Search Results

Search found 39577 results on 1584 pages for 'temp files'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 110/1584 | < Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >

  • Using windows CopyFile function to copy all files with certain name format

    - by Ben313
    Hello! I am updating some C code that copys files with a certain name. basically, I have a directory with a bunch of files named like so: AAAAA.1.XYZ AAAAA.2.ZYX AAAAA.3.YZX BBBBB.1.XYZ BBBBB.2.ZYX Now, In the old code, they just used a call to ShellExecute and used xcopy.exe. to get all the files starting with AAAAA, they just gave xcopy the name of the file as AAAAA.* and it knew to copy all of the files starting with AAAAA. now, im trying to get it to copy with out having to use the command line, and I am running into trouble. I was hoping CopyFile would be smart enough to handle AAAAA.* as the file to be copied, but it doesnt at all do what xcopy did. So, any Ideas on how to do this without the external call to xcopy.exe?

    Read the article

  • tool for advanced ID3 tags handling and audio files ordering

    - by Juhele
    I have following problem – some of my files do not have complete ID3 tags and some have typos or small differences in writing - so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override “artist” in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but artist is missing etc. Without touching the audio quality, of course (but this should be no problem, I think). I already tried tools in Winamp, Songbird and other players and currently most advanced free tool I tried is Tagscanner. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Rename files and directories using substitution and variables

    - by rednectar
    I have found several similar questions that have solutions, except they don't involve variables. I have a particular pattern in a tree of files and directories - the pattern is the word TEMPLATE. I want a script file to rename all of the files and directories by replacing the word TEMPLATE with some other name that is contained in the variable ${newName} If I knew that the value of ${newName} was say "Fred lives here", then the command find . -name '*TEMPLATE*' -exec bash -c 'mv "$0" "${0/TEMPLATE/Fred lives here}"' {} \; will do the job However, if my script is: newName="Fred lives here" find . -name '*TEMPLATE*' -exec bash -c 'mv "$0" "${0/TEMPLATE/${newName}}"' {} \; then the word TEMPLATE is replaced by null rather than "Fred lives here" I need the "" around $0 because there are spaces in the path name, so I can't do something like: find . -name '*TEMPLATE*' -exec bash -c 'mv "$0" "${0/TEMPLATE/"${newName}"}"' {} \; Can anyone help me get this script to work so that all files and directories that contain the word TEMPLATE have TEMPLATE replaced by whatever the value of ${newName} is eg, if newName="A different name" and a I had directory of /foo/bar/some TEMPLATE directory/with files then the directory would be renamed to /foo/bar/some A different name directory/with files and a file called some TEMPLATE file would be renamed to some A different name file

    Read the article

  • EF 4.x generated entity classes (POCO) and Map files

    - by JBeckton
    I have an MVC 4 app that I am working on and using the code first implementation except I cheated a bit and created my database first then generated my entity classes (poco) from my database using the EF power tools (reverse engineer). I guess you can say I did database first method but I have no edmx file just the context class and my entity classes (poco) I have a few projects in the works using MVC and EF with pocos but just the one project I used the tool to generate my pocos from the database. My question is about the mapping files that get created when I generate my pocos using the tool. What is the purpose of these Map files? I figured the map files are needed when generating the db from the model like with the true code first method, in my case where I am using a tool to generate my model from the database do the map files have any influence on how my app uses the entity classes?

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • Is there any way to do a WER "Request Additional Files" for the windows temp directory?

    - by Jason Mathison
    My company has had numerous crashes reported to windows error reporting due to what looks like an install problem. The logs for our installs are typically in the windows\temp directory. I would like to include the install log file as a "Request Additional Files" entry, however there doesn't seem to be any way to get to a subdirectory of the list of environmental Variables that are provided. The windows temp directory is not in the list of values that you can work from, so I am stuck. In general, I don't understand how it is possible to get at almost anything of use via the "Request Additional Files". For example, the %programfiles% directory shouldn't contain any useful files, they should be in a subdirectory for your product. What am I missing?

    Read the article

  • IE8 Unable to download files

    - by jetgunner
    I recently installed Windows 7. I can browse to any webpage using IE8, but if I click on any links to download files, I receive the following error: Unable to download [filename] from [website]. Unable to open this Internet site. The requested site is either unavailable or cannot be found. Please try again later. I can download files perfectly fine using firefox, it's just IE that is having issues. There are no messages in the windows event log. I have no add-ins installed and have made no security changes as this is a fresh install. Any ideas?

    Read the article

  • Getting data from closed files with concatenate formula

    - by Pav
    Each day a program is creating an excel file for me with some data for the current day. Like what is the price for products, how many people are available today and things like that. Based on all this I need to make some forecasts and workplace allocations for workers. The problem is, that I need to drag all this information manually all the time. So to make it automatic I placed the formula in cells like: ='c:\ABC\[ABC 29-01-14.xlsx]sheet'!a1 Everything works fine, but next day I have to change file name for "ABC 30-01-14" for each cell, what is the same as entering the data manually. So I used "concatenate" formula to change date according to today's date automatically. I used "indirect" formula to turn it in to a real formula, not text string, and realized that it is working only for open files, not closed. Is there any way to do this for closed files without VBA, because I don't know it, or with VBA but explained for an idiot.

    Read the article

  • puppet agent doesn't retrieve files from master

    - by nicmon
    I have a very basic question regarding to Puppet 3.0.1 configuration. I setup a puppet master server (CentOS) with 2 agents (CentOS and Windows 7), all 3 can ping and access each other. There is no error at all. I have copied a file under /etc/puppet/files/test2.txt my site.pp (/etc/puppet/manifests) contains these lines: node default { include test file { "/tmp/testmaster.txt": owner => root, group => root, mode => 644, source => "puppet:///files/test2.txt" } } but there will no file be created on agent servers under /tmp/ once I run "puppet agent --test" here is the output: [root@agent1 ~]# puppet agent --test Info: Retrieving plugin Info: Caching catalog for agent1.mydomain.com Info: Applying configuration version '1354267916' Finished catalog run in 0.02 seconds "puppet apply /etc/puppet/manifests/site.pp" creates the testmaster.txt under /tmp/ on master.

    Read the article

  • Which open source repository or version control systems store files' original mtime, ctime and atime

    - by sampablokuper
    I want to create a personal digital archive. I want to be able to check digital files (some several years old, some recent, some not yet created) into that archive and have them preserved, along with their metadata such as ctime, atime and mtime. I want to be able to check these files out of that archive, modify their contents and commit the changes back to the archive, while keeping the earlier commits and their metadata intact. I want the archive to be very reliable and secure, and able to be backed up remotely. I want to be able to check files in and out of the archive from PCs running Linux, Mac OS X 10.5+ or Win XP+. I want to be able to check files in and out of the archive from PCs with RAM capacities lower than the size of the files. E.g. I want to be able to check in/out a 13GB file using a PC with 2GB RAM. I thought Subversion could do all this, but apparently it can't. (At least, it couldn't a couple of years ago and as far as I know it still can't; correct me if I'm wrong.) Is there a libre VCS or similar capable of all these things? Thanks for your help.

    Read the article

  • How to copy protected files when an Administrator in Vista (easily)

    - by earlz
    Hello, I have a harddrive I need to backup. In the harddrive is of course things like Documents and Settings which is set to not allow other people to see inside someone's personal folders. I am an administrator though and I can not figure out how to mark these files so that I am permitted to access them and copy them. IWhen I double click on My Documents then it pops up saying You must have permission to access this and gives me an option like ok or cancel. I click ok and then it says you do not have permission to access these files I'm an administrator on the system so I don't understand why Vista is locking me out. How can I setup vista so that it will let me copy every file, even ones I don't have permission to?

    Read the article

  • Making archive from files with same names in different directories

    - by Tim
    Hi, I have some files with same names but under different directories. For example, path1/filea, path1/fileb, path2/filea, path2/fileb,.... What is the best way to make the files into an archive? Under these directories, there are other files that I don't want to make into the archive. Off the top of my head, I think of using Bash, probably ar, tar and other commands, but am not sure how exactly to do it. Renaming the files seems to make the file names a little complicated. I tend to keep the directory structure inside the archive. Or I might be wrong. Other ideas are welcome! Thanks and regards!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Windows script to create directories of 3,000 files

    - by uhpl1
    We have some email archiving that is dumping all the emails into a directory. Because of some performance reasons with the server, I want to setup an automated task that will run a script once a day and if there is more than 3,000 (or whatever number) of files in the main directory, create a new directory with the date and move all the main directory files into it. I'm sure someone has already written something similar, so if anyone could point me at it that would be great. Batch file or Powershell would both be fine.

    Read the article

  • Advanced ID3 tags handling and audio files ordering

    - by Juhele
    Some of my files do not have complete ID3 tags and some have typos or small differences in writing – so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override artist in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but the artist is missing etc. I'd like to do this without touching the audio quality, of course (but this should be no problem, I think). I already tried tools like: Winamp Songbird other players Tagscanner – the most advanced free tool I tried. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • why toString method does not work here??

    - by user329820
    Hi this is my whole class ,I have added number 2 to the doubly linked list and then I want it to be be print in the concole but it will show this "datastructureproject.Node@f62373" thanks! package datastructureproject; public class DoublyLinkedList { private Node head = new Node(0); private Node tail = new Node(0); private int length = 0; public DoublyLinkedList() { head.setPrev(null); head.setNext(tail); tail.setPrev(head); tail.setNext(null); } public void add(int index, int value) throws IndexOutOfBoundsException { Node cursor = get(index); Node temp = new Node(value); temp.setPrev(cursor); temp.setNext(cursor.getNext()); cursor.getNext().setPrev(temp); cursor.setNext(temp); length++; } private Node get(int index) throws IndexOutOfBoundsException { if (index < 0 || index > length) { throw new IndexOutOfBoundsException(); } else { Node cursor = head; for (int i = 0; i < index; i++) { cursor = cursor.getNext(); } return cursor; } } public long size() { return length; } public boolean isEmpty() { return length == 0; } @Override public String toString() { StringBuffer result = new StringBuffer(); result.append("(head) - "); Node temp = head; while (temp.getNext() != tail) { temp = temp.getNext(); result.append(temp.getValue() + " - "); } result.append("(tail)"); return result.toString(); } public static void main(String[] args){ DoublyLinkedList list = new DoublyLinkedList(); list.add(0,2 ); System.out.println(list.get(0).toString()); } }

    Read the article

  • Can't access my files in ASP.NET web site

    - by jumbojs
    I'm having a very difficult time. I am running windows 2008 server, I have an Able Commerce site using ASP.NET with C#. I'm writing an automated task that will ftp some xml files down into a local directory on our web server and then the program parses the xml file and saves information to our database. The problem, once I save the files to our local directory, my program has no access to the files. The NETWORK SERVICE user permissions isn't being inherited by the xml files so my program can't do anything with them. I can manually change the permissions, but this wouldn't be automated and won't work. How can I get this to work? help please, it's very frustrating.

    Read the article

  • CVS list of files only in working directories

    - by Joshua Berry
    Is it possible to get a list of files that are in the working directory tree, but not in the current branch/tag? I currently diff the working copy with another directory updated to the same module and tag/branch but without the local non-repo files. It works, but doesn't honor the .cvsignore files. I figure there must be an option using a variation of 'cvs diff'. Thanks in advance.

    Read the article

  • Combine and compress script files in asp.net mvc

    - by victor_foster
    I am working in Visual Studio 2008, IIS7 and using asp.net MVC. I would like to know the best way to combine all of my Javascript files into one file to reduce the number of HTTP requests to the server. I have seen many articles on this subject but I'm not sure which one I should look at first (many of them are over a year old). Here are the things I would like to do: Combine my Javascript and css files Safely compress my Javascript files when I publish, but keep them uncompressed while I am debugging Cache my Css and Javascript files but allow them to refreshed with a hard refresh when they are updated without having to rename them.

    Read the article

  • Another "Trouble copying music files from HD to 16GB thumb drive"

    - by Ron
    I have a brand new HP Quad Core - 6GB Ram - running 64-bit Windows 7. Running Norton Internet 2010. I try copying music files from HD to 16 GB thumbdrive and get blue screen after a few files have transfered over to thumbdrive. Computer blinks once and boom - blue screen and then reboots. This is really aggravating. I stopped anti-virus, pulled other USB attached devices - still does same thing. Any solutions out there?

    Read the article

  • RealPath returns an empty string

    - by Abs
    Hello all, I have the following which just loops through the files in a directory and echo the file names. However, when I use realpath, it returns nothing. What am I doing wrong: if ($handle = opendir($font_path)) { while (false !== ($file = readdir($handle))) { if ($file != "." && $file != ".." && $file != "a.zip") { echo $file.'<br />';//i can see file names fine echo realpath($file);// return empty string?! } } closedir($handle); } Thanks all for any help on this. ~I am on a windows machine, running php 5.3 and apache 2.2.

    Read the article

  • Preventing logrotate's dateext from overwriting files

    - by Thirler
    I'm working with a system where I would like to use the dateext function of logrotate (or some other way) to add the date to a logfile when it is rotated. However in this system it is important that no logging is missing and dateext will overwrite any existing files (which will happen if logrotate is called twice on a day). Is there a reliable way to prevent dateext to overwrite existing files, but instead make another file?. It is acceptable that either no rotate happens or a file is created with a less predictable name (date with an extra number, or the time or something).

    Read the article

  • How to ignore the .classpath for Eclipse projects using Mercurial?

    - by Feanor
    I'm trying to share a repository between my Mac (laptop) and PC (desktop). There are some external dependencies for the project that are stored on different places on each machine, and noted in the .classpath file in the Eclipse project. When the project changes are shared, the dependencies break. I'm trying to figure out how to keep this from happening. I've tried using .hgignore with the following settings, among others, without success: syntax: glob *.classpath Based on this question, it appears that the .hgignore file will not allow Mercurial to ignore files that are also committed to the repository. Is there another way around this? Other ways to configure the project to make it work?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >