Search Results

Search found 39577 results on 1584 pages for 'temp files'.

Page 110/1584 | < Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Search Files (Preferably with index) on Windows 2000 Server

    - by ThinkBohemian
    I have many files on a windows server 2000 machine that is setup to act as a networked disk drive, is there anyway I can index the files and make that index available as a search to more people than just me? Bonus if the index can look inside of documents such as readme.txt? If there is no easy way to do this globaly (for all users) Is there a way I could generate and store an index locally on my computer? If this is the wrong place to ask this question, any advice on community more suited?

    Read the article

  • Windows script to create directories of 3,000 files

    - by uhpl1
    We have some email archiving that is dumping all the emails into a directory. Because of some performance reasons with the server, I want to setup an automated task that will run a script once a day and if there is more than 3,000 (or whatever number) of files in the main directory, create a new directory with the date and move all the main directory files into it. I'm sure someone has already written something similar, so if anyone could point me at it that would be great. Batch file or Powershell would both be fine.

    Read the article

  • Using rsync to synchronise folders without overwriting files of same name on Mac OS X

    - by Adam
    I would like to synchronise the contents of two directories. Without overwriting but to create a copy if two files have the same name, but different sizes Without duplicating if two files have the same name and size. To work recursively So far I have found the following command which might work $ rsync -varE --progress ~/folder /volumes/server/folder But I'm not entirely sure what the -E flag does. It was suggested by a user on bananica.com but couldn't see a description for it in the manual. Would this do what I require successfully? Thanks

    Read the article

  • How to make NetBeans IDE 6.8 show svn commit status (especially for "dirty" files)

    - by Andrew M. Andrews III
    I just switched from Eclipse to NetBeans IDE 6.8 for my PHP/Ajax development. Eclipse always showed a little hard disk symbol over the file icon for files that were in sync with the svn repository, and an asterisk for files with changes that have not been committed. Is there a way to see the commit status in NetBeans? If not, what is your preferred way of recognizing which files to commit?

    Read the article

  • Getting data from closed files with concatenate formula

    - by Pav
    Each day a program is creating an excel file for me with some data for the current day. Like what is the price for products, how many people are available today and things like that. Based on all this I need to make some forecasts and workplace allocations for workers. The problem is, that I need to drag all this information manually all the time. So to make it automatic I placed the formula in cells like: ='c:\ABC\[ABC 29-01-14.xlsx]sheet'!a1 Everything works fine, but next day I have to change file name for "ABC 30-01-14" for each cell, what is the same as entering the data manually. So I used "concatenate" formula to change date according to today's date automatically. I used "indirect" formula to turn it in to a real formula, not text string, and realized that it is working only for open files, not closed. Is there any way to do this for closed files without VBA, because I don't know it, or with VBA but explained for an idiot.

    Read the article

  • best way to record local modifications to an application's configuration files

    - by Menelaos Perdikeas
    I often install applications in Linux which don't come in package form but rather one just downloads a tarball, unpacks it, and runs the app out of the exploded folder. To adjust the application to my environment I need to modify the default configuration files, perhaps add an odd script of my own and I would like to have a way to record all these modifications automatically so I can apply them to another environment. Clearly, the modifications can not be reproduced verbatim as things like IP addresses or username need to change from system to system; still an exhaustive record to what was changed and added would be useful. My solution is to use a pattern involving git. Basically after I explode the tarball I do a git init and an initial commit and then I can save to a file the output of git diff and a cat of all files appearing as new in the git status -s. But I am sure there are more efficient ways. ???

    Read the article

  • Using windows CopyFile function to copy all files with certain name format

    - by Ben313
    Hello! I am updating some C code that copys files with a certain name. basically, I have a directory with a bunch of files named like so: AAAAA.1.XYZ AAAAA.2.ZYX AAAAA.3.YZX BBBBB.1.XYZ BBBBB.2.ZYX Now, In the old code, they just used a call to ShellExecute and used xcopy.exe. to get all the files starting with AAAAA, they just gave xcopy the name of the file as AAAAA.* and it knew to copy all of the files starting with AAAAA. now, im trying to get it to copy with out having to use the command line, and I am running into trouble. I was hoping CopyFile would be smart enough to handle AAAAA.* as the file to be copied, but it doesnt at all do what xcopy did. So, any Ideas on how to do this without the external call to xcopy.exe?

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • Advanced ID3 tags handling and audio files ordering

    - by Juhele
    Some of my files do not have complete ID3 tags and some have typos or small differences in writing – so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override artist in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but the artist is missing etc. I'd like to do this without touching the audio quality, of course (but this should be no problem, I think). I already tried tools like: Winamp Songbird other players Tagscanner – the most advanced free tool I tried. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Best Place to Store Config Files and Log Files on Windows for My Program?

    - by Dave
    I need to store log files and config files for my application. Where is the best place to store them? Right now I'm just using the current directory, which ends up putting them in the Program Files directory where my program lives. The log files will probably be accessed by the user somewhat regularly, so %APPDATA% seems a little hard to get to. Is a directory under %USERPROFILE%\My Documents the best? It needs to work for all versions of Windows from 2000 forward.

    Read the article

  • Replace files with symlink

    - by soandos
    This question is intended to be the inverse of Replace Symbolic Links with Files, but for windows. I have started running out of space on my SSD drive, and I found that about 12% of used space is in my installer folder (holds the .msi files for all the programs that I have installed) I am looking for two things: A way to move this (or any) folder via symlink. Ideally, some powershell function that I could use to just designate a folder, a destination, and the symlink would be created in the original (pointing to the destination) In this particular case, a registry change that would allow the location to be move would also be helpful, but I would still prefer solution 1. How can this be done?

    Read the article

  • Mixing two wav music files of different size

    - by iphoneDev
    Hi, I want to mix audio files of different size into a one single .wav file. There is a sample through which we can mix files of same size [(http://www.modejong.com/iOS/#ex4 )(Example 4)]. I modified the code to get the mixed file as a .wav file. But I am not able to understand that how to modify this code for unequal sized files. If someone can help me out with some code snippet,i'll be really thankful.

    Read the article

  • Which open source repository or version control systems store files' original mtime, ctime and atime

    - by sampablokuper
    I want to create a personal digital archive. I want to be able to check digital files (some several years old, some recent, some not yet created) into that archive and have them preserved, along with their metadata such as ctime, atime and mtime. I want to be able to check these files out of that archive, modify their contents and commit the changes back to the archive, while keeping the earlier commits and their metadata intact. I want the archive to be very reliable and secure, and able to be backed up remotely. I want to be able to check files in and out of the archive from PCs running Linux, Mac OS X 10.5+ or Win XP+. I want to be able to check files in and out of the archive from PCs with RAM capacities lower than the size of the files. E.g. I want to be able to check in/out a 13GB file using a PC with 2GB RAM. I thought Subversion could do all this, but apparently it can't. (At least, it couldn't a couple of years ago and as far as I know it still can't; correct me if I'm wrong.) Is there a libre VCS or similar capable of all these things? Thanks for your help.

    Read the article

  • Storage of various linux config files

    - by stantona
    I'm using git to track/store all my various config files required for linux. They're organized as if they live in my home directory, eg: .Xresources .config/ Awesome rc.lua .xmodmap .zshrc vim/ <- submodule emacs/ <- submodule etc I use git submodules for other things like vim/emacs configuration (since I also want to keep those separate repos). I'm thinking of creating a shell script to create the various links to these files. The goal is to make it easier to setup another linux painlessly. Is this a reasonable idea? Is there a preferred approach? I'm mostly interested in hearing how others people store their configs.

    Read the article

  • Wrong owner and group for files created under a samba shared directory

    - by agmao
    I am trying to make writing to a shared samba directory work. I got a very weird problem. Now the shared directory is writable from a client machine. But the files created under the samba share directory have weird owner and group names. I am writing to the shared directory as user mike under the client machine, but the file created always has user and group name as steve instead... Does anybody know why that would happen...? Another thing I just noticed is that on the samba server, the files have owner and user name as samba, which I created for samba clients. Thanks a lot

    Read the article

  • How to ignore the .classpath for Eclipse projects using Mercurial?

    - by Feanor
    I'm trying to share a repository between my Mac (laptop) and PC (desktop). There are some external dependencies for the project that are stored on different places on each machine, and noted in the .classpath file in the Eclipse project. When the project changes are shared, the dependencies break. I'm trying to figure out how to keep this from happening. I've tried using .hgignore with the following settings, among others, without success: syntax: glob *.classpath Based on this question, it appears that the .hgignore file will not allow Mercurial to ignore files that are also committed to the repository. Is there another way around this? Other ways to configure the project to make it work?

    Read the article

  • Oracle application - files missing in the Mount point in UNix server

    - by arun_V
    My oracle application test instance is down, When I browse through the Unix server, I couldn’t find any files in the mount point,U01 U06 or U10, when I put BDF command it shows the following $ bdf Filesystem kbytes used avail %used Mounted on /dev/vg00/lvol3 204800 35571 158662 18% / /dev/vg00/lvol1 299157 38506 230735 14% /stand /dev/vg00/lvol8 1392640 1261068 123620 91% /var /dev/vg00/lvol7 1327104 825170 470631 64% /usr /dev/vg00/lvol4 716800 385891 310746 55% /tmp /dev/vg00/lvol6 872448 814943 53936 94% /opt /dev/vg00/lvolssh 32768 13243 18306 42% /opt/openssh /dev/vg00/lvol5 204800 187397 16334 92% /home /dev/vg00/lvolback 512000 472879 36704 93% /backup dg-ora04:/dgora03_u10 204800 167088 35416 83% /u10 dg-ora04:/dgora03_u06 204800 167088 35416 83% /u06 dg-ora04:/dgora03_u01 204800 167088 35416 83% /u01 Why can't I see any files inside the mount points?

    Read the article

  • why toString method does not work here??

    - by user329820
    Hi this is my whole class ,I have added number 2 to the doubly linked list and then I want it to be be print in the concole but it will show this "datastructureproject.Node@f62373" thanks! package datastructureproject; public class DoublyLinkedList { private Node head = new Node(0); private Node tail = new Node(0); private int length = 0; public DoublyLinkedList() { head.setPrev(null); head.setNext(tail); tail.setPrev(head); tail.setNext(null); } public void add(int index, int value) throws IndexOutOfBoundsException { Node cursor = get(index); Node temp = new Node(value); temp.setPrev(cursor); temp.setNext(cursor.getNext()); cursor.getNext().setPrev(temp); cursor.setNext(temp); length++; } private Node get(int index) throws IndexOutOfBoundsException { if (index < 0 || index > length) { throw new IndexOutOfBoundsException(); } else { Node cursor = head; for (int i = 0; i < index; i++) { cursor = cursor.getNext(); } return cursor; } } public long size() { return length; } public boolean isEmpty() { return length == 0; } @Override public String toString() { StringBuffer result = new StringBuffer(); result.append("(head) - "); Node temp = head; while (temp.getNext() != tail) { temp = temp.getNext(); result.append(temp.getValue() + " - "); } result.append("(tail)"); return result.toString(); } public static void main(String[] args){ DoublyLinkedList list = new DoublyLinkedList(); list.add(0,2 ); System.out.println(list.get(0).toString()); } }

    Read the article

  • Compile multiple C files with make

    - by Mohit Deshpande
    (I am running Linux Ubuntu 9.10, so the extension for an executable is executablefile.out) I am just getting into modular programming (programming with multiple files) in C and I want to know how to compile multiple files in a single makefile. For example, what would be the makefile to compile these files: main.c, dbAdapter.c, dbAdapter.h? (By the way, If you haven't figured it out yet, the main function is in main.c) Also could someone post a link to the documentation of a makefile?

    Read the article

  • Making archive from files with same names in different directories

    - by Tim
    Hi, I have some files with same names but under different directories. For example, path1/filea, path1/fileb, path2/filea, path2/fileb,.... What is the best way to make the files into an archive? Under these directories, there are other files that I don't want to make into the archive. Off the top of my head, I think of using Bash, probably ar, tar and other commands, but am not sure how exactly to do it. Renaming the files seems to make the file names a little complicated. I tend to keep the directory structure inside the archive. Or I might be wrong. Other ideas are welcome! Thanks and regards!

    Read the article

< Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >