Search Results

Search found 8886 results on 356 pages for 'parse tree'.

Page 110/356 | < Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >

  • Error in Decompression?

    - by user595606
    I am writing a crawler for a website. Its response is gzip encoded. I am not able to parse correctly a particular field, though the decompression is successful. I am also using htmlagilitypack to parse it, the parsed value of the field is only a part of the original value as an example : I am getting only /wEWAwKc04vTCQKb86mzBwKln/PuCg== whereas the firebug shows the actual value as much longer: /wEWBgKj7IuJCgKb86mzBwKln/PuCgLT250qAtC0+8cMAvimiNYD what does the '==' at the end means? I am assuming it that its a error on decompressors behalf?

    Read the article

  • Read binary data from a MDB-file running under LAMP

    - by BusterX
    I need to be able to connect to an MDB-file in a LAMP-environment (running on Linux) and ultimately insert converted data into a Mysql db. The data I need to access is stored as a BLOB (Long Binary Data according to Access) in the MDB file. I have not yet been able to actually have a look at the data but I have been told that the BLOB consists of byte strings. Something along the lines of: 0x1c 0x10 0x27 0x00 0x00 I need to parse the byte strings and convert these to a format that is human readable. I do have access to the documentation that explains the various byte strings. So this is really two questions: How do a get access to the MDB file via PHP* (running under LAMP) and read the BLOB (I do not have access to a Windows-platform)? What would be the best way to parse the binary data (in PHP*) once I am able to connect to the MDB-file? *Or are there other methods/languages that are more appropriate?

    Read the article

  • Reverse Breath First Search in C#

    - by Ngu Soon Hui
    Anyone has a ready implementation of the Reverse Breath First Search algorithm in C#? By Reverse Breath First Search, I mean instead of searching a tree starting from a common node, I want to search the tree from the bottom and gradually converged to a common node. Let's see the below figure, this is the output of a Breath First Search: In my reverse breath first search, 9,10,11 and 12 will be the first few nodes found ( the order of them are not important as they are all first order). 5, 6, 7 and 8 are the second few nodes found, and so on. 1 would be the last node found. Any ideas or pointers?

    Read the article

  • What's the performance penalty of weak_ptr?

    - by Kornel Kisielewicz
    I'm currently designing a object structure for a game, and the most natural organization in my case became a tree. Being a great fan of smart pointers I use shared_ptr's exclusively. However, in this case, the children in the tree will need access to it's parent (example -- beings on map need to be able to access map data -- ergo the data of their parents. The direction of owning is of course that a map owns it's beings, so holds shared pointers to them. To access the map data from within a being we however need a pointer to the parent -- the smart pointer way is to use a reference, ergo a weak_ptr. However, I once read that locking a weak_ptr is a expensive operation -- maybe that's not true anymore -- but considering that the weak_ptr will be locked very often, I'm concerned that this design is doomed with poor performance. Hence the question: What is the performance penalty of locking a weak_ptr? How significant is it?

    Read the article

  • DOM: how to import nodes and give them different namespace prefix

    - by thomasrutter
    I'm familiar with the DOMDocument::importNode method for importing a tree of nodes from some other document element. However, what I was wondering is if I can automatically change the namespace prefix on a tree of nodes as I import them, that is, specify a new prefix for all nodes of that namespace. Say the nodes, in their existing document, all have names like "name", "identity", and so on. When importing them into my new document they will be alongside other namespaces, so I'd like them to appear as "nicnames:name", "nicnames:identity" and so on. I'd like to be able to change this prefix programmatically so that in another context I may be able to import them as, for instance, "myprefix:name", "myprefix:identity" depending on the document they're imported into. Can anyone help me understand how to do this? Thanks

    Read the article

  • git can I speed up committing?

    - by AndreasT
    I have a big repository in a shared folder. I use git from within a VM on that folder. Everything works nice, but the repository is big and git's searching through all directories and files when committing is slow. I cannot move this repository out of the shared folder. I tried to git add specific files and directories, but when I do git commit -m "something" it still goes off onto it's oddyssey through the directory tree. Can I do commits that ignore the rest of the tree?

    Read the article

  • How should I handle searching through byte arrays in Java?

    - by Zombies
    Preliminary: I am writting my own httpclient in Java. I am trying to parse out the contents of chunked encoding. Here is my dilema: Since I am trying to parse out chunked http transfer encoding with a gzip payload there is a mix of ascii and binary. I can't just take the http resp content and convert it to a string and make use of StringUtils since the binary data can easily contain nil characters. So what I need to do is some basic things for parsing out each chunk and its chunk length (as per chunked transfer/HTTP/1.1 spec). Are there any helpful ways of searching through byte arrays of binary/part ascii data for certain patterns (like a CR LF) (instead of just a single byte) ? Or must I write the for loops for this?

    Read the article

  • C# SQL Parameter Errors in Loops

    - by jakesankey
    Please help me out with this. I have this small application to load txt files into a sql db and it works fine with sqlite. When I ported to SQL I started getting 'parameter already declared' errors.. If anyone can help me reorganize this code, it would be great! I need to get the parameter definitions outside of the loops or something.. using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"SELECT FileName FROM Import;"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { Console.WriteLine("Connecting to SQL server..."); SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R.txt*", SearchOption.AllDirectories); insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { var FileNameExt1 = Path.GetFileName(file); cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } } FYI - the PartNumber, CMMNumber, Date, etc at the bottom are pulled from the file name and I need it in the table next to each respective record.

    Read the article

  • How do I add Objective C code to a FireBreath Project?

    - by jmort253
    I am writing a browser plugin for Mac OS that will place a status bar icon in the status bar, which users can use to interface with the browser plugin. I've successfully built a FireBreath 1.6 project in XCode 4.4.1, and can install it in the browser. However, FireBreath uses C++, whereas a large majority of the existing libraries for Mac OS are written in Objective C. In the /Mac/projectDef.make file, I added the Cocoa Framework and Foundation Framework, as suggested here and in other resources I've found on the Internet: target_link_libraries(${PROJECT_NAME} ${PLUGIN_INTERNAL_DEPS} ${Cocoa.framework} # added line ${Foundation.framework} # added line ) I reran prepmac.sh, expecting a new project to be created in XCode with my .mm files, and .m files; however, it seems that they're being ignored. I only see the .cpp and .h files. I added rules for those in the projectDef.make file, but it doesn't seem to make a difference: file (GLOB PLATFORM RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} Mac/[^.]*.cpp Mac/[^.]*.h Mac/[^.]*.m #added by me Mac/[^.]*.mm #added by me Mac/[^.]*.cmake ) Even if I add the files in manually, I get a series of compilation errors. There are about 20 of them, all related to the file NSObjRuntime.h file: Parse Issue - Expected unqualified-id Parse Issue - Unknown type name 'NSString' Semantic Issue - Use of undeclared identifier 'NSString' Parse Issue - Unknown type name 'NSString' ... ... Semantic Issue - Use of undeclared identifier 'aSelectorName' ... ... Semantic Issue - Use of undeclared identifier 'aClassName' ... It continues like this for some time with similar errors... From what I've read, these errors appear because of dependencies on the Foundation Framework, which I believe I've included in the project. I also tried clicking the project in XCode I'm to the point now where I'm not sure what to try next. People say it's not hard to use Objective C in C/C++ code, but being new to XCode and Objective C might contribute to my confusion. This is only day 4 for me in this new platform. What do I need to do to get XCode to compile the Objective C code? Please remember that I'm a little new to this, so I'd appreciate it if you leave detailed answers as opposed to the vague one-liners that are common in the firebreath tag. I'm just a little in over my head, but if you can get me past this hurdle I'm certain I'll be good to go from there. UPDATE: I edited projects/MyPlugin/CMakeLists.txt and added in the .m and .mm rules there too. after running prepmac.sh, the files are included in the project, but I still get the same compile errors. I moved all the .h files and .mm files from the Obj C code to the MyPlugin root folder and reran the prepmac.sh file. Problem still exists. Same compile errors.

    Read the article

  • Java simple data format british time

    - by DD
    Hi, I am using simple date format to allow users to specify which time zone they are sending data in: DateFormat df = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss,z"); This works fine: e.g. df.parse("2009-05-16 11:07:41,GMT"); However, if someone is always sending time in London time (i.e. taking into account daylight savings), what would be the approriate time zone String to add? e.g. this doesnt work: df.parse("2009-05-16 11:07:41,Europe/London"); Thanks.

    Read the article

  • Combining DROP USER and DROP DATABASE with SELECT .. WHERE query?

    - by zsero
    I'd like to make a very simple thing, replicate the functionality of mysql's interactive mysql_secure_installation script. My question is that is there a simple, built-in way in MySQL to combine the output of a SELECT query with the input of a DROP user or DROP database script? For example, if I'd like to drop all users with empty passwords. How could I do that with DROP USER statement? I know an obvious solution would be to run everything for example from a Python script, run a query with mysql -Bse "select..." parse the output with some program construct the drop query run it. Is there an easy way to do it in a simple SQL query? I've seen some example here, but I wouldn't call it simple: http://stackoverflow.com/a/12097567/518169 Would you recommend making a combined query, or just to parse the output using for example Python or bash scripts/sed?

    Read the article

  • Extracting multiple values from a string with RegEx

    - by Toni Frankola
    I have an input string that's generated as in following example: string.Format("Document {0}, was saved by {1} on {2}. The process was completed {3} milliseconds and data was received.", "Document.docx", "John", "1/1/2011", 45); Generate string looks like this then: Document Document.docx, was saved by John on 1/1/2011. The process was completed 45 milliseconds and data was received. Once such a string is received from a different application, what would be the easiest way to parse with regex and extract values Document.docx, John, 1/1/2011, 45 from it. I am looking for the easiest way to do this as we will have to parse a number of different input strings.

    Read the article

  • python regex for repeating string

    - by Lars Nordin
    I am wanting to verify and then parse this string (in quotes): string = "start: c12354, c3456, 34526;" //Note that some codes begin with 'c' I would like to verify that the string starts with 'start:' and ends with ';' Afterward, I would like to have a regex parse out the strings. I tried the following python re code: regx = r"V1 OIDs: (c?[0-9]+,?)+;" reg = re.compile(regx) matched = reg.search(string) print ' matched.groups()', matched.groups() I have tried different variations but I can either get the first or the last code but not a list of all three. Or should I abandon using a regex?

    Read the article

  • Datetime comparaison in CAML Query for Sharepoint

    - by Garcia Julien
    Hi, i'm trying to have some item from a sharepoint list, depends on date in a custom column. I've created my query with 2U2 Caml Builder, and that's worked but when I put it in my own code in my webpart, it always return to me all the items od the list. Here is my code: DateTime startDate = new DateTime(Int32.Parse(year), 1, 1); DateTime endDate = new DateTime(Int32.Parse(year), 12, 31); SPQuery q = new SPQuery(); q.Query = "<Query><Where><And><Geq><FieldRef Name='Publicate Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(startDate) + "</Value></Geq><Leq><FieldRef Name='Publicate_x0020_Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(endDate) + "</Value></Leq></And></Where></Query>"; SPListItemCollection allItem = library.GetItems(q);

    Read the article

  • Validating XML with multiple XSDs in Java

    - by Arian
    Hello! I want to parse an XML file with Java and validate it in the same step against an XSD schema. An XML file may contain content of several schemas, like this: <outer xmlns="my.outer.namespace" xmlns:x="my.third.namespace"> <foo>hello</foo> <inner xmlns="my.inner.namespace"> <bar x:id="bar">world</bar> </inner> </outer> Given a namespace the corresponding xsd file can be provided, but the used namespaces are unknown before parsing. If a schema defines default values for attributes, I also want to know that somehow. I was able to validate a file if the schemas are known, I was able to parse a file without validation and I implemented a LSResourceResolver. However, I can't get all of it working together. How do I have to set up my (SAX) parser?

    Read the article

  • .NET TreeView causes application to crash when trying to check Parent node

    - by alexD
    I have a TreeView with check boxes, and when a user checks a child node, I want to go up the tree and check each parent. However, for some reason my application blows up whenever I touch the parent node. For the nodes in my tree, I've extended TreeNode to create my own objects with some data that I need to store in them, but I still reference them as TreeNodes when checking/unchecking. My code looks like this: //checkBox checked event handler if (node.Parent != null) { checkAllParents(node.Parent); } // private void checkAllParents(TreeNode node) { node.Checked = true; if (node.Parent != null) { checkAllParents(node.Parent); } }

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Recursive compilation using gcc

    - by curiousexplorer
    I am using the gcc compiler. My project source tree looks like somewhat like this test$~: tree . . |-- folder | |-- hello.cpp | `-- hello.h `-- main.cpp 1 directory, 3 files test$~: The file main.cpp contains the main() function and all the functions invoked by main.cpp lie in the directory named folder So far in all my little projects I never had to put some source code under a sub-directory. What I am looking for, in short, is some gcc command for recursive compilation in sub-directories and their subdirectories and so on... This command should be invoked from the home directory of the code project.

    Read the article

  • JSTree select_node event and checkbox

    - by Ted Mosbey
    Hi there! I have a jstree in which I used the select_node event to toggle nodes(expand), and have therefore removed the toggle arrows in the tree since they look ugly and I've no need for them. Now I've added the checkbox plugin to use within the tree, but have found the select_node event is disabled when the plugin is active. How would I toggle my nodes with the checkbox plugin active, without re-adding the ugly toggle arrows? I could do it in the check/uncheck event, but I don't want to check/uncheck everytime I expand a node.

    Read the article

  • How do I use "this" in a member function?

    - by Peter Stewart
    I've written a member function of class Node to read a tree of Nodes in postfix order. It will be called by the Node instance which is the root node of the tree. So: N.postfix(); these appear to be illeagal: *this->left.postfix(); *this->right.postfix(); What is the proper way to do this? class Node { public: const char *cargo; int depth; Node *left; Node *right void Node::postfix() { if (this==__nullptr) { return; } else { *this->left.postfix(); *this->right.postfix(); out<<*this->cargo<<"\n"; return; } };

    Read the article

  • Parsing a text file with a fixed format in Java

    - by EugeneP
    Suppose I know a text file format, say, each line contains 4 fields like this: firstword secondword thirdword fourthword firstword2 secondword2 thirdword2 fourthword2 ... and I need to read it fully into memory I can use this approach: open a text file while not EOF read line by line split each line by a space create a new object with four fields extracted from each line add this object to a Set Ok, but is there anything better, a special 3-rd party Java library? So that we could define the structure of each text line beforehand and parse the file with some function thirdpartylib.setInputTextFileFormat("format.xml"); thirdpartylib.parse(Set, "pathToFile") ?

    Read the article

  • transferring subversion changes between linux and windows

    - by andreas buykx
    Hi all, What is the best way to transfer changes that include new and deleted directories and/or new and deleted (actually moved) files in those directories from a subversion repository on linux to windows? I do my developments on linux using a subversion repository, but I have to test my changes on windows as well. My windows machine has a tortoisesvn repository which I tried to patch with a svn diff output. This failed miserably since my patch contains a renamed (i.e. deleted and added under a different name) directory, a new directory and the files in there. Do I do things wrong by just applying the svn diff output as a patch in tortoisesvn? For now I think that my best option is to have the windows tree on the same svn version as the linux tree and just copy the entire changed directory over the existing directory. Would that work?

    Read the article

< Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >