Search Results

Search found 4929 results on 198 pages for 'character'.

Page 11/198 | < Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >

  • How to keep columns labels when numeric convert to character

    - by stata
    a<- data.frame(sex=c(1,1,2,2,1,1),bq=factor(c(1,2,1,2,2,2))) library(Hmisc) label(a$sex)<-"gender" label(a$bq)<-"xxx" str(a) b<-data.frame(lapply(a, as.character), stringsAsFactors=FALSE) str(b) When I covert dataframe a columns to character,the columns labels disappeared.My dataframe have many columns.Here as an example only two columns. How to keep columns labels when numeric convert to character? Thank you!

    Read the article

  • textbox character countdown asp.net

    - by Ugene
    i have many textboxes on a form and all textboxes require to have a character limit / character countdown (50 character left of 150), what is the best way to achieve this and can anyone please provide code to implement. Much Grateful Thanks

    Read the article

  • c# logic to get the first non-repeating(distinct) character from the string

    - by NoviceToDotNet
    In c# i want to create logic that if i a string like abcabda is passed to a method then it should return first non repeative character from string like in above it should return c. i am unable to convert a string to array of character then how to make comparison of each array character to the string and return the first non repeative character. CanI make it like this? class A { static void main() { A a=new A(); char ch=a.m1(abcabd); } } class B { char m1(string s) { string s1=s; char[] ch1=new char[s.length]; for(int x=0; x<s.length;x++) { ch1[x]=s[x]; } for(int x=0; x<s.length; x++) { for(int y=0; y<s.lenth; y++) { if(s[x]=ch1[y]) { /// here i am confused how to create logic for comparison please let me know // and how to return the character } } } } }

    Read the article

  • Why are prefab customizations being applied to only a single character? [on hold]

    - by m0rgul
    I've built my (networked) game to the point where I have a room, some characters and a character customization screen. In the character customization screen I get to chose gender, chose from three different wardrobe options and assign custom colors to these wardrobe items. Then I use a custom object to store these options, serialize them and store them in PlayerPrefs, then load the next scene and apply them to my chosen character in this scene. Then I go and spawn some more characters, customize them, etc. The problem is that my character is always customized, but all other characters in the scene are default copies of the prefab. The prefabs themselves are a generic male and a generic female, both with three different wardrobes to chose from (they are included in the prefab). When I spawn my character, I go to the saved options in PlayerPrefs, destroy the two discarded wardrobes, apply color to my chosen wardrobe and then spawn the character. How would it be possible to make the other characters also show up in their customized form rather than just the generic prefab (which shows all three wardrobes at the same time)?

    Read the article

  • Can't Type Tilde character in Mac OS X

    - by Brock Woolf
    Hi this is a new problem that I did not have a few weeks ago. I have a Logitech Illuminated Keyboard running on Mac OS X 10.6 (Snow Leopard). The problem is that I cannot type a tilde. Instead when I press the tilde I get this character: §§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§§ I cannot for the life of me figure this out, except that I vaguely remember I can asked to redetect the Mac keyboard layout for this keyboard and I think i chose the wrong one. Now I get this weird character when pressing tilde. How can I fix this? Or how can I redetect this keyboard layout? Thanks.

    Read the article

  • Unable to write into character device file in Ubuntu

    - by Surjya Narayana Padhi
    I just written a linux character driver. I created one character device file named X. I can see that file in /dev folder. Now I want to do some read/write operation into this file. I opened the filed in VI editor and write some text into it. I used :wq and exited. It didn't show any error. Now when I do cat on that same file I am not able to see any content. I tried it several times. The same situation. Please let me know If I am doing something wrong....

    Read the article

  • Import PDF in Inkscape without per character spacing

    - by Morinar
    I have a PDF form I imported into Inkscape. It did a pretty great job of created an SVG from it, however it appears to have given per character x coordinates to each tspan in every text block. I'm not sure, but I think this is making the FOP render that our software does ridiculously slow (running it through other renderers like IBEX it seems fine). I'd like to import it but have it not do per character positions. I can't seem to find any sort of PDF importing options at all. Does such a thing exist? Or is there perhaps some other, better freeware application I could use to generate the SVG from the PDF then use Inkscape to do adjustments from there? Thanks in advance.

    Read the article

  • Can't paste symbol from Character viewer in Mac to Photoshop

    - by Cristian
    This is extremely annoying: I want to paste in a special symbol in Photoshop using the Character Viewer in Mac. I understand that there are some fonts that do not support these symbols, but when I paste this symbol in Photoshop, it appears as an unknown symbol (similar to this: ? ), and I can't even change the font (to anything), it skips back to Myriad Pro. I found a stupid solution to this: using the arrows to change fonts - this seems to work, but still Photoshop doesn't show all fonts that are available in Character Viewer under Font Variation Have you experienced this? I can't remember if it was the same with Windows, but I know there were some bugs too.

    Read the article

  • How Can I Find Nth Character in Notepad++?

    - by Teno
    From the following text, I'd like to find a n th character. For example, the 10th character is "u"`. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Pellentesque ac arcu sit amet lorem mollis dignissim ac ut metus. Aliquam sed nulla ut risus sollicitudin luctus vitae eget quam. Nam velit diam, ullamcorper id tempus ac, iaculis sed arcu. According to this page, \w{10,} would work but when I type it in the Find what field of the Findwindow, it produces the message, 'Can't find the text: "\w{10,}"' Thanks in advance.

    Read the article

  • Excel: Change all cells with one character to something else

    - by Allan
    Is there a formula I can use that will change all cells with one character to something else? For example, I have cells with single letters and no matter what the letter is I want that cell to contain the word Member. More Info: I get spreadsheets that contain, up to 40,000 rows. Column B will have names in the cells. Every once in a while a column will just have an initial instead of a full name. I'm looking for a way to change every single cell containing only one single character to the word "Member." The cells that need to change could be any letter but no matter what that letter is, if it's just a single letter in a cell, it needs to change to the word "Member."

    Read the article

  • Best practice for organizing/storing character/monster data in an RPG?

    - by eclecto
    Synopsis: Attempting to build a cross-platform RPG app in Adobe Flash Builder and am trying to figure out the best class hierarchy and the best way to store the static data used to build each of the individual "hero" and "monster" types. My programming experience, particularly in AS3, is embarrassingly small. My ultra-alpha method is to include a "_class" object in the constructor for each instance. The _class, in turn, is a static Object pulled from a class created specifically for that purpose, so things look something like this: // Character.as package { public class Character extends Sprite { public var _strength:int; // etc. public function Character(_class:Object) { _strength = _class._strength; // etc. } } } // MonsterClasses.as package { public final class MonsterClasses extends Object { public static const Monster1:Object={ _strength:50, // etc. } // etc. } } // Some other class in which characters/monsters are created. // Create a new instance of Character var myMonster = new Character(MonsterClasses.Monster1); Another option I've toyed with is the idea of making each character class/monster type its own subclass of Character, but I'm not sure if it would be efficient or even make sense considering that these classes would only be used to store variables and would add no new methods. On the other hand, it would make creating instances as simple as var myMonster = new Monster1; and potentially cut down on the overhead of having to read a class containing the data for, at a conservative preliminary estimate, over 150 monsters just to fish out the one monster I want (assuming, and I really have no idea, that such a thing might cause any kind of slowdown in execution). But long story short, I want a system that's both efficient at compile time and easy to work with during coding. Should I stick with what I've got or try a different method? As a subquestion, I'm also assuming here that the best way to store data that will be bundled with the final game and not read externally is simply to declare everything in AS3. Seems to me that if I used, say, XML or JSON I'd have to use the associated AS3 classes and methods to pull in the data, parse it, and convert it to AS3 object(s) anyway, so it would be inefficient. Right?

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • RegEx - Take all numeric characters following a text character

    - by Simon
    Given a string in the format: XXX999999v99 (where X is any alpha character and v is any numeric character and v is a literal v character) how can I get a regex to match the numeric characters following the v? So far I've got 'v\d\d' which includes the v but ideally I'd like just the numeric part. As an aside does anyone know of a tool in which you can specify a string to match and have the regex generated? Modifying an existing regex is one thing but I find starting from scratch painful! Edit: Re-reading this question I realise it reads like a homework assignment! However I can assure you it's not, the strings I'm trying to match represent product versions appended to product codes. The current code uses all sorts of substring expressions to retrieve the version part.

    Read the article

< Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >