Search Results

Search found 7897 results on 316 pages for 'partial views'.

Page 112/316 | < Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >

  • Type checking and recursive types (Writing the Y combinator in Haskell/Ocaml)

    - by beta
    When explaining the Y combinator in the context of Haskell, it's usually noted that the straight-forward implementation won't type-check in Haskell because of its recursive type. For example, from Rosettacode [1]: The obvious definition of the Y combinator in Haskell canot be used because it contains an infinite recursive type (a = a -> b). Defining a data type (Mu) allows this recursion to be broken. newtype Mu a = Roll { unroll :: Mu a -> a } fix :: (a -> a) -> a fix = \f -> (\x -> f (unroll x x)) $ Roll (\x -> f (unroll x x)) And indeed, the “obvious” definition does not type check: ?> let fix f g = (\x -> \a -> f (x x) a) (\x -> \a -> f (x x) a) g <interactive>:10:33: Occurs check: cannot construct the infinite type: t2 = t2 -> t0 -> t1 Expected type: t2 -> t0 -> t1 Actual type: (t2 -> t0 -> t1) -> t0 -> t1 In the first argument of `x', namely `x' In the first argument of `f', namely `(x x)' In the expression: f (x x) a <interactive>:10:57: Occurs check: cannot construct the infinite type: t2 = t2 -> t0 -> t1 In the first argument of `x', namely `x' In the first argument of `f', namely `(x x)' In the expression: f (x x) a (0.01 secs, 1033328 bytes) The same limitation exists in Ocaml: utop # let fix f g = (fun x a -> f (x x) a) (fun x a -> f (x x) a) g;; Error: This expression has type 'a -> 'b but an expression was expected of type 'a The type variable 'a occurs inside 'a -> 'b However, in Ocaml, one can allow recursive types by passing in the -rectypes switch: -rectypes Allow arbitrary recursive types during type-checking. By default, only recursive types where the recursion goes through an object type are supported. By using -rectypes, everything works: utop # let fix f g = (fun x a -> f (x x) a) (fun x a -> f (x x) a) g;; val fix : (('a -> 'b) -> 'a -> 'b) -> 'a -> 'b = <fun> utop # let fact_improver partial n = if n = 0 then 1 else n*partial (n-1);; val fact_improver : (int -> int) -> int -> int = <fun> utop # (fix fact_improver) 5;; - : int = 120 Being curious about type systems and type inference, this raises some questions I'm still not able to answer. First, how does the type checker come up with the type t2 = t2 -> t0 -> t1? Having come up with that type, I guess the problem is that the type (t2) refers to itself on the right side? Second, and perhaps most interesting, what is the reason for the Haskell/Ocaml type systems to disallow this? I guess there is a good reason since Ocaml also will not allow it by default even if it can deal with recursive types if given the -rectypes switch. If these are really big topics, I'd appreciate pointers to relevant literature. [1] http://rosettacode.org/wiki/Y_combinator#Haskell

    Read the article

  • DataContractSerializer: type is not serializable because it is not public?

    - by Michael B. McLaughlin
    I recently ran into an odd and annoying error when working with the DataContractSerializer class for a WP7 project. I thought I’d share it to save others who might encounter it the same annoyance I had. So I had an instance of  ObservableCollection<T> that I was trying to serialize (with T being a class I wrote for the project) and whenever it would hit the code to save it, it would give me: The data contract type 'ProjectName.MyMagicItemsClass' is not serializable because it is not public. Making the type public will fix this error. Alternatively, you can make it internal, and use the InternalsVisibleToAttribute attribute on your assembly in order to enable serialization of internal members - see documentation for more details. Be aware that doing so has certain security implications. This, of course, was malarkey. I was trying to write an instance of MyAwesomeClass that looked like this: [DataContract] public class MyAwesomeClass { [DataMember] public ObservableCollection<MyMagicItemsClass> GreatItems { get; set; }   [DataMember] public ObservableCollection<MyMagicItemsClass> SuperbItems { get; set; }     public MyAwesomeClass { GreatItems = new ObservableCollection<MyMagicItemsClass>(); SuperbItems = new ObservableCollection<MyMagicItemsClass>(); } }   That’s all well and fine. And MyMagicItemsClass was also public with a parameterless public constructor. It too had DataContractAttribute applied to it and it had DataMemberAttribute applied to all the properties and fields I wanted to serialize. Everything should be cool, but it’s not because I keep getting that “not public” exception. I could tell you about all the things I tried (generating a List<T> on the fly to make sure it wasn’t ObservableCollection<T>, trying to serialize the the Collections directly, moving it all to a separate library project, etc.), but I want to keep this short. In the end, I remembered my the “Debug->Exceptions…” VS menu option that brings up the list of exception-related circumstances under which the Visual Studio debugger will break. I checked the “Thrown” checkbox for “Common Language Runtime Exceptions”, started the project under the debugger, and voilà: the true problem revealed itself. Some of my properties had fairly elaborate setters whose logic I wanted to ignore. So for some of them, I applied an IgnoreDataMember attribute to them and applied the DataMember attribute to the underlying fields instead. All of which, in line with good programming practices, were private. Well, it just so happens that WP7 apps run in a “partial trust” environment and outside of “full trust”-land, DataContractSerializer refuses to serialize or deserialize non-public members. Of course that exception was swallowed up internally by .NET so all I ever saw was that bizarre message about things that I knew for certain were public being “not public”. I changed all the private fields I was serializing to public and everything worked just fine. In hindsight it all makes perfect sense. The serializer uses reflection to build up its graph of the object in order to write it out. In partial trust, you don’t want people using reflection to get at non-public members of an object since there are potential security problems with allowing that (you could break out of the sandbox pretty quickly by reflecting and calling the appropriate methods and cause some havoc by reflecting and setting the appropriate fields in certain circumstances. The fact that you cannot reflect your own assembly seems a bit heavy-handed, but then again I’m not a compiler writer or a framework designer and I have no idea what sorts of difficulties would go into allowing that from a compilation standpoint or what sorts of security problems allowing that could present (if any). So, lesson learned. If you get an incomprehensible exception message, turn on break on all thrown exceptions and try running it again (it might take a couple of tries, depending) and see what pops out. Chances are you’ll find the buried exception that actually explains what was going on. And if you’re getting a weird exception when trying to use DataContractSerializer complaining about public types not being public, chances are you’re trying to serialize a private or protected field/property.

    Read the article

  • Getting warning about sensitive information that could be disclosed to 3rd parties - Asp.net MVC 2.0

    - by chobo2
    Hi I never gotten this message before I started to use asp.net mvc 2.0 and jquery 1.4. <title>This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.</title> <span><H1>Server Error in '/' Application.<hr width=100% size=1 color=silver></H1> <h2> <i>This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.</i> </h2></span> <font face="Arial, Helvetica, Geneva, SunSans-Regular, sans-serif "> <b> Description: </b>An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. <br><br> <b> Exception Details: </b>System.InvalidOperationException: This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.<br><br> So it makes me wondering what sensitive data could be disclosed and if so how to get around this? What I was trying to send back was a rendered string of a partial view(http://www.klopfenstein.net/lorenz.aspx/render-partial-view-to-string-in-asp-net-mvc) and a success msg.

    Read the article

  • How to use multiple DisplayName attribute using Entity Framework and ASP.Net Mvc 2

    - by Picflight
    Depending on where I use my Class, I want to be able to show a different DisplayName. I have the following class: [MetadataType(typeof(PortalMetaData))] [System.Web.Mvc.Bind(Exclude = "PortalId")] public partial class Portal { public Portal() { this.Created = DateTime.Now; } } public class PortalMetaData { [Required(ErrorMessage = "Portal name is required")] [StringLength(50, ErrorMessage = "Portal name must be under 50 characters")] public object PortalName { get; set; } [Required(ErrorMessage = "Description is required")] public object Description { get; set; } } I have a corresponding Table in the database Portal I use the Portal table with a PortalController for the Site Admin to update the records in the Portal Table. I want another user with a different Role (AsstAdmin) to be able to update this table as well. To facilitate that I am thinking of creating a separate partial class that somehow links back to the Portal Model. This would allow me to display limited Fields for update by the AsstAdmin and I can display a different name for the Field as well. How can I accomplish this task? If I add the following class which inherits from Portal than I get an exception: Unable to cast object of type 'Project1.Mvc.Models.Portal' to type 'Prpject1.Mvc.Models.Site'. [MetadataType(typeof(SiteMetaData))] public class Site : Portal { public Site() { } } public class SiteMetaData { [Required(DisplayName = "Site Description")] public object Description { get; set; } }

    Read the article

  • Bread Crumbs With C#

    - by kareemsaad
    I made Class And user Control In master.cs public partial class BreadCrumbs : System.Web.UI.UserControl { protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here bc1.PageTitle = HeaderText; } protected BreadCrumbs.ctrlBreadCrumbs bc1; private string _strHeaderText; public string HeaderText { get { return _strHeaderText; } set { _strHeaderText = value; } } } User Control: public partial class BreadCrumbs : System.Web.UI.UserControl { protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here bc1.PageTitle = HeaderText; } protected BreadCrumbs.ctrlBreadCrumbs bc1; private string _strHeaderText; public string HeaderText { get { return _strHeaderText; } set { _strHeaderText = value; } } } protected System.Web.UI.WebControls.Literal lblPageTitle; protected namespace.headerBreadCrumb header; ClsCategory clscategory = new ClsCategory(); protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here string PageTitle = "ASP.NET Breadcrumbs with C#"; lblPageTitle.Text = PageTitle; header.HeaderText = PageTitle; but it not work well i think problem here <%@ Register TagPrefix="bc" Namespace="BreadCrumbs" Assembly="BreadCrumbs" %> <bc:ctrlBreadCrumbs id="bc1" runat="server" />

    Read the article

  • ASP.NET 4.0 UpdatePanel and UserControl with PlaceHolder

    - by Chris
    I don't know if this is ASP.NET 4.0 specific but I don't recall having this problem in previous versions. I have very simple user control called "TestModal" that contains a PlaceHolder control which I use to instantiate a template in. When I put an UpdatePanel inside this UserControl on the page the updatepanel only does full postbacks and not partial postbacks. What gives? USER CONTROL MARKUP: <%@ Control Language="C#" AutoEventWireup="true" CodeBehind="TestModal.ascx.cs" Inherits="MyProject.UserControls.TestModal" %> <div id="<%= this.ClientID %>"> <asp:PlaceHolder ID="plchContentTemplate" runat="server"></asp:PlaceHolder> </div> USER CONTROL CODE BEHIND: public partial class TestModal : System.Web.UI.UserControl { private ITemplate _contentTemplate; [TemplateInstance(TemplateInstance.Single)] [PersistenceMode(PersistenceMode.InnerProperty), TemplateContainer(typeof(TemplateControl))] public ITemplate ContentTemplate { get { return _contentTemplate; } set { _contentTemplate = value; } } protected override void OnInit(EventArgs e) { base.OnInit(e); if (_contentTemplate != null) _contentTemplate.InstantiateIn(plchContentTemplate); } } ASPX PAGE MARKUP: <ajaxToolkit:ToolkitScriptManager ID="scriptManager" EnablePartialRendering="true" AllowCustomErrorsRedirect="true" CombineScripts="true" EnablePageMethods="true" ScriptMode="Release" AsyncPostBackTimeout="180" runat="server"></ajaxToolkit:ToolkitScriptManager> <uc1:TestModal ID="testModal" ClientIDMode="Static" runat="server"> <ContentTemplate> <asp:UpdatePanel ID="upAttachments" UpdateMode="Conditional" ChildrenAsTriggers="true" runat="server"> <ContentTemplate> <asp:LinkButton ID="lnkRemoveAttachment" runat="server"><img src="/images/icons/trashcan.png" style="border: none;" /></asp:LinkButton> </ContentTemplate> </asp:UpdatePanel> </ContentTemplate> </uc1:TestModal>

    Read the article

  • How to clone a Model using Entity Framework and ASP.Net Mvc 2

    - by Picflight
    I have the following class: [MetadataType(typeof(PortalMetaData))] [System.Web.Mvc.Bind(Exclude = "PortalId")] public partial class Portal { public Portal() { this.Created = DateTime.Now; } } public class PortalMetaData { [Required(ErrorMessage = "Portal name is required")] [StringLength(50, ErrorMessage = "Portal name must be under 50 characters")] public object PortalName { get; set; } [Required(ErrorMessage = "Description is required")] public object Description { get; set; } } I have a corresponding Table in the database Portal I use the Portal table with a PortalController for the Site Admin to update the records in the Portal Table. I want another user with a different Role (AsstAdmin) to be able to update this table as well. To facilitate that I am thinking of creating a separate partial class that somehow links back to the Portal Model. This would allow me to display limited Fields for update by the AsstAdmin and I can display a different name for the Field as well. How can I accomplish this task? If I add the following class which inherits from Portal than I get an exception: Unable to cast object of type 'Project1.Mvc.Models.Portal' to type 'Prpject1.Mvc.Models.Site'. [MetadataType(typeof(SiteMetaData))] public class Site : Portal { public Site() { } } public class SiteMetaData { [Required(DisplayName = "Site Description")] public object Description { get; set; } }

    Read the article

  • ASP.NET MVC 2 validation LINQ to SQL

    - by Chino
    Currently I have a DataModel object which contains my linq to sql classes(a dmbl file). Currently I use a partial class to validate the incoming input. For example public partial class User : IEntity { public NameValueCollection CheckModel() { return GetRuleViolations(); } /// <summary> /// Method validates incoming data, by given rules in the if statement. /// </summary> /// <returns>NameValueCollection</returns> private NameValueCollection GetRuleViolations() { NameValueCollection errors = new NameValueCollection(); if (string.IsNullOrEmpty(Username)) errors.Add("Username", "A username is required"); // and so on return errors; } } Now what I want to try to do is add validation attributes to the fields. For example I want to try to add the required attribute to the field Username instead/in addtion of using the validation I currently have. My question is how can I achieve this because the dmbl file is auto generated. Or maybe it is not possible and should I use a different approach?

    Read the article

  • Ajax actionlinks straight from a DropDownList

    - by Ingó Vals
    I've got a small linkbox on the side of my page that is rendered as a PartialView. In it I have a dropDownlist the should change the routing value of the links in the box but I'm having difficulty doing so. My current plan is to call on something similar to a Ajax.ActionLink to reload the partial view into the with a different parameter based on the value of the dropdown selection. However I'm having multiple problems with this, for example as a novice in using dropdownlists I have no idea how to call on the selected value for example. <%= Html.DropDownList("DropDownList1", new SelectList(Model, "ID", "Name"), "--Pick--", new { AutoPostBack = "true", onchange = "maybe something here" })%> I tried putting in the sys.mvc.AsyncHyperlink into the onchange attribute and that worked except I don't know how to put in the route value for it. Sys.Mvc.AsyncHyperlink.handleClick(this, new Sys.UI.DomEvent(event), { insertionMode: Sys.Mvc.InsertionMode.replace, updateTargetId: 'SmallMenu' } Is there no straight Ajax drop down list that fires events onchange? Any way this is possible? I have later in the Partial view the Ajax actionlinks but they need to have their id's updated by the value in the dropdownlist and if I could do that somehow else I would appreciate a suggestion.

    Read the article

  • Primefaces, JavaScript, and JSF does not work well together or am I doing something wrong

    - by Harry Pham
    Here is something so simple <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <input id="tom"/> When u click on the Tom, the textbox get focus. Great, now try this <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <h:inputText id="tom"/> <br/> when I click nothing happen, I check firebug, I see document.getElementById("tom") is null When I try to use jQuery $('#tom').focus(), nothing happen, no error, but did not get focus either. This is the response (not sure if this is the response from the server) when I see from firebug <?xml version="1.0" encoding="utf-8"?> <partial-response> <changes> <update id="javax.faces.ViewState"><![CDATA[455334589763307998:-2971181471269134244]]></update> </changes> <extension primefacesCallbackParam="validationFailed">{"validationFailed":false}</extension> </partial-response>

    Read the article

  • Problem with custom Equality in Entity Framework

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

  • Automatic INotifyPropertyChanged Implementation through T4 code generation?

    - by chrischu
    I'm currently working on setting up a new project of mine and was wondering how I could achieve that my ViewModel classes do have INotifyPropertyChanged support while not having to handcode all the properties myself. I looked into AOP frameworks but I think they would just blow up my project with another dependency. So I thought about generating the property implementations with T4. The setup would be this: I have a ViewModel class that declares just its Properties background variables and then I use T4 to generate the Property Implementations from it. For example this would be my ViewModel: public partial class ViewModel { private string p_SomeProperty; } Then T4 would go over the source file and look for member declarations named "p_" and generate a file like this: public partial class ViewModel { public string SomeProperty { get { return p_SomeProperty; } set { p_SomeProperty= value; NotifyPropertyChanged("SomeProperty"); } } } This approach has some advantages but I'm not sure if it can really work. So I wanted to post my idea here on StackOverflow as a question to get some feedback on it and maybe some advice how it can be done better/easier/safer.

    Read the article

  • entity framework POCO template in a n-tiers design question

    - by bryan
    HI all I was trying to follow the POCO Template walkthrough . And now I am having problems using it in n-tiers design. By following the article, I put my edmx model, and the template generated context.tt in my DAL project, and moved the generated model.tt entity classes to my Business Logic layer (BLL) project. By doing this, I could use those entities inside my BLL without referencing the DAL, I guess that is the idea of PI; without knowing anything about the data source. Now, I want to extend the entities (inside the model.tt) to perform some CUD action in the BLL project,so I added a new partial class same name as the one generated from template, public partial class Company { public static IEnumerable AllCompanies() { using(var context = new Entities()){ var q = from p in context.Companies select p; return q.ToList(); } } } however visual studio won't let me do that, and I think it was because the context.tt is in the DAL project, and the BLL project could not add a reference to the DAL project as DAL has already reference to the BLL. So I tried to added this class to the DAL and it compiled, but intelisense won't show up the BLL.Company.AllCompanies() in my web service method from my webservice project which has reference to my BLL project. What should I do now? I want to add CUD methods to the template generated entities in my BLL project, and call them in my web services from another project. I have been looking for this answer a few days already, and I really need some guides from here please. Bryan

    Read the article

  • can't get jquery livequery to with an update panel

    - by Jeremy
    I have some basic html inside an asp.net update panel. Using livequery, I set up autocomplete, blur and keydown events so that they all continue to be wired up after the update panel does a partial page load. When the page initially loads, all the events work fine but after the update panel does a partial page reload, none of the events wired up with livequery continue to work. Are there known issues with livequery and update panels? Html: <asp:UpdatePanel ID="upData" runat="server" UpdateMode="Conditional"> <ContentTemplate> <asp:DataList ID="dlData" runat="server" DataSource='<%# this.Data %>' DataKeyField="ID"> <ItemTemplate> <table> <tr> <th class="required">Location</th> <td><asp:TextBox ID="txtFromLocation" MaxLength="10" CssClass="searchlocation fromlocation required" runat="server" Text='<%# Eval("FromLocation")%>'/><asp:RequiredFieldValidator ID="rvalFromLocation" runat="server" ControlToValidate="txtFromLocation" ValidationGroup="leg">*</asp:RequiredFieldValidator></td> </tr> </table> </ItemTemplate> </asp:DataList> </ContentTemplate> </asp:UpdatePanel> And then I have my javascript. Normally it has a bunch of other code, but I can reduce it down to this and still have the problem: $(document).ready(function() { $(".searchlocation").livequery(function() { $(this).keydown(function(event) {alert('test');}); }); });

    Read the article

  • ASP.NET Content Web Form - content from placeholder disappears

    - by Naeem Sarfraz
    I'm attempting to set a class on the body tag in my asp.net site which uses a master page and content web forms. I simply want to be able to do this by adding a bodycssclass property (see below) to the content web form page directive. It works through the solution below but when i attempt to view Default.aspx the Content1 control loses its content. Any ideas why? Here is how I'm doing it. I have a master page with the following content: <%@ Master Language="C#" ... %> <html><head>...</head> <body id=ctlBody runat=server> <asp:ContentPlaceHolder ID="cphMain" runat="server" /> </body> </html> it's code behind looks like: public partial class Site : MasterPageBase { public override string BodyCssClass { get { return ctlBody.Attributes["class"]; } set { ctlBody.Attributes["class"] = value; } } } it inherits from: public abstract class MasterPageBase : MasterPage { public abstract string BodyCssClass { get; set; } } my default.aspx is defined as: <%@ Page Title="..." [master page definition etc..] bodycssclass="home" %> <asp:Content ID="Content1" ContentPlaceHolderID="cphMain" runat="server"> Some content </asp:Content> the code behind for this file looks like: public partial class Default : PageBase { ... } and it inherits from : public class PageBase : Page { public string BodyCssClass { get { MasterPageBase mpbCurrent = this.Master as MasterPageBase; return mpbCurrent.BodyCssClass; } set { MasterPageBase mpbCurrent = this.Master as MasterPageBase; mpbCurrent.BodyCssClass = value; } } }

    Read the article

  • WPF binding fails with custom add and remove accessors for INotifyPropertyChanged.PropertyChanged

    - by emddudley
    I have a scenario which is causing strange behavior with WPF data binding and INotifyPropertyChanged. I want a private member of the data binding source to handle the INotifyPropertyChanged.PropertyChanged event. I get some exceptions which haven't helped me debug, even when I have "Enable .NET Framework source stepping" checked in Visual Studio's options: A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.InvalidOperationException' occurred in PresentationCore.dll Here's the source code: XAML <Window xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="TestApplication.MainWindow" DataContext="{Binding RelativeSource={RelativeSource Self}}" Height="100" Width="100"> <StackPanel> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="A" /> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="B" /> </StackPanel> </Window> Normal implementation works public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; public MainWindow() { InitializeComponent(); } } Desired implementation doesn't work public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged { add { lock (this.mHandler) { this.mHandler.PropertyChanged += value; } } remove { lock (this.mHandler) { this.mHandler.PropertyChanged -= value; } } } public bool CheckboxIsChecked { get { return this.mHandler.CheckboxIsChecked; } set { this.mHandler.CheckboxIsChecked = value; } } private HandlesPropertyChangeEvents mHandler = new HandlesPropertyChangeEvents(); public MainWindow() { InitializeComponent(); } public class HandlesPropertyChangeEvents : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; } }

    Read the article

  • How to copy the shipping address to billing address

    - by Jerry
    Hi all I like to know if I can copy the shipping address to billing address. I got most of the parts done but I am not sure how to copy select menu (states) value to billing address. I really appreciate any helps. My code $(document).ready(function(){ Jquery $('#same').click(function(){ if($('#same').attr('checked')){ $('#bfName').val($('#fName').val()); $('#blName').val($('#lName').val()); $('#baddress1').val($('#address1').val()); $('#baddress2').val($('#address2').val()); $('#bcity').val($('#city').val()); alert(($('#state option:selected').val())); //not sure what to do here $('#bzip').val($('#zip').val()); }; }); Html <td><select name="state"> //shipping states......only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> <td><select name="bstate"> //billing state................only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> Thanks a lot!

    Read the article

  • How can I render a list of objects using DisplayFor but from the controller in ASP.NET MVC?

    - by Darragh
    Here's the scenaio, I have an Employee object and a Company object which has a list of employees. I have Company.aspx which inherits from ViewPage<Company>. In Company.aspx I call Html.DisplayFor(m => m.Employees). I have an Employee.ascx partial view which inherits from ViewUserControl<Employee in my DisplayTemplates folder. Everything works fine and Company.aspx renders the Employee.ascx partial for each employee. Now I have two additional methods on my controller called GetEmployees and GetEmployee(Id). In the GetEmployee(Id) action I want to return the markup to display this one employee, and in GetEmployees() I want to render the markup to display all the employees (these two action methods will be called via AJAX). In the GetEmployee action I call return PartialView("DisplayTemplates\Employee", employee) This works, although I'd prefer something like return PartialViewFor(employee) which would determine the view name by convention. Anwyay, my question is how should I implement the GetEmployees() action? I don't want to create any more views, because frankly, I don't see why I should have to. I've tried the following which fails miserably :) return Content(New HtmlHelper<IList<Of DebtDto>>(null, null).DisplayFor(m => debts)); However if I could create an instance of an HtmlHelper object in my controller, I suppose I could get it to work, but it feels wrong. Any ideas? Have i missed something obvious?

    Read the article

  • Rails 3.2 Ajax Update Div when Text Field Populated

    - by ctilley79
    In the end I would like a text field that passes a client_id to the partial. I would like to do this asynchronously so the shipment_products partial would dynamically change when the textfield value was updated. What is the best way to do this? In index.html.erb <!-- Text Field Here--> <div id="available_products"> <%= render "shipment_products" %> </div> In _shipment_products.html.erb <div id="shipment_products_container"> <h3>Assign Products to Ship<\h3> <ul class="shipment_products" id="shipment_products"> <% Product.by_client(client_id).each do |product|%> <!-- TextField value passed here --> <%= content_tag_for :li, product, :value => product.id do %> <%= hidden_field_tag("shipment[product_ids][]", product.id) %> <%= product.product_name %> <% end %> <% end %> <\ul> </div> This is similar to what I want in the end.

    Read the article

  • Ajax.BeginForm driving me crazy

    - by Fabio Milheiro
    ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Problem with custom Equality and GetHashCode in a mutable object

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. The problem is that when I hit save, the ID changes from 0 to its db value. So the question is how can I have an equatable object, being properly hashed. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

  • How do I expose the columns collection of GridView control that is inside a user control

    - by Christopher Edwards
    See edit. I want to be able to do this in the aspx that consumes the user control. <uc:MyControl ID="MyGrid" runat="server"> <asp:BoundField DataField="FirstColumn" HeaderText="FirstColumn" /> <asp:BoundField DataField="SecondColumn" HeaderText="SecondColumn" /> </uc> I have this code (which doesn't work). Any ideas what I am doing wrong? VB Partial Public Class MyControl Inherits UserControl <System.Web.UI.IDReferenceProperty(GetType(DataControlFieldCollection))> _ Public Property Columns() As DataControlFieldCollection Get Return MyGridView.Columns End Get Set(ByVal value As DataControlFieldCollection) ' The Columns collection of the GridView is ReadOnly, so I rebuild it MyGridView.Columns.Clear() For Each c As DataControlField In value MyGridView.Columns.Add(c) Next End Set End Property ... End Class C# public partial class MyControl : UserControl {         [System.Web.UI.IDReferenceProperty(typeof(DataControlFieldCollection))]     public DataControlFieldCollection Columns {         get { return MyGridView.Columns; }         set {             MyGridView.Columns.Clear();             foreach (DataControlField c in value) {                 MyGridView.Columns.Add(c);             }         }     } ... } EDIT: Actually it does work, but auto complete does not work between the uc:MyControl opening and closing tags and I get compiler warnings:- Content is not allowed between the opening and closing tags for element 'MyControl'. Validation (XHTML 1.0 Transitional): Element 'columns' is not supported. Element 'BoundField' is not a known element. This can occur if there is a compilation error in the Web site, or the web.config file is missing. So I guess I need to use some sort of directive to tell the complier to expect content between the tags. Any ideas?

    Read the article

  • Need advice on using Grails and Ajax to append to a div like in Rails

    - by Nate
    I'm just starting out in Grails and need some advice on using Ajax. I want to append some html to the bottom of a div inside a form. This is basically what I have: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields -/div- -form- -a-Add Child 4-/a- When I click on the "Add Child" I want to make an ajax call that results in a new childrow getting inserted into the "listOfchildren" div. So the document would look like this: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields childrow 4 input fields -/div- -form- -a-Add Child 5-/a- In Rails I would do something simple like this: render :update do |page| page.insert_html :bottom, "list_of_children", :partial = child_partial page.replace "add_link", :partial = 'add_link' end The previous code sends an javascript back to the browser with two commands. The first command tells the browser to append some html to the bottom of a div. The second command updates the "add link" counter. In grails I can only see how to replace an entire div (which would wipe out the user's existing input) and I don't see how I can call multiple functions from the ajax response. I can probably do this if I was to write some javascript functions in prototype or whatever, but I'd like to avoid that if there is a simpler way. Thanks! Nate

    Read the article

  • LINQ Datacontext Disposal Issues

    - by Refracted Paladin
    I am getting a Cannot access object: DataContext after it's been disposed in the below DAL method. I thought that I would be okay calling dispose there. result is an IEnumurable and I thought it was IQueryable that caused these kinds of problems. What am I doing wrong? How SHOULD I be disposing of my DataContext. Is there something better to be returning then a DataTable? This is a Desktop app that points at SQL 2005. Example method that causes this error -- public static DataTable GetEnrolledMembers(Guid workerID) { var DB = CmoDataContext.Create(); var AllEnrollees = from enrollment in DB.tblCMOEnrollments where enrollment.CMOSocialWorkerID == workerID || enrollment.CMONurseID == workerID join supportWorker in DB.tblSupportWorkers on enrollment.EconomicSupportWorkerID equals supportWorker.SupportWorkerID into workerGroup from worker in workerGroup.DefaultIfEmpty() select new { enrollment.ClientID, enrollment.CMONurseID, enrollment.CMOSocialWorkerID, enrollment.EnrollmentDate, enrollment.DisenrollmentDate, ESFirstName = worker.FirstName, ESLastName = worker.LastName, ESPhone = worker.Phone }; var result = from enrollee in AllEnrollees.AsEnumerable() where (enrollee.DisenrollmentDate == null || enrollee.DisenrollmentDate > DateTime.Now) //let memberName = BLLConnect.MemberName(enrollee.ClientID) let lastName = BLLConnect.MemberLastName(enrollee.ClientID) let firstName = BLLConnect.MemberFirstName(enrollee.ClientID) orderby enrollee.DisenrollmentDate ascending, lastName ascending select new { enrollee.ClientID, //MemberName = memberName, LastName = lastName, FirstName = firstName, NurseName = BLLAspnetdb.NurseName(enrollee.CMONurseID), SocialWorkerName = BLLAspnetdb.SocialWorkerName(enrollee.CMOSocialWorkerID), enrollee.EnrollmentDate, enrollee.DisenrollmentDate, ESWorkerName = enrollee.ESFirstName + " " + enrollee.ESLastName, enrollee.ESPhone }; DB.Dispose(); return result.CopyLinqToDataTable(); } partial class where I create the DataContext -- partial class CmoDataContext { public static bool IsDisconnectedUser { get { return Settings.Default.IsDisconnectedUser; } } public static CmoDataContext Create() { var cs = IsDisconnectedUser ? Settings.Default.CMOConnectionString : Settings.Default.Central_CMOConnectionString; return new CmoDataContext(cs); }

    Read the article

< Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >