirectoryEntry constructor, by using the Admin on the machine that IIS7 is running on, but that didn't change anything. I'll also note that this works fine on IIS6 and W2K3. Any help is appreciated.

    Read the article

  • Unlocking Locked Out accounts using PowerShell (not with Quest AD cmdlets)

    - by Jonny
    I'm writing a GUI tool using PowerShell that is able to do most AD related tasks with just a user name and button click. I've done all the usual ones (Create / Remove Users, Create / Remove Security & Distribution Groups, Resetting Passwords, etc) but can't find away of unlocking a "Locked Out" account. I'm trying to do this without using Quest AD cmdlets as I want a more stand alone solution. So I'm wondering whether is possible with plain PowerShell (1.0 or 2.0) in a Windows 2003 Domain. Many thanks.

    Read the article

  • Use default credentials in order to call DirectoryEntry

    - by Copeleto
    Hi, I am working in a Login page and teh logic is like - try { DirectoryEntry LDAPLogin = new DirectoryEntry(ConfigurationSettings.AppSettings ["LDAPPath"].ToString(), Usuario, Txt_Contrasenia.Text.ToString()); if (LDAPLogin.NativeGuid != LDAPLogin.Name) ValidarGrupo(); } catch (Exception exc) { Label_Info.Text = "Sus credenciales no son validas: " + Usuario.ToString() + " " + exc.Message; } If the user enters the rights credentials I call a method ValidarGrupo that implements a lookup in the AD for a group of the user I would like to replace the username and password with UseDefaultCredentials in order to avoid that the user has to enter the username and password and the Login pages use the credentials of the user that is login on the machine.

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • Assembly reference from ASP.NET App_Code directory

    - by Gerald Schneider
    I have trouble getting a custom ObjectDataSource for an asp:ListView control to work. I have the class for the DataSource in the App_Code directory of the web application (as required by the asp:ListView control). using System; using System.Collections.Generic; using System.ComponentModel; using System.Configuration; using System.Data; using System.Data.Common; using System.Web; using System.DirectoryServices; [DataObject] public class UsersDAL { [DataObjectMethod(DataObjectMethodType.Select)] public List<User> LoadAll(int startIndex, int maxRows, string sortedBy) { List<User> users = new List<User>(); DirectoryEntry entry; return users; } } As soon as I add using System.DirectoryServices; the page crashes with this message: Compiler Error Message: CS0234: The type or namespace name 'DirectoryServices' does not exist in the namespace 'System' (are you missing an assembly reference?) Without the usage of System.DirectoryServices the page loads without problems. The reference is there, it is working in classes outside the App_Code directory.

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 105 106 107 108 109 110 111 112 113 114 115 116  | Next Page >