Search Results

Search found 46865 results on 1875 pages for 'string array'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 11/1875 | < Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >

  • Change array that might contain None to an array that contains "" in python

    - by vy32
    I have a python function that gets an array called row. Typically row contains things like: ["Hello","goodbye","green"] And I print it with: print "\t".join(row) Unfortunately, sometimes it contains: ["Hello",None,"green"] Which generates this error: TypeError: sequence item 2: expected string or Unicode, NoneType found Is there an easy way to replace any None elements with ""?

    Read the article

  • passing an array structure as an array

    - by Matias
    I'm having trouble passing a structure array as a parameter of a function struct Estructure{ int a; int b; }; and a funtion Begining(Estructure &s1[]) { //modifi the estructure s1 }; and the main would be something like this int main() { Estructure m[200]; Begining(m); }; is this valid?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Reset array keys in multidimensional array

    - by nbaumann
    I've been looking around for a solution to this with no real success. I have a multidimensional array of parents and children with no limits on depth. This is generated from a database but the issue is that the item ID becomes the key using my way of arranging a flat array into a multidimensional array like so: Array( [28] => Array ( [id] => 28 [color] => #ff24e5 [name] => Personal [parent_id] => [children] => Array ( [23] => Array ( [id] => 23 [color] => #41c3a3 [name] => Shopping [parent_id] => 28 [children] => Array ( [22] => Array ( [id] => 22 [color] => #8be32b [name] => Deals [parent_id] => 23 [children] => Array ( ) ) ) ) [150] => Array ( [id] => 150 [color] => #e9a3f0 [name] => Orders [parent_id] => 28 [children] => Array ( ) ) ) ) ) What I would like, is a function that does the following: Array ( [0] => Array ( [id] => 28 [color] => #ff24e5 [name] => Personal [parent_id] => [children] => Array ( [0] => Array ( [id] => 23 [color] => #41c3a3 [name] => Shopping [parent_id] => 28 [children] => Array ( [0] => Array ( [id] => 22 [color] => #8be32b [name] => Deals [user_id] => 1 [selected] => 0 [parent_id] => 23 [children] => Array ( ) ) ) ) [1] => Array ( [id] => 150 [color] => #e9a3f0 [name] => Orders [parent_id] => 28 [children] => Array ( ) ) ) ) ) Essentially reassign keys starting from 0. I've tried numerous methods, but I'm assuming that I need to find a recursive solution and when I tried that, it destroyed my array. I was reading up on the array_walk_recursive() function, but I don't quite know what to do beyond that. Essentially, is there a way to reset numeric keys in a multidimensional array? Thanks for the help!

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • get the array with html array path

    - by antpaw
    hey, i have this path name from an input element interesse[angebote][flurfuerderfahrzeuge] as a string in my php var. now i need convert it somehow (with regex or explode()) so it looks like this: $_POST['interesse']['angebote']['flurfuerderfahrzeuge'] and the use eval() to get the value. But I'm sure there must be a much easier way do this. Any ideas? Thanks!

    Read the article

  • Remove characters after specific character in string, then remove substring?

    - by sah302
    I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • String formatting error

    - by wrongusername
    Using the code print('{0} is not'.format('That that is not')) in Python 3.1.1, I get the following error: AttributeError: 'str' object has no attribute 'format' when I delete the line Netbeans automatically inserted at the beginning: from distutils.command.bdist_dumb import format which itself causes an error of ImportError: cannot import name format What am I doing wrong here?

    Read the article

  • How to replace round bracket tag in javascript string

    - by tomaszs
    I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

    Read the article

  • How to structurally display a multi-dimensional array in PHP?

    - by Jaime Cross
    How can I display the contents of an array as follows: Company Name - Username1 - Username2 Another Company Name - Username3 The array I have created is as follows: $array[1]['company_id'] = '12'; $array[1]['company_name'] = 'ABC Company'; $array[1]['company_type'] = 'default'; $array[1]['user_id'] = '23'; $array[1]['user_name'] = 'Andrew'; $array[2]['company_id'] = '12'; $array[2]['company_name'] = 'ABC Company'; $array[2]['company_type'] = 'default'; $array[2]['user_id'] = '27'; $array[2]['user_name'] = 'Jeffrey'; $array[3]['company_id'] = '1'; $array[3]['company_name'] = 'Some Company'; $array[3]['company_type'] = 'default'; $array[3]['user_id'] = '29'; $array[3]['user_name'] = 'William'; $array[4]['company_id'] = '51'; $array[4]['company_name'] = 'My Company'; $array[4]['company_type'] = 'default'; $array[4]['user_id'] = '20'; $array[4]['user_name'] = 'Jaime';

    Read the article

  • Problem with Replacing special characters in a string

    - by Hossein
    Hi, I am trying to feed some text to a special pupose parser. The problem with this parser is that it is sensitive to ()[] characters and in my sentence in the text have quite a lot of these characters. The manual for the parser suggests that all the ()[] get replaced with \( \) \[ \]. So using str.replace i am using to attach \ to all of those charcaters. I use the code below: a = 'abcdef(1234)' a.replace('(','\(') however i get this as my output: 'abcdef\\(1234)' What is wrong with my code? can anyone provide me a solution to solve this for these characters?

    Read the article

  • Dynamic Array traversal in PHP

    - by Kristoffer Bohmann
    I want to build a hierarchy from a one-dimensional array and can (almost) do so with a more or less hardcoded code. How can I make the code dynamic? Perhaps with while(isset($array[$key])) { ... }? Or, with an extra function? Like this: $out = my_extra_traverse_function($array,$key); function array_traverse($array,$key=NULL) { $out = (string) $key; $out = $array[$key] . "/" . $out; $key = $array[$key]; $out = $array[$key] ? $array[$key] . "/" . $out : ""; $key = $array[$key]; $out = $array[$key] ? $array[$key] . "/" . $out : ""; $key = $array[$key]; $out = $array[$key] ? $array[$key] . "/" . $out : ""; return $out; } $a = Array(102=>101, 103=>102, 105=>107, 109=>105, 111=>109, 104=>111); echo array_traverse($a,104); Output: 107/105/109/111/104

    Read the article

  • PHP arrays - How to 1-dimensional array into nested multidimensional array?

    - by sombe
    When retrieving a hierarchical structure from MySQL (table with one ID column and one PARENT column signifying the hierarchical relationships), I map the result into an enumerated array as follows (for this example the numbers are arbitrary): Array ( [3] => Array ( [7] => Array () ), [7] => Array ( [8] => Array () ) ) Notice 3 is the parent of 7, and 7 is the parent of 8 (this could go on and on; and any parent could have multiple children). I wanted to shrink this array into a nested multidimensional array as follows: Array ( [3] => Array ( [7] => Array ( [8] => Array () ) ) ) That is, each NEW id is automatically assigned an empty array. Regardless, any ID's children will be pushed into their parent's array. Take a look at the following illustration for further clarification: This will probably result in a complicated recursive operation, since I always have to check whether a parent with any certain ID already exists (and if so, push the value into its array). Is there a built-in php function that can assist me with this? Do you have any idea as to how to go about constructing this? For what it's worth I'm using this to built a navigation bar in wordpress (which can contain categories, subcategories, posts... essentially anything).

    Read the article

  • Replacing substring in a string

    - by user177785
    I am uploading a image file to the server. Now after uploading the file to the server I need to rename the file with an id, but the extension of the file should be retained. Eg: if I upload the file image1.png then my server script should retain the extension .png. But I need to change the substring to some other substring (primary key of db). image1.png should be renamed to 123.png image2.jpg should be renamed to somevalue.jpg The image can be of any extension like .png, .jpg, .jpeg etc. I want to rename then in such a way that the image/file extension should be retained.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >