Search Results

Search found 3176 results on 128 pages for 'parsing'.

Page 117/128 | < Previous Page | 113 114 115 116 117 118 119 120 121 122 123 124  | Next Page >

  • What is a good platform for building a game framework targetting both web and native languages?

    - by fuzzyTew
    I would like to develop (or find, if one is already in development) a framework with support for accelerated graphics and sound built on a system flexible enough to compile to the following: native ppc/x86/x86_64/arm binaries or a language which compiles to them javascript actionscript bytecode or a language which compiles to it (actionscript 3, haxe) optionally java I imagine, for example, creating an API where I can open windows and make OpenGL-like calls and the framework maps this in a relatively efficient manner to either WebGL with a canvas object, 3d graphics in Flash, OpenGL ES 2 with EGL, or desktop OpenGL in an X11, Windows, or Cocoa window. I have so far looked into these avenues: Building the game library in haXe Pros: Targets exist for php, javascript, actionscript bytecode, c++ High level, object oriented language Cons: No support for finally{} blocks or destructors, making resource cleanup difficult C++ target does not allow room for producing highly optimized libraries -- the foreign function interface requires all primitive types be boxed in a wrapper object, as if writing bindings for a scripting language; these feel unideal for real-time graphics and audio, especially exporting low-level functions. Doesn't seem quite yet mature Using the C preprocessor to create a translator, writing programs entirely with macros Pros: CPP is widespread and simple to use Cons: This is an arduous task and probably the wrong tool for the job CPP implementations differ widely in support for features (e.g. xcode cpp has no variadic macros despite claiming C99 compliance) There is little-to-no room for optimization in this route Using llvm's support for multiple backends to target c/c++ to web languages Pros: Can code in c/c++ LLVM is a very mature highly optimizing compiler performing e.g. global inlining Targets exist for actionscript (alchemy) and javascript (emscripten) Cons: Actionscript target is closed source, unmaintained, and buggy. Javascript targets do not use features of HTML5 for appropriate optimization (e.g. linear memory with typed arrays) and are immature An LLVM target must convert from low-level bytecode, so high-level constructs are lost and bloated unreadable code is created from translating individual instructions, which may be more difficult for an unprepared JIT to optimize. "jump" instructions cause problems for languages with no "goto" statements. Using libclang to write a translator from C/C++ to web languages Pros: A beautiful parsing library providing easy access to the code structure Can code in C/C++ Has sponsored developer effort from Apple Cons: Incomplete; current feature set targets IDEs. Basic operators are unexposed and must be manually parsed from the returned AST element to be identified. Translating code prior to compilation may forgo optimizations assumed in c/c++ such as inlining. Creating new code generators for clang to translate into web languages Pros: Can code in C/C++ as libclang Cons: There is no API; code structure is unstable A much larger job than using libclang; the innards of clang are complex Building the game library in Common Lisp Pros: Flexible, ancient, well-developed language Extensive introspection should ease writing translators Translators exist for at least javascript Cons: Unfamiliar language No standardized library functions, widely varying implementations Which of these avenues should I pursue? Do you know of any others, or any systems that might be useful? Does a general project like this exist somewhere already? Thank you for any input.

    Read the article

  • J2ME/Java: Referencing StringBuffer through Threads

    - by Jemuel Dalino
    This question might be long, but I want to provide much information. Overview: I'm creating a Stock Quotes Ticker app for Blackberry. But I'm having problems with my StringBuffer that contains an individual Stock information. Process: My app connects to our server via SocketConnection. The server sends out a formatted set of strings that contains the latest Stock trade. So whenever a new trade happens, the server will send out an individual Stock Quote of that trade. Through an InputStream I am able to read that information and place each character in a StringBuffer that is referenced by Threads. By parsing based on char3 I am able to determine a set of stock quote/information. char1 - to separate data char3 - means end of a stock quote/information sample stock quote format sent out by our server: stock_quote_name(char 1)some_data(char1)some_data(char1)(char3) My app then parses that stock quote to compare certain data and formats it how it will look like when displayed in the screen. When trades happen gradually(slow) the app works perfectly. However.. Problem: When trades happen too quickly and almost at the same time, My app is not able to handle the information sent efficiently. The StringBuffer has its contents combined with the next trade. Meaning Two stock information in one StringBuffer. field should be: Stock_quote_name some_data some_data sample of what's happening: Stock_quote_name some_data some_dataStock_quote_name some_data some_data here's my code for this part: while (-1 != (data = is.read())) { sb.append((char)data); while(3 != (data = is.read())) { sb.append((char)data); } UiApplication.getUiApplication().invokeLater(new Runnable() { public void run() { try { synchronized(UiApplication.getEventLock()) { SetStringBuffer(sb); DisplayStringBuffer(); RefreshStringBuffer(); } } catch (Exception e) { System.out.println("Error in setting stringbuffer: " + e.toString()); } } }); } public synchronized void DisplayStringBuffer() { try { //parse sb - string buffer ...... } catch(Exception ex) { System.out.println("error in DisplayStringBuffer(): " + ex.toString()); } } public synchronized void SetStringBuffer(StringBuffer dataBuffer) { this.sb =dataBuffer; System.out.println(sb); } public synchronized void RefreshStringBuffer() { this.sb.delete(0, this.sb.length()); } From what I can see, when trades happen very fast, The StringBuffer is not refreshed immediately and still has the contents of the previous trade, when i try to put new data. My Question is: Do you guys have any suggestion on how i can put data into the StringBuffer, without the next information being appended to the first content

    Read the article

  • Sort/Group XML data with PHP?

    - by Volmar
    I'm trying to make a page using data from the discogs.com (XML)-API. i've been parsing it with simpleXML and it's working pretty well but there is some things i'm not sure how to do. Here is part of the XML: <releases> <release id="1468764" status="Accepted" type="Main"> <title>Versions</title> <format>12", EP</format> <label>Not On Label</label> <year>1999</year> </release> <release id="72246" status="Accepted" type="Main"> <title>The M.O.F Blend</title> <format>LP</format> <label>Blenda Records</label> <year>2002</year> </release> <release id="890064" status="Accepted" type="Main"> <title>The M.O.F Blend</title> <format>CD</format> <label>Blenda Records</label> <year>2002</year> </release> <release id="1563561" status="Accepted" type="TrackAppearance"> <title>Ännu En Gång Vol. 3</title> <trackinfo>Backtrack</trackinfo> <format>Cass, Comp, Mix</format> <label>Hemmalaget</label> <year>2001</year> </release> </releases> What i want to achieve is something similair to how discogs presents the releases: http://www.discogs.com/artist/Mics+Of+Fury where diferent versions of the same release are sorted together. (see. The M.O.F Blend in my link) This is done on discogs with having a master release that features the other releases. unfortunately this information isn't present in the API data, so i want to do the same thing by grouping the <release>-nodes with the same <title>-tags, or add a flag to the <releases> that don't have a unique <title>? any good ideas on the best way of doing this? i also like to know if it's possible to count the <release>-nodes (child of releases) that have the same type-attribute? like in this example count the releases with the type "Main"? maybe it's better to do this things with XMLReader or XPath?

    Read the article

  • Cannot execute "LOAD DATA LOCAL INFILE" Mysql query in Rails after a connection reconnection

    - by Ngan
    On Rails 2.3.8 (but I think Rails 3 might have this issue as well, not sure): I get an error when trying to execute a LOAD DATA LOCAL INFILE query after reconnecting to a database. I have a process that parses a file that can potentially take a bit of time. During the parsing, Mysql closes the connection due to timeout. This is fine, I do a ActiveRecord::Base.verify_active_connections! and I get the connection back (I do this in several places through my app). However, running a LOAD DATA LOCAL INFILE statement, I get this error: Mysql::Error: The used command is not allowed with this MySQL version It's not a permission issue, I know that for sure. Check out my test in console: ActiveRecord::Base.connection.execute("LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users") [Sat Jan 08 00:09:29 2011] (9990) SQL (1.7ms) LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users => nil > ActiveRecord::Base.connection.disconnect! => #<Mysql:0x104c6f890> > ActiveRecord::Base.verify_active_connections! [Sat Jan 08 00:09:58 2011] (9990) SQL (0.2ms) SET SQL_AUTO_IS_NULL=0 => {...connection stuff...} > ActiveRecord::Base.connection.execute("LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users") [Sat Jan 08 00:10:00 2011] (9990) SQL (0.0ms) Mysql::Error: The used command is not allowed with this MySQL version: LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users ActiveRecord::StatementInvalid: Mysql::Error: The used command is not allowed with this MySQL version: LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users from ~/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract_adapter.rb:221:in `log' from ~/gems/activerecord-2.3.8/lib/active_record/connection_adapters/mysql_adapter.rb:323:in `execute' from (irb):6 I am able to do other queries like SELECT and whatnot, and I will get the correct result. It's just this one that giving me the error. I even tested this with a fresh rails app. You'll notice that I am able to do the exact same query before the disconnect. Thanks for the help!

    Read the article

  • Is it possible to read infinity or NaN values using input streams?

    - by Drise
    I have some input to be read by a input filestream (for example): -365.269511 -0.356123 -Inf 0.000000 When I use std::ifstream mystream; to read from the file to some double d1 = -1, d2 = -1, d3 = -1, d4 = -1; (assume mystream has already been opened and the file is valid), mystream >> d1 >> d2 >> d3 >> d4; mystream is in the fail state. I would expect std::cout << d1 << " " << d2 << " " << d3 << " " << d4 << std::endl; to output -365.269511 -0.356123 -1 -1. I would want it to output -365.269511 -0.356123 -Inf 0 instead. This set of data was output using C++ streams. Why can't I do the reverse process (read in my output)? How can I get the functionality I seek? From MooingDuck: #include <iostream> #include <limits> using namespace std; int main() { double myd = std::numeric_limits<double>::infinity(); cout << myd << '\n'; cin >> myd; cout << cin.good() << ":" << myd << endl; return 0; } Input: inf Output: inf 0:inf See also: http://ideone.com/jVvei Also related to this problem is NaN parsing, even though I do not give examples for it.

    Read the article

  • PDF Report generation

    - by IniTech
    EDIT : I completed this project using ABCpdf. For anyone interested, I love this product and their support is A+. Everything I listed as a 'Con' for the HTML - PDF solution was easily doable in ABCpdf. I've been charged with creating a data driven pdf report. After reviewing the plethora of options, I have narrowed it down to 2. I need you all to to help me decide, or offer alternatives I haven't considered. Here are the requirements: 100% Data driven Eventually PDF (a stop in HTML is fine, so long as it is converted) Can be run with multiple sets of data (the layout is always the same, the data is variable) Contains normal analysis-style copy (saved in DB with html markup) Contains tables (data for tables is generated at run-time) Header/Page # on each page Table of Contents .NET (VB or C#) Done quickly Now, because of the fact that the report is going to be generated with multiple sets of data, I don't think a stamped pdf template will work since I won't know how long or how many pages a certain piece of the report could require. So, I think my best options are: Programmatic creation using an iText-like solution. Generate in HTML and convert to PDF using a third-party application (ABCPdf is the tool I have played with so far) Both solutions have their pro's and con's. Programmatic solution: Pros: Flexible Easy page numbering/page header/table of contents Free Cons: Time consuming (to write a layer on top of iText to do what I need and keep maintainable) Since the copy is already stored in the db with html markup, I would have to parse through the data before I place it into the pdf, ensuring I don't have to break the paragraph into chunks so I can apply bold, italic, underline, etc. to specific phrases. This seems like a huge PITA, and I hope I am wrong about that assumption. HTML - PDF Pros: Easy to generate from db (no parsing necessary) Many tools for conversion Uses technology I am already familiar with Built-in "Print Preview" - not a req, but nice Cons: (Edited after project completion. All of my assumptions were incorrect and ABCpdf is awesome) 1. Almost impossible to generate page headers - Not True 2. Very difficult to generate page numbers Not True 3. Nearly impossible to generate table of contents Not True 4. (Cross-browser support isn't a con; Since its internal, I can dictate what browser to use) 5. Conversion tool quirks - may not convert exactly as rendered in browser Not True 6. Overall, I think it would be very hard to format the HTML exactly as I would want it to appear/convert to PDF. Not True That's it - I need the communitys help in deciding which way I should go. I might be wrong about some of my Pro/Con assumptions. If I am, please tell me. All thoughts and suggestions are welcome and appreciated. Thanks

    Read the article

  • Convert NSData into Hex NSString

    - by Dawson
    With reference to the following question: Convert NSData into HEX NSSString I have solved the problem using the solution provided by Erik Aigner which is: NSData *data = ...; NSUInteger capacity = [data length] * 2; NSMutableString *stringBuffer = [NSMutableString stringWithCapacity:capacity]; const unsigned char *dataBuffer = [data bytes]; NSInteger i; for (i=0; i<[data length]; ++i) { [stringBuffer appendFormat:@"%02X", (NSUInteger)dataBuffer[i]]; } However, there is one small problem in that if there are extra zeros at the back, the string value would be different. For eg. if the hexa data is of a string @"3700000000000000", when converted using a scanner to integer: unsigned result = 0; NSScanner *scanner = [NSScanner scannerWithString:stringBuffer]; [scanner scanHexInt:&result]; NSLog(@"INTEGER: %u",result); The result would be 4294967295, which is incorrect. Shouldn't it be 55 as only the hexa 37 is taken? So how do I get rid of the zeros? EDIT: (In response to CRD) Hi, thanks for clarifying my doubts. So what you're doing is to actually read the 64-bit integer directly from a byte pointer right? However I have another question. How do you actually cast NSData to a byte pointer? To make it easier for you to understand, I'll explain what I did originally. Firstly, what I did was to display the data of the file which I have (data is in hexadecimal) NSData *file = [NSData dataWithContentsOfFile:@"file path here"]; NSLog(@"Patch File: %@",file); Output: Next, what I did was to read and offset the first 8 bytes of the file and convert them into a string. // 0-8 bytes [file seekToFileOffset:0]; NSData *b = [file readDataOfLength:8]; NSUInteger capacity = [b length] * 2; NSMutableString *stringBuffer = [NSMutableString stringWithCapacity:capacity]; const unsigned char *dataBuffer = [b bytes]; NSInteger i; for (i=0; i<[b length]; ++i) { [stringBuffer appendFormat:@"%02X", (NSUInteger)dataBuffer[i]]; } NSLog(@"0-8 bytes HEXADECIMAL: %@",stringBuffer); As you can see, 0x3700000000000000 is the next 8 bytes. The only changes I would have to make to access the next 8 bytes would be to change the value of SeekFileToOffset to 8, so as to access the next 8 bytes of data. All in all, the solution you gave me is useful, however it would not be practical to enter the hexadecimal values manually. If formatting the bytes as a string and then parsing them is not the way to do it, then how do I access the first 8 bytes of the data directly and cast them into a byte pointer?

    Read the article

  • Parallel programming in C#

    - by Alxandr
    I'm interested in learning about parallel programming in C#.NET (not like everything there is to know, but the basics and maybe some good-practices), therefore I've decided to reprogram an old program of mine which is called ImageSyncer. ImageSyncer is a really simple program, all it does is to scan trough a folder and find all files ending with .jpg, then it calculates the new position of the files based on the date they were taken (parsing of xif-data, or whatever it's called). After a location has been generated the program checks for any existing files at that location, and if one exist it looks at the last write-time of both the file to copy, and the file "in its way". If those are equal the file is skipped. If not a md5 checksum of both files is created and matched. If there is no match the file to be copied is given a new location to be copied to (for instance, if it was to be copied to "C:\test.jpg" it's copied to "C:\test(1).jpg" instead). The result of this operation is populated into a queue of a struct-type that contains two strings, the original file and the position to copy it to. Then that queue is iterated over untill it is empty and the files are copied. In other words there are 4 operations: 1. Scan directory for jpegs 2. Parse files for xif and generate copy-location 3. Check for file existence and if needed generate new path 4. Copy files And so I want to rewrite this program to make it paralell and be able to perform several of the operations at the same time, and I was wondering what the best way to achieve that would be. I've came up with two different models I can think of, but neither one of them might be any good at all. The first one is to parallelize the 4 steps of the old program, so that when step one is to be executed it's done on several threads, and when the entire of step 1 is finished step 2 is began. The other one (which I find more interesting because I have no idea of how to do that) is to create a sort of worker and consumer model, so when a thread is finished with step 1 another one takes over and performs step 2 at that object (or something like that). But as said, I don't know if any of these are any good solutions. Also, I don't know much about parallel programming at all. I know how to make a thread, and how to make it perform a function taking in an object as its only parameter, and I've also used the BackgroundWorker-class on one occasion, but I'm not that familiar with any of them. Any input would be appreciated.

    Read the article

  • Calling a function that resides in the main page from a plugin?

    - by Justin Lee
    I want to call a function from within plugin, but the function is on the main page and not the plugin's .js file. EDIT I have jQuery parsing a very large XML file and building, subsequently, a large list (1.1 MB HTML file when dynamic content is copied, pasted, then saved) that has expand/collapse functionality through a plugin. The overall performance on IE is super slow and doggy, assuming since the page/DOM is so big. I am currently trying to save the collapsed content in the event.data when it is collapsed and remove it from the DOM, then bring it back when it is told to expand... the issue that I am having is that when I bring the content back, obviously the "click" and "hover" events are gone. I'm trying to re-assign them, currently doing so inside the plugin after the plugin expands the content. The issue then though is that is says the function that I declare within the .click() is not defined. Also the hover event doesn't seem to be re-assigning either.... if ($(event.data.trigger).attr('class').indexOf('collapsed') != -1 ) { // if expanding // console.log(event.data.targetContent); $(event.data.trigger).after(event.data.targetContent); $(event.data.target).hide(); /* This Line --->*/ $(event.data.target + 'a.addButton').click(addResourceToList); $(event.data.target + 'li.resource') .hover( function() { if (!($(this).attr("disabled"))) { $(this).addClass("over"); $(this).find("a").css({'display':'block'}); } }, function () { if (!($(this).attr("disabled"))) { $(this).removeClass("over"); $(this).children("a").css({'display':'none'}); } } ); $(event.data.target).css({ "height": "0px", "padding-top": "0px", "padding-bottom": "0px", "margin-top": "0px", "margin-bottom": "0px"}); $(event.data.target).show(); $(event.data.target).animate({ height: event.data.heightVal + "px", paddingTop: event.data.topPaddingVal + "px", paddingBottom: event.data.bottomPaddingVal + "px", marginTop: event.data.topMarginVal + "px", marginBottom: event.data.bottomMarginVal + "px"}, "normal");//, function(){$(this).hide();}); $(event.data.trigger).removeClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'expanded', {hoursToLive: 24 * 365}); } else if ($(event.data.trigger).attr('class').indexOf('collapsed') == -1 ) { // if collapsing $(event.data.target).animate({ height: "0px", paddingTop: "0px", paddingBottom: "0px", marginTop: "0px", marginBottom: "0px"}, "normal", function(){$(this).hide();$(this).remove();}); $(event.data.trigger).addClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'collapsed', {hoursToLive: 24 * 365}); } EDIT So, having new eyes truly makes a difference. As I was reviewing the code in this post this morning after being away over the weekend, I found where I had err'd. This: $(event.data.target + 'a.addButton').click(addResourceToList); Should be this (notice the space before a.addbutton): $(event.data.target + ' a.addButton').click(addResourceToList); Same issue with the "li.resource". So it was never pointing to the right elements... Thank you, Rene, for your help!!

    Read the article

  • What regular expression(s) would I use to remove escaped html from large sets of data.

    - by Elizabeth Buckwalter
    Our database is filled with articles retrieved from RSS feeds. I was unsure of what data I would be getting, and how much filtering was already setup (WP-O-Matic Wordpress plugin using the SimplePie library). This plugin does some basic encoding before insertion using Wordpress's built in post insert function which also does some filtering. I've figured out most of the filters before insertion, but now I have whacko data that I need to remove. This is an example of whacko data that I have data in one field which the content I want in the front, but this part removed which is at the end: <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:V_sGLiPBpWU" border="0"></img> <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?d=qj6IDK7rITs" border="0"></img> &lt;img src=&quot;http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:D7DqB2pKExk&quot; Notice how some of the images are escape and some aren't. I believe this has to do with the last part being cut off so as to be unrecognizable as an html tag, which then caused it to be html endcoded. Another field has only this which is now filtered before insertion, but I have to get rid of the others: &lt;img src=&quot;http://farm3.static.flickr.com/2183/2289902369_1d95bcdb85.jpg&quot; alt=&quot;post_img&quot; width=&quot;80&quot; (all examples are on one line, but broken up for readability) Question: What is the best way to work with the above escaped html (or portion of an html tag)? I can do it in Perl, PHP, SQL, Ruby, and even Python. I believe Perl to be the best at text parsing, so that's why I used the Perl tag. And PHP times out on large database operations, so that's pretty much out unless I wanted to do batch processing and what not. PS One of the nice things about using Wordpress's insert post function, is that if you use php's strip_tags function to strip out all html, insert post function will insert <p> at the paragraph points. Let me know if there's anything more that I can answer. Some article that didn't quite answer my questions. (http://stackoverflow.com/questions/2016751/remove-text-from-within-a-database-text-field) (http://stackoverflow.com/questions/462831/regular-expression-to-escape-html-ampersands-while-respecting-cdata)

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • zlib gzgets extremely slow?

    - by monkeyking
    I'm doing stuff related to parsing huge globs of textfiles, and was testing what input method to use. There is not much of a difference using c++ std::ifstreams vs c FILE, According to the documentation of zlib, it supports uncompressed files, and will read the file without decompression. I'm seeing a difference from 12 seconds using non zlib to more than 4 minutes using zlib.h This I've tested doing multiple runs, so its not a disk cache issue. Am I using zlib in some wrong way? thanks #include <zlib.h> #include <cstdio> #include <cstdlib> #include <fstream> #define LENS 1000000 size_t fg(const char *fname){ fprintf(stderr,"\t-> using fgets\n"); FILE *fp =fopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(NULL!=fgets(buffer,LENS,fp)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t is(const char *fname){ fprintf(stderr,"\t-> using ifstream\n"); std::ifstream is(fname,std::ios::in); size_t nLines =0; char *buffer = new char[LENS]; while(is. getline(buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t iz(const char *fname){ fprintf(stderr,"\t-> using zlib\n"); gzFile fp =gzopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(0!=gzgets(fp,buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } int main(int argc,char**argv){ if(atoi(argv[2])==0) fg(argv[1]); if(atoi(argv[2])==1) is(argv[1]); if(atoi(argv[2])==2) iz(argv[1]); }

    Read the article

  • StringBuffer wont read whole stream into a string (JAVA/Android)

    - by Levara
    Hi all! I'm making an android program that retrieves content of a webpage using HttpURLConnection. I'm new to both Java and Android. Problem is: Reader reads whole page source, but in the last while iteration it doesn't append to stringBuffer that last part. Using debbuger I have determined that, in the last loop iteration, string buff is created, but stringBuffer just doesnt append it. I need to parse retrieved content. Is there any better way to handle the content for parsing than using strings. I've read on numerous other sites that string size in Java is limited only by available heap size. I've tried with StringBuilder too. Anyone know what could be the problem. Btw feel free to suggest any improvements to the code. Thanks! URL u; try { u = new URL("http://feeds.timesonline.co.uk/c/32313/f/440134/index.rss"); HttpURLConnection c = (HttpURLConnection) u.openConnection(); c.setRequestProperty("User-agent","Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.1; SV1; .NET CLR 1.1.4322; InfoPath.1; .NET CLR 2.0.50727)"); c.setRequestMethod("GET"); c.setDoOutput(true); c.setReadTimeout(3000); c.connect(); StringBuffer stringBuffer = new StringBuffer(""); InputStream in = c.getInputStream(); InputStreamReader inp = new InputStreamReader(in); BufferedReader reader = new BufferedReader(inp); char[] buffer = new char[3072]; int len1 = 0; while ( (len1 = reader.read(buffer)) != -1 ) { String buff = new String(buffer,0,len1); stringBuffer.append(buff); } String stranica = new String(stringBuffer); c.disconnect(); reader.close(); inp.close(); in.close();

    Read the article

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • cellForRowAtIndexPath called too late

    - by Mihai Fonoage
    Hi, I am trying to re-load a table every time some data I get from the web is available. This is what I have: SearchDataViewController: - (void)parseDatatXML { parsingDelegate = [[XMLParsingDelegate alloc] init]; parsingDelegate.searchDataController = self; // CONTAINS THE TABLE THAT NEEDS RE-LOADING; ImplementedSearchViewController *searchController = [[ImplementedSearchViewController alloc] initWithNibName:@"ImplementedSearchView" bundle:nil]; ProjectAppDelegate *delegate = [[UIApplication sharedApplication] delegate]; UINavigationController *nav = (UINavigationController *)[delegate.splitViewController.viewControllers objectAtIndex: 0]; NSArray *viewControllers = [[NSArray alloc] initWithObjects:nav, searchController, nil]; self.splitViewController.viewControllers = viewControllers; [viewControllers release]; // PASS A REFERENCE TO THE PARSING DELEGATE SO THAT IT CAN CALL reloadData on the table parsingDelegate.searchViewController = searchController; [searchController release]; // Build the url request used to fetch data ... NSURLRequest *dataURLRequest = [NSURLRequest requestWithURL:[NSURL URLWithString:dataURL]]; parsingDelegate.feedConnection = [[[NSURLConnection alloc] initWithRequest:dataURLRequest delegate:parsingDelegate] autorelease]; } ImplementedSearchViewController: - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { NSLog(@"count = %d", [keys count]); // keys IS A NSMutableArray return [self.keys count]; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { ... cell.textLabel.text = [keys objectAtIndex:row]; ... } XMLParsingDelgate: -(void) updateSearchTable:(NSArray *)array { ... [self.currentParseBatch addObject:(NSString *)[array objectAtIndex:1]]; // RELOAD TABLE [self.searchViewController.table reloadData]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qualifiedName attributes:(NSDictionary *)attributeDict { if ([elementName isEqualToString:@"..."]) { self.currentParseBatch = [NSMutableArray array]; searchViewController.keys = self.currentParseBatch; ... } ... } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName { if ([elementName isEqualToString:@"..."]) { ... [self performSelectorOnMainThread:@selector(updateSearchTable:) withObject:array waitUntilDone:NO]; } ... } My problem is that when I debug, the calls go between reloadData and numberOfRowsInSection until the keys array is filled with the last data, time at which the cellForRowAtIndexPath gets called. I wanted the table to be updated for each element I send, one by one, instead of just in the end. Any ideas why this behavior? Thank you!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • Having problems creating an array from XML data in Acrobat Javascript, please help if you can

    - by Kevin Minke
    I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

    Read the article

  • C# Getting a node with attributes from SelectSingleNode

    - by bdefreese
    Hi folks, I am quite the n00b but lately I have been playing with parsing some XML data. I actually found a nice feature on this site where I can get to a specific node with a specific attribute by doing: docFoo.SelectSingleNode("foo/bar/baz[@name='qux']); However, the data looks like this: <saving-throws> <saving-throw> <name>Fortitude</name> <abbr>Fort</abbr> <ability>Con</ability> <modifiers> <modifier name="base" value="2"/> <modifier name="ability" value="5"/> <modifier name="magic" value="0"/> <modifier name="feat" value="0"/> <modifier name="race" value="0"/> <modifier name="familar" value="0"/> <modifier name="feature" value="0"/> <modifier name="user" value="0"/> <modifier name="misc" value="0"/> </modifiers> </saving-throw> <saving-throw> <name>Reflex</name> <abbr>Ref</abbr> <ability>Dex</ability> <modifiers> <modifier name="base" value="6"/> <modifier name="ability" value="1"/> <modifier name="magic" value="0"/> <modifier name="feat" value="0"/> <modifier name="race" value="0"/> <modifier name="familar" value="0"/> <modifier name="feature" value="0"/> <modifier name="user" value="0"/> <modifier name="misc" value="0"/> </modifiers> </saving-throw> And I want to be able to get the node with name=base but for each saving-throw node where childnode "abbr" = xx. Can I somehow do that in a single SelectSingleNode or am I going to have to stop at saving throw and walk through the rest of the tree? Thanks!

    Read the article

  • What are the steps to convert this function to a model/controller in Zend Framework?

    - by Joel
    Hi guys, I'm learning Zend Framework MVC, and I have a website that is mainly static php pages. However one of the pages is using functions, etc, and I'm trying to figure out what the process is for converting this to an OOP setup. Within the <body> I have this function (and more, but this is the first function): function filterEventDetails($contentText) { $data = array(); foreach($contentText as $row) { if(strstr($row, 'When: ')) { ##cleaning "when" string to get date in the format "May 28, 2009"## $data['duration'] = str_replace('When: ','',$row); list($when, ) = explode(' to ',$data['duration']); $data['when'] = substr($when,4); if(strlen($data['when'])>13) $data['when'] = trim(str_replace(strrchr($data['when'], ' '),'',$data['when'])); $data['duration'] = substr($data['duration'], 0, strlen($data['duration'])-4); //trimming time zone identifier (UTC etc.) } if(strstr($row, 'Where: ')) { $data['where'] = str_replace('Where: ','',$row); //pr($row); //$where = strstr($row, 'Where: '); //pr($where); } if(strstr($row, 'Event Description: ')) { $event_desc = str_replace('Event Description: ','',$row); //$event_desc = strstr($row, 'Event Description: '); ## Filtering event description and extracting venue, ticket urls etc from it. //$event_desc = str_replace('Event Description: ','',$contentText[3]); $event_desc_array = explode('|',$event_desc); array_walk($event_desc_array,'get_desc_second_part'); //pr($event_desc_array); $data['venue_url'] = $event_desc_array[0]; $data['details'] = $event_desc_array[1]; $data['tickets_url'] = $event_desc_array[2]; $data['tickets_button'] = $event_desc_array[3]; $data['facebook_url'] = $event_desc_array[4]; $data['facebook_icon'] = $event_desc_array[5]; } } return $data; } ?> So right now I have this in my example.phtml view page. I understand this needs to be a model and acted on by the controller, but I'm really not sure where to start with this conversion? This is a function tht is taking info from a Google calendar and parsing it for the view. Thanks for any help!

    Read the article

  • ANSI C as core of a C# project? Is this possible?

    - by Nektarios
    I'm writing a NON-GUI app which I want to be cross platform between OS X and Windows. I'm looking at the following architecture, but I don't know if it will work on the windows side: (Platform specific entry point) - ANSI C main loop = ANSI C model code doing data processing / logic = (Platform specific helpers) So the core stuff I'm planning to write in regular ANSI C, because A) it should be platform independent, B) I'm extremely comfortable with C, C) It can do the job and do it well (Platform specific entry point) can be written in whatever necessary to get the job done, this is a small amount of code, doesn't matter to me. (Platform specific helpers) is the sticky thing. This is stuff like parsing XML, accessing databases, graphics toolkit stuff, whatever. Things that aren't easy in C. Things that modern languages/frameworks will give for free. On OS X this code will be written in Objective-C interfacing with Cocoa. On Windows I'm thinking my best bet is to use C# So on Windows my architecture (simplified) looks like (C# or C?) - ANSI C - C# Is this possible? Some thoughts/suggestions so far.. 1) Compile my C core as a .dll -- this is fine, but seems there's no way to call my C# helpers unless I can somehow get function pointers and pass them to my core, but that seems unlikely 2) Compile a C .exe and a C# .exe and have them talk via shared memory or some kind of IPC. I'm not entirely opposed to this but it obviously introduces a lot of complexity so it doesn't seem ideal 3) Instead of C# use C++, it gets me some nice data management stuff and nice helper code. And I can mix it pretty easily. And the work I do could probably easily port to Linux. But I really don't like C++, and I don't want this to turn in to a 3rd-party-library-fest. Not that it's a huge deal, but it's 2010.. anything for basic data management should be built in. And targetting Linux is really not a priority. Note that no "total" alternatives are OK as suggested in other similar questions on SO I've seen; java, RealBasic, mono.. this is an extremely performance intensive application doing soft realtime for game/simulation purposes, I need C & friends here to do it right (maybe you don't, but I do)

    Read the article

  • How to manually (bitwise) perform (float)x? (homework)

    - by Silver
    Now, here is the function header of the function I'm supposed to implement: /* * float_from_int - Return bit-level equivalent of expression (float) x * Result is returned as unsigned int, but * it is to be interpreted as the bit-level representation of a * single-precision floating point values. * Legal ops: Any integer/unsigned operations incl. ||, &&. also if, while * Max ops: 30 * Rating: 4 */ unsigned float_from_int(int x) { ... } We aren't allowed to do float operations, or any kind of casting. Now I tried to implement the first algorithm given at this site: http://locklessinc.com/articles/i2f/ Here's my code: unsigned float_from_int(int x) { // grab sign bit int xIsNegative = 0; int absValOfX = x; if(x < 0){ xIsNegative = 1; absValOfX = -x; } // zero case if(x == 0){ return 0; } //int shiftsNeeded = 0; /*while(){ shiftsNeeded++; }*/ unsigned I2F_MAX_BITS = 15; unsigned I2F_MAX_INPUT = ((1 << I2F_MAX_BITS) - 1); unsigned I2F_SHIFT = (24 - I2F_MAX_BITS); unsigned result, i, exponent, fraction; if ((absValOfX & I2F_MAX_INPUT) == 0) result = 0; else { exponent = 126 + I2F_MAX_BITS; fraction = (absValOfX & I2F_MAX_INPUT) << I2F_SHIFT; i = 0; while(i < I2F_MAX_BITS) { if (fraction & 0x800000) break; else { fraction = fraction << 1; exponent = exponent - 1; } i++; } result = (xIsNegative << 31) | exponent << 23 | (fraction & 0x7fffff); } return result; } But it didn't work (see test error below): Test float_from_int(-2147483648[0x80000000]) failed... ...Gives 0[0x0]. Should be -822083584[0xcf000000] 4 4 0 float_times_four I don't know where to go from here. How should I go about parsing the float from this int?

    Read the article

< Previous Page | 113 114 115 116 117 118 119 120 121 122 123 124  | Next Page >