Search Results

Search found 3649 results on 146 pages for 'aziz light'.

Page 12/146 | < Previous Page | 8 9 10 11 12 13 14 15 16 17 18 19  | Next Page >

  • RelayCommands overriding the "IsEnabled" of my buttons.

    - by vidalsasoon
    RelayCommands overriding the "IsEnabled" of my buttons. Is this is a bug? Here is xaml from my View and code from my ViewModel <Button Grid.Column="0" Content="Clear" IsEnabled="False" cmd:ButtonBaseExtensions.Command="{Binding ClearCommand}" /> public RelayCommand ClearCommand { get { return new RelayCommand(() => MessageBox.Show("Clear Command")); } } Notice I hardcoded the IsEnabled="False" in my xaml. This value is completely ignored (button always enabled). I realize that RelayCommand have a CanExecute overload but I did want to use this as I want to do more than just have a disabled button.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Menu bars are a basic light gray after installing graphics card driver. [closed]

    - by Jonathan
    Possible Duplicate: Desktop forgets theme? Hi, I've just installed Ubuntu 10.10 64-bit. It came up saying I could install 2 proprietary drivers, one for my WiFi adapter (which works perfectly) and one for my graphics card - a Sapphire AIT Radeon HD 5770 1024MB GDDR5 PCI-Express Graphics Card. The driver is called ATI/AMD proprietary FGLRX graphics driver. Before installing this driver I was unable to have Extra Visual Effects in Appearances. However after installing (and restarting) the menu bars are now in a basic light gray mode, rather than the sleek Ubuntu black. - Although Extra Visual Effects does now work. I've tried rebooting, and I've had a look around in ATI "Catalyst Control Center" but nothing has worked so far. Does anybody know what this windows mode is, how to change it back to normal and why it's doing it in the first place? Below is a screenshot of my computer: (This is also the first time I've installed Ubuntu on my computer, and am keen for it to work.)

    Read the article

  • how to access anti aliasing method of a font with CSS

    - by Daniel Ramirez-Escudero
    I've had this problem in a lot of different webs. You have a font which has different anti-aliasing options, the designer uses the same font with different anti-aliasing options on different parts of the text on the web. So there is a difference between some elements. In this case I have sharp, crisp, strong and smooth. I've used a font generator to get the code to access it via @font-face. Even so, I also have the original .otf if important to know. Is there a method to access this? I upload a picture of what I mean and my actual code: ![@font-face { font-family: 'light'; src: url('../_fnt/light/gothamrnd-light.eot'); src: url('../_fnt/light/gothamrnd-light.eot?#iefix') format('embedded-opentype'), url('../_fnt/light/gothamrnd-light.woff') format('woff'), url('../_fnt/light/gothamrnd-light.ttf') format('truetype'), url('../_fnt/light/gothamrnd-light.svg#../_fnt/light/gothamrnd-light') format('svg'); font-weight: normal; font-style: normal; }]![enter image description here][1]

    Read the article

  • how to center align a light box and hide a scrollbar.

    - by Mayur
    Hi All, I m web designer and getting problem in adjustment of light box. light box is not center aligned at any resolution. it should be center aligned at any resolution. and i used a black overlay for transparency in background but it shows scrollbars in light box so its not look good .... plz tell how could i center align a lightbox and hide a scrollbar .......... Thanks Mayur

    Read the article

  • Why does my monitor have a black screen but the power light is blinking green?

    - by Chris Vesper
    I have a ViewSonic VA912b 19" display I use as a secondary monitor. When I turn it on, the power light is green for a few seconds, and then switches to blinking green. The display stays black. Windows thinks the monitor is on, as it shows up in the control panel as a second monitor. If I unplug the DVI cable, it displays a "No Signal" message and the power light goes to amber, which means it went to sleep.

    Read the article

  • Content light website and Google - Tell google it's a listings site (as opposed shop, reviews or restaurants)

    - by Doug Firr
    I have a listings style website. Due to the nature of this (listings) the site is content light. Each page is typically less that 50 words but there are many pages. The site in question has had a ton of media coverage and so has some great inbound links from places like Wired, Fast Company, Canada Broadcasting Corporation and many many other bloggers, media websites and recycle related niche authors (It's a recycling site). But Google really ignores it. Traffic from search is very very low - less than 5% of all traffic. I know that using markup you can tell Google whether your site is a restaurant, article, review, shop, local business and a few other categories (https://www.google.com/webmasters/markup-helper/u/0/). Is there a way to tell Google that my site is a listings site? I suspect, but do not know for sure, that part of the problem is that Google simply does not know what my site is? It's a crowdmap where people post curbalerts. The information is useful to people but it is presented in a short, concise way - a pin on a map, a picture and a short description. Adding anything further is not necessary for the site's intended purpose. 1st question - how best to tell the search engines what y site is - listings and not some spammy website? Any recommendations in improving our site's Search presence? You can take a look here if interested: http://tinyurl.com/lxg4hn7

    Read the article

  • Oracle bleibt auch 2011 Spitzenreiter im Bereich Datenbanken

    - by Anne Manke
    Mit der Veröffentlichung der aktuellen Ausgabe "Market Share: All Software Markets, Worldwide 2011" bestätigt das weltweit führende Marktanalyseunternehmen Gartner Oracle's Marktführerschaft im Bereich der Relationellen Datenbank Management Systeme (RDBMS). Oracle konnte innerhalb des letzten Jahres seinen Abstand zu seinen Marktbegleitern im Bereich der RDBMS mit einem stabilen Wachstum von 18% sogar ausbauen: der Marktanteil stieg im Jahr 2010 von 48,2% auf 48,8% im Jahr 2011. Damit ist der Abstand zu Oracle's stärkstem Verfolger IBM auf 28,6%.   Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:12.0pt; mso-para-margin-left:0cm; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2 {mso-style-name:"Light List - Accent 2"; mso-tstyle-rowband-size:1; mso-tstyle-colband-size:1; mso-style-priority:61; mso-style-unhide:no; border:solid #C0504D 1.0pt; mso-border-themecolor:accent2; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2FirstRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-shading:#C0504D; mso-tstyle-shading-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; color:white; mso-themecolor:background1; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:2.25pt double #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2FirstCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2OddColumn {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-column; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} table.MsoTableLightListAccent2OddRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} Revenue 2010 ($USM) Revenue 2011 ($USM) Growth 2010 Growth 2011 Share 2010 Share 2011 Oracle 9,990.5 11,787.0 10.9% 18.0% 48.2% 48.8% IBM 4,300.4 4,870.4 5.4% 13.3% 20.7% 20.2% Microsoft 3,641.2 4,098.9 10.1% 12.6% 17.6% 17.0% SAP/Sybase 744.4 1,101.1 12.8% 47.9% 3.6% 4.6% Teradata 754.7 882.3 16.9% 16.9% 3.6% 3.7% Source: Gartner’s “Market Share: All Software Markets, Worldwide 2011,” March 29, 2012, By Colleen Graham, Joanne Correia, David Coyle, Fabrizio Biscotti, Matthew Cheung, Ruggero Contu, Yanna Dharmasthira, Tom Eid, Chad Eschinger, Bianca Granetto, Hai Hong Swinehart, Sharon Mertz, Chris Pang, Asheesh Raina, Dan Sommer, Bhavish Sood, Marianne D'Aquila, Laurie Wurster and Jie Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:12.0pt; mso-para-margin-left:0cm; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2 {mso-style-name:"Light List - Accent 2"; mso-tstyle-rowband-size:1; mso-tstyle-colband-size:1; mso-style-priority:61; mso-style-unhide:no; border:solid #C0504D 1.0pt; mso-border-themecolor:accent2; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2FirstRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-shading:#C0504D; mso-tstyle-shading-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; color:white; mso-themecolor:background1; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:2.25pt double #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2FirstCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2OddColumn {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-column; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} table.MsoTableLightListAccent2OddRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:12.0pt; mso-para-margin-left:0cm; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2 {mso-style-name:"Light List - Accent 2"; mso-tstyle-rowband-size:1; mso-tstyle-colband-size:1; mso-style-priority:61; mso-style-unhide:no; border:solid #C0504D 1.0pt; mso-border-themecolor:accent2; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2FirstRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-shading:#C0504D; mso-tstyle-shading-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; color:white; mso-themecolor:background1; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:2.25pt double #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2FirstCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2OddColumn {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-column; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} table.MsoTableLightListAccent2OddRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;}

    Read the article

  • Video capture Performance

    - by volting
    I have noticed high CPU utilization in a number of applications (except mplayer) which read from the embedded webcam on my laptop. Bizarrely CPU utilization varies proportionately to the level of illumination present. I know that that high CPU usage has nothing to do with rendering the video, as I have written a simple app using the OpenCV library to simply grab frames from the webcam, and cpu usage is still high. I think that mplayer might be using my GPU (and the other apps aren't), but since its not an issue with rendering, I dont think this explains anything. Cheese Low light --- ~12% CPU Bright Light ---- ~63% CPU Camorama Low light --- ~7% CPU Bright Light ---- ~30% CPU Opencv C++ library, (display in a single highgui window) Low light --- ~13% CPU Bright Light ---- ~40% CPU (same test on windows 7, 4-9%) Mplayer No problem, 1-2% regardless of light levels Note: If all I want't to do is capture a feed from my webcam I would use mplayer and forget about it, but I'm developing an application which uses the OpenCV to capture a video feed among other things, performance is important.

    Read the article

  • How to do directional per fragment lighting in world space?

    - by user
    I am attempting to create a GLSL shader for simple, per-fragment directional light. So far, after following many tutorials, I have continually ran into the issue: my light is specified in world coordinates, however, the shader treats the light's position as being in eye space, thus, the light direction changes when I move the camera. My question is, how to I transform a directional light position such as (50, 50, 50, 0) into eye space, or, would doing things this way be the incorrect approach to the problem?

    Read the article

  • How to call method written in C# class library from Silver light application(xaml.cs file) ?

    - by Shyju
    Can a xaml.cs file call the method in a c# class library ? I am trying to add a Silver light control to my Existing ASP.NET project where i used to add reference to my BL Project and acces methods of BL from My UI pages of ASP.NET Web application.Now i have added one Silver light project to my solution.How can i use the already existing BL method which is in a C# class library ? When tried to add reference, it is saying that "You can only add project reference to other silver light projects in the solution". Should i give up ? Is there any way to get rid of this ?

    Read the article

  • Calculate travel time on road map with semaphores

    - by Ivansek
    I have a road map with intersections. At intersections there are semaphores. For each semaphore I generate a red light time and green light time which are represented with syntax [R:T1, G:T2], for example: 119 185 250 A ------- B: [R:6, G:4] ------ C: [R:5, G:5] ------ D I want to calculate a car travel time from A - D. Now I do this with this pseudo code: function get_travel_time(semaphores_configuration) { time = 0; for( i=1; i<path.length;i++) { prev_node = path[i-1]; next_node = path[i]); cost = cost_between(prev_node, next_node) time += (cost/movement_speed) // movement_speed = 50px per second light_times = get_light_times(path[i], semaphore_configurations) lights_cycle = get_lights_cycle(light_times) // Eg: [R,R,R,G,G,G,G], where [R:3, G:4] lights_sum = light_times.green_time+light_times.red_light; // Lights cycle time light = lights_cycle[cost%lights_sum]; if( light == "R" ) { time += light_times.red_light; } } return time; } So for distance 119 between A and B travel time is, 119/50 = 2.38s ( exactly mesaured time is between 2.5s and 2.6s), then we add time if we came at a red light when at B. If we came at a red light is calculated with lines: lights_cycle = get_lights_cycle(light_times) // Eg: [R,R,R,G,G,G,G], where [R:3, G:4] lights_sum = light_times.green_time+light_times.red_light light = lights_cycle[cost%lights_sum]; if( light == "R" ) { time += light_times.red_light; } This pseudo code doesn't calculate exactly the same times as they are mesaured, but the calculations are very close to them. Any idea how I would calculate this?

    Read the article

  • What can I do to make sure my code gets maintained in a developer light environment?

    - by asjohnson
    I am a contract data analyst, so I bounce between jobs every 3-6 months, which I find to be a good fit for me, but it leads to some problems when it comes to coding. I mostly do statistics (I've asked a similar question on cross validated, but the answers there are not relevant here), but I have also found out that the business world loves excel and loves copying and pasting the same thing over and over again even more. This led me to learn how to write VBA scripts and then VB.NET programs to automate as many of these reports as I can. I am certain my programs are not the most elegant, but I put a good bit of effort into making sure they work under as many cases as I can test, I add in exceptions and try to code so the program can handle changes in the files that it processes, but there is a limit, if you remove a huge portion of the data, there is a good chance my program is going to trip up, which I accept will inevitably happen. Usually a pretty minor change in the code fixes the problem and I do try and comment my code and make it readable under the assumption that some other person will have to read it some day. My problem is that I generally get put on teams of folks with essentially no experience with programming (like VBA would be a huge stretch for anyone I work directly with). I am wondering what I should be doing as the person that wrote the code to do my best to keep it maintained. I have two approaches in mind (outlined next), but would be very happy to get any advice. Solution 1: Find the more tech savvy coworkers and run them through the programs and what basic changes can be made. Honestly automating excel is about as easy as it can get when it comes to programming, so I feel like I could teach someone the basics of maintaining it pretty quick. Solution 2: Get in touch with the IT department and show them what is going on and maybe they will be able to help. The problem here is that the IT department is constantly swamped (as I'm sure many of you know) and I feel like kind of a jerk for dumping more things on them. I do leave my personal email address with places and am willing to answer quick questions via email, but I view the need for more exhaustive maintenance as something of an inevitability and would like to make sure I do my due diligence to make sure it gets done. I imagine some combination of the two approaches outlined there, but is there any kind of heads up I should give IT? I feel like I would be annoyed if I started getting requests to fix a program that I had never seen from some random guy that is no longer there.

    Read the article

  • What is a light-weight "slideshow" script that could integrate w/ CMS?

    - by aslum
    I'm looking to reduce the footprint of my Strict html 4.01 front page. One possible way is to combine much of the "upcoming events" into a single small box, and have them automagically switch which one is displayed every few seconds. I'm sure there are a bunch of this kind of thing written already, and surely an open source one exists, but I haven't had much luck find one. I'd prefer javascript to jQuery as installing jQuery might not be an option, but if the best-fit script requires jQuery I'd certainly be willing to investigate that route. If it can display content from Wordpress that would be ideal.

    Read the article

  • Where can I get a list or data base of light reflectance values for different materials?

    - by mikidelux
    I'm implementing lighting for a WebGL app but I'm not an artist so I don't know how to generate or where to obtain a list of materials with its values (diffuse, specular, ambient and shininess). I've been searching a lot but with no luck. Is there any list or DB I might have overlooked? Any common repository or something similar? Thanks in advance. Note: English is not my main language, let me know if you don't understand something and I'll try to rephrase it.

    Read the article

  • What are the memory-management capabilities of MySQL + JDBC (in light of autonomic computing)?

    - by Adel
    I'm interested in implementing some kind of autonomic-computing functionality using MySQL. By autonomic-computing I mean roughly some failsafe abilities, whereby the application appears to be at least slightly "intelligent" For reference, the main parts of autonomic computing we'd like are the "self-configuring" and "self-healing" features (the other two - "self-optimizing" and "self-protecting", are too abstract/futuristic for us, at this time). Sofor example, if we have a sample Java application that utilizes a MySQL database, we might want to automatically restart the MySQL database if we take up too much memory. Or maybe we want to have the ability to dynamiccally adjust the database memory as needed. So for example, when we start the application the database begins with a 56 Megabyte buffer; but then as we insert so many rows we want to have it automatically jump up to 512 MB, then to 1024, until a max of 4096 MB. Does all of the above suggest that MySQL is too "weak" for the task? Do you suggest using Oracle database? My professor believes that by using Java we can basically make up for any memory-management deficiencies that MySQL has in relation to Oracle DB. I'm new to MySQL , but have experience with Oracle. If all of the above sounds wishy-washy, it is because I'm still fleshing it out. thanks

    Read the article

  • Does anyone know a light Vim scheme which makes coding more readable and pleasant?

    - by janoChen
    I know a lot of nice dark schemes for Vim which makes coding more readable and pleasant such as ir_black, wombat, zenburn. Its weird but I haven't seen so many popular light themes (white background). Does anyone knows a light Vim scheme which makes code more readable and pleasant to see? (that makes code less confusing to distinguish, something like Visual studio's default scheme?)

    Read the article

  • flash core engine by Dinesh [closed]

    - by hdinesh
    This post was a dump of the following code (without the highlights). No question, just a dump. Please update this q. with a real question to have it reopened. You (the asker) risk to be flagged as spammer (if not already) and a bad reputation. This is a q/a site, not a site to promote your own code libraries. package facers { import flash.display.*; import flash.events.*; import flash.geom.ColorTransform; import flash.utils.Dictionary; import org.papervision3d.cameras.*; import org.papervision3d.scenes.*; import org.papervision3d.objects.*; import org.papervision3d.objects.special.*; import org.papervision3d.objects.primitives.*; import org.papervision3d.materials.*; import org.papervision3d.events.FileLoadEvent; import org.papervision3d.materials.special.*; import org.papervision3d.materials.shaders.*; import org.papervision3d.materials.utils.*; import org.papervision3d.lights.*; import org.papervision3d.render.*; import org.papervision3d.view.*; import org.papervision3d.events.InteractiveScene3DEvent; import org.papervision3d.events.*; import org.papervision3d.core.utils.*; import org.papervision3d.core.geom.renderables.Vertex3D; import caurina.transitions.*; public class Main extends Sprite { public var viewport :BasicView; public var displayObject :DisplayObject3D; private var light :PointLight3D; private var shadowPlane :Plane; private var dataArray :Array; private var material :BitmapFileMaterial; private var planeByContainer :Dictionary = new Dictionary(); private var paperSize :Number = 0.5; private var cloudSize :Number = 1500; private var rotSize :Number = 360; private var maxAlbums :Number = 50; private var num :Number = 0; public function Main():void { trace("START APPLICATION"); viewport = new BasicView(1024, 690, true, true, CameraType.FREE); viewport.camera.zoom = 50; viewport.camera.extra = { goPosition: new DisplayObject3D(),goTarget: new DisplayObject3D() }; addChild(viewport); displayObject = new DisplayObject3D(); viewport.scene.addChild(displayObject); createAlbum(); addEventListener(Event.ENTER_FRAME, onRenderEvent); } private function createAlbum() { dataArray = new Array("images/thums/pic1.jpg", "images/thums/pic2.jpg", "images/thums/pic3.jpg", "images/thums/pic4.jpg", "images/thums/pic5.jpg", "images/thums/pic6.jpg", "images/thums/pic7.jpg", "images/thums/pic8.jpg", "images/thums/pic9.jpg", "images/thums/pic10.jpg", "images/thums/pic1.jpg", "images/thums/pic2.jpg", "images/thums/pic3.jpg", "images/thums/pic4.jpg", "images/thums/pic5.jpg", "images/thums/pic6.jpg", "images/thums/pic7.jpg", "images/thums/pic8.jpg", "images/thums/pic9.jpg", "images/thums/pic10.jpg"); for (var i:int = 0; i < dataArray.length; i++) { material = new BitmapFileMaterial(dataArray[i]); material.doubleSided = true; material.addEventListener(FileLoadEvent.LOAD_COMPLETE, loadMaterial); } } public function loadMaterial(event:Event) { var plane:Plane = new Plane(material, 300, 180); displayObject.addChild(plane); var _x:int = Math.random() * cloudSize - cloudSize/2; var _y:int = Math.random() * cloudSize - cloudSize/2; var _z:int = Math.random() * cloudSize - cloudSize/2; var _rotationX:int = Math.random() * rotSize; var _rotationY:int = Math.random() * rotSize; var _rotationZ:int = Math.random() * rotSize; Tweener.addTween(plane, { x:_x, y:_y, z:_z, rotationX:_rotationX, rotationY:_rotationY, rotationZ:_rotationZ, time:5, transition:"easeIn" } ); } protected function onRenderEvent(event:Event):void { var rotY: Number = (mouseY-(stage.stageHeight/2))/(900/2)*(1200); var rotX: Number = (mouseX-(stage.stageWidth/2))/(600/2)*(-1200); displayObject.rotationY = viewport.camera.x + (rotX - viewport.camera.x) / 50; displayObject.rotationX = viewport.camera.y + (rotY - viewport.camera.y) / 30; viewport.singleRender(); } } } package designLab.events { import flash.display.BlendMode; import flash.display.Sprite; import flash.events.Event; import flash.filters.BlurFilter; // Import designLab import designLab.layer.IntroLayer; import designLab.shadow.ShadowCaster; import designLab.utils.LayerConstant; // Import Papervision3D import org.papervision3d.cameras.*; import org.papervision3d.scenes.*; import org.papervision3d.objects.*; import org.papervision3d.objects.special.*; import org.papervision3d.objects.primitives.*; import org.papervision3d.materials.*; import org.papervision3d.materials.special.*; import org.papervision3d.materials.shaders.*; import org.papervision3d.materials.utils.*; import org.papervision3d.lights.*; import org.papervision3d.render.*; import org.papervision3d.view.*; import org.papervision3d.events.InteractiveScene3DEvent; import org.papervision3d.events.*; import org.papervision3d.core.utils.*; import org.papervision3d.core.geom.renderables.Vertex3D; public class CoreEnging extends Sprite { public var viewport :BasicView; // Create BasicView public var displayObject :DisplayObject3D; // Create DisplayObject public var shadowCaster :ShadowCaster; // Create ShadowCaster private var light :PointLight3D; // Create PointLight private var shadowPlane :Plane; // Create Plane private var layer :LayerConstant; // Create constant resource layer private static var instance :CoreEnging; // Create CoreEnging class static instance // CoreEnging class static instance mathod function public static function getinstance() { if (instance != null) return instance; else { instance = new CoreEnging(); return instance; } } // CoreEnging constrictor public function CoreEnging () { trace("INFO: Design Lab Application : Core Enging v0.1"); layer = new LayerConstant(); viewport = new BasicView(900, 600, true, true, CameraType.FREE); // pass the width, height, scaleToStage, interactive, cameraType to BasicView viewport.camera.zoom = 100; // Define the zoom level of camera addChild(viewport); createFloor(); // Create the floor displayObject = new DisplayObject3D(); // Create new instance of DisplayObject viewport.scene.addChild(displayObject); // Add the DisplayObject to the BasicView light = new PointLight3D(); // Create new instance of PointLight light.z = -50; // Position the Z of create instance light.x = 0; //Position the X of create instance light.rotationZ = 45; //Position the rotation angel of the Z of create instance light.y = 500; //Position the Y of create instance shadowCaster = new ShadowCaster("shadow", 0x000000, BlendMode.MULTIPLY, .1, [new BlurFilter(20, 20, 1)]); // pass shadowcaster name, color, blend mode, alpha and filters shadowCaster.setType(ShadowCaster.SPOTLIGHT); // Define the shadow type addEventListener(Event.ENTER_FRAME, onRenderEvent); // Add frame render event } // Start create floor public function createFloor() { var spr:Sprite = new Sprite(); // Create Sprite spr.graphics.beginFill(0xFFFFFF); // Define the fill color for sprite spr.graphics.drawRect(0, 0, 600, 600); // Define the X, Y, width, height of the sprite var sprMaterial:MovieMaterial = new MovieMaterial(spr, true, true, true); //Create a texture from an existing sprite instance shadowPlane = new Plane(sprMaterial, 2000, 2000, 1, 1); // create new instance of the Plane and pass the texture material, width, height, segmentsW and segmentsH shadowPlane.rotationX = 80; //Position the rotation angel of the X of Plane shadowPlane.y = -200; //Position the Y of Plane viewport.scene.addChild(shadowPlane); // Add the Plane to the BasicView } // switch method function of the page layer control public function addLayer(type:String) { switch (type) { case layer.INTRO: var intro:IntroLayer = new IntroLayer(); break; } } // Create get mathod function for DisplayObject public function getDisplayObject():DisplayObject3D { return displayObject; } // Create get mathod function for BasicView public function getViewport():BasicView { return viewport; } // Rendering function protected function onRenderEvent(event:Event):void { var rotY: Number = (mouseY-(stage.stageHeight/2))/(900/2)*(1200); var rotX: Number = (mouseX-(stage.stageWidth/2))/(600/2)*(-1200); displayObject.rotationY = viewport.camera.x + (rotX - viewport.camera.x) / 50; displayObject.rotationX = viewport.camera.y + (rotY - viewport.camera.y) / 30; // Remove the shadow shadowCaster.invalidate(); // create new shadow on DisplayObject move shadowCaster.castModel(displayObject, light, shadowPlane); viewport.singleRender(); } } } package designLab.layer { import flash.display.Sprite; import flash.events.Event; // Import designLab import designLab.materials.iBusinessCard; import designLab.events.CoreEnging; // Import Papervision3D import org.papervision3d.objects.primitives.Cube; import org.papervision3d.materials.ColorMaterial; import org.papervision3d.materials.MovieMaterial; public class IntroLayer { // IntroLayer constrictor public function IntroLayer() { trace("INFO: Load Intro layer"); var indexDP:DP_index = new DP_index(); //Create the library MovieClip var blackMaterial:MovieMaterial = new MovieMaterial(indexDP, true); //Create a texture from an existing library MovieClip instance blackMaterial.smooth = true; blackMaterial.doubleSided = false; var mycolor:ColorMaterial = new ColorMaterial(0x000000); //Create solid color material var mycard:iBusinessCard = new iBusinessCard(blackMaterial, blackMaterial, mycolor, 372, 10, 207); // Create custom 3D cube object to pass the Front, Back, All, CubeWidth, CubeDepth and CubeHeight CoreEnging.getinstance().getDisplayObject().addChild(mycard.create3DCube()); // Add the custom 3D cube to the DisplayObject } } } package designLab.materials { import flash.display.*; import flash.events.*; // Import Papervision3D import org.papervision3d.materials.*; import org.papervision3d.materials.utils.MaterialsList; import org.papervision3d.objects.primitives.Cube; public class iBusinessCard extends Sprite { private var materialsList :MaterialsList; private var cube :Cube; private var Front :MovieMaterial = new MovieMaterial(); private var Back :MovieMaterial = new MovieMaterial(); private var All :ColorMaterial = new ColorMaterial(); private var CubeWidth :Number; private var CubeDepth :Number; private var CubeHeight :Number; public function iBusinessCard(Front:MovieMaterial, Back:MovieMaterial, All:ColorMaterial, CubeWidth:Number, CubeDepth:Number, CubeHeight:Number) { setFront(Front); setBack(Back); setAll(All); setCubeWidth(CubeWidth); setCubeDepth(CubeDepth); setCubeHeight(CubeHeight); } public function create3DCube():Cube { materialsList = new MaterialsList(); materialsList.addMaterial(Front, "front"); materialsList.addMaterial(Back, "back"); materialsList.addMaterial(All, "left"); materialsList.addMaterial(All, "right"); materialsList.addMaterial(All, "top"); materialsList.addMaterial(All, "bottom"); cube = new Cube(materialsList, CubeWidth, CubeDepth, CubeHeight); cube.x = 0; cube.y = 0; cube.z = 0; cube.rotationY = 180; return cube; } public function setFront(Front:MovieMaterial) { this.Front = Front; } public function getFront():MovieMaterial { return Front; } public function setBack(Back:MovieMaterial) { this.Back = Back; } public function getBack():MovieMaterial { return Back; } public function setAll(All:ColorMaterial) { this.All = All; } public function getAll():ColorMaterial { return All; } public function setCubeWidth(CubeWidth:Number) { this.CubeWidth = CubeWidth; } public function getCubeWidth():Number { return CubeWidth; } public function setCubeDepth(CubeDepth:Number) { this.CubeDepth = CubeDepth; } public function getCubeDepth():Number { return CubeDepth; } public function setCubeHeight(CubeHeight:Number) { this.CubeHeight = CubeHeight; } public function getCubeHeight():Number { return CubeHeight; } } } package designLab.shadow { import flash.display.Sprite; import flash.filters.BlurFilter; import flash.geom.Point; import flash.geom.Rectangle; import flash.utils.Dictionary; import org.papervision3d.core.geom.TriangleMesh3D; import org.papervision3d.core.geom.renderables.Triangle3D; import org.papervision3d.core.geom.renderables.Vertex3D; import org.papervision3d.core.math.BoundingSphere; import org.papervision3d.core.math.Matrix3D; import org.papervision3d.core.math.Number3D; import org.papervision3d.core.math.Plane3D; import org.papervision3d.lights.PointLight3D; import org.papervision3d.materials.MovieMaterial; import org.papervision3d.objects.DisplayObject3D; import org.papervision3d.objects.primitives.Plane; public class ShadowCaster { private var vertexRefs:Dictionary; private var numberRefs:Dictionary; private var lightRay:Number3D = new Number3D() private var p3d:Plane3D = new Plane3D(); public var color:uint = 0; public var alpha:Number = 0; public var blend:String = ""; public var filters:Array; public var uid:String; private var _type:String = "point"; private var dir:Number3D; private var planeBounds:Dictionary; private var targetBounds:Dictionary; private var models:Dictionary; public static var DIRECTIONAL:String = "dir"; public static var SPOTLIGHT:String = "spot"; public function ShadowCaster(uid:String, color:uint = 0, blend:String = "multiply", alpha:Number = 1, filters:Array=null) { this.uid = uid; this.color = color; this.alpha = alpha; this.blend = blend; this.filters = filters ? filters : [new BlurFilter()]; numberRefs = new Dictionary(true); targetBounds = new Dictionary(true); planeBounds = new Dictionary(true); models = new Dictionary(true); } public function castModel(model:DisplayObject3D, light:PointLight3D, plane:Plane, faces:Boolean = true, cull:Boolean = false):void{ var ar:Array; if(models[model]) { ar = models[model]; }else{ ar = new Array(); getChildMesh(model, ar); models[model] = ar; } var reset:Boolean = true; for each(var t:TriangleMesh3D in ar){ if(faces) castFaces(light, t, plane, cull, reset); else castBoundingSphere(light, t, plane, 0.75, reset); reset = false; } } private function getChildMesh(do3d:DisplayObject3D, ar):void{ if(do3d is TriangleMesh3D) ar.push(do3d); for each(var d:DisplayObject3D in do3d.children) getChildMesh(d, ar); } public function setType(type:String="point"):void{ _type = type; } public function getType():String{ return _type; } public function castBoundingSphere(light:PointLight3D, target:TriangleMesh3D, plane:Plane, scaleRadius:Number=0.8, clear:Boolean = true):void{ var planeVertices:Array = plane.geometry.vertices; //convert to target space? var world:Matrix3D = plane.world; var inv:Matrix3D = Matrix3D.inverse(plane.transform); var lp:Number3D = new Number3D(light.x, light.y, light.z); Matrix3D.multiplyVector(inv, lp); p3d.setNormalAndPoint(plane.geometry.faces[0].faceNormal, new Number3D()); var b:BoundingSphere = target.geometry.boundingSphere; var bounds:Object = planeBounds[plane]; if(!bounds){ bounds = plane.boundingBox(); planeBounds[plane] = bounds; } var tbounds:Object = targetBounds[target]; if(!tbounds){ tbounds = target.boundingBox(); targetBounds[target] = tbounds; } var planeMovie:Sprite = Sprite(MovieMaterial(plane.material).movie); var movieSize:Point = new Point(planeMovie.width, planeMovie.height); var castClip:Sprite = getCastClip(plane); castClip.blendMode = this.blend; castClip.filters = this.filters; castClip.alpha = this.alpha; if(clear) castClip.graphics.clear(); vertexRefs = new Dictionary(true); var tlp:Number3D = new Number3D(light.x, light.y, light.z); Matrix3D.multiplyVector(Matrix3D.inverse(target.world), tlp); var center:Number3D = new Number3D(tbounds.min.x+tbounds.size.x*0.5, tbounds.min.y+tbounds.size.y*0.5, tbounds.min.z+tbounds.size.z*0.5); var dif:Number3D = Number3D.sub(lp, center); dif.normalize(); var other:Number3D = new Number3D(); other.x = -dif.y; other.y = dif.x; other.z = 0; other.normalize(); var cross:Number3D = Number3D.cross(new Number3D(plane.transform.n12, plane.transform.n22, plane.transform.n32), p3d.normal); cross.normalize(); //cross = new Number3D(-dif.y, dif.x, 0); //cross.normalize(); cross.multiplyEq(b.radius*scaleRadius); if(_type == DIRECTIONAL){ var oPos:Number3D = new Number3D(target.x, target.y, target.z); Matrix3D.multiplyVector(target.world, oPos); Matrix3D.multiplyVector(inv, oPos); dir = new Number3D(oPos.x-lp.x, oPos.y-lp.y, oPos.z-lp.z); } //numberRefs = new Dictionary(true); var pos:Number3D; var c2d:Point; var r2d:Point; //_type = SPOTLIGHT; pos = projectVertex(new Vertex3D(center.x, center.y, center.z), lp, inv, target.world); c2d = get2dPoint(pos, bounds.min, bounds.size, movieSize); pos = projectVertex(new Vertex3D(center.x+cross.x, center.y+cross.y, center.z+cross.z), lp, inv, target.world); r2d = get2dPoint(pos, bounds.min, bounds.size, movieSize); var dx:Number = r2d.x-c2d.x; var dy:Number = r2d.y-c2d.y; var rad:Number = Math.sqrt(dx*dx+dy*dy); castClip.graphics.beginFill(color); castClip.graphics.moveTo(c2d.x, c2d.y); castClip.graphics.drawCircle(c2d.x, c2d.y, rad); castClip.graphics.endFill(); } public function getCastClip(plane:Plane):Sprite{ var planeMovie:Sprite = Sprite(MovieMaterial(plane.material).movie); var movieSize:Point = new Point(planeMovie.width, planeMovie.height); var castClip:Sprite;// = new Sprite(); if(planeMovie.getChildByName("castClip"+uid)) return Sprite(planeMovie.getChildByName("castClip"+uid)); else{ castClip = new Sprite(); castClip.name = "castClip"+uid; castClip.scrollRect = new Rectangle(0, 0, movieSize.x, movieSize.y); //castClip.alpha = 0.4; planeMovie.addChild(castClip); return castClip; } } public function castFaces(light:PointLight3D, target:TriangleMesh3D, plane:Plane, cull:Boolean=false, clear:Boolean = true):void{ var planeVertices:Array = plane.geometry.vertices; //convert to target space? var world:Matrix3D = plane.world; var inv:Matrix3D = Matrix3D.inverse(plane.transform); var lp:Number3D = new Number3D(light.x, light.y, light.z); Matrix3D.multiplyVector(inv, lp); var tlp:Number3D; if(cull){ tlp = new Number3D(light.x, light.y, light.z); Matrix3D.multiplyVector(Matrix3D.inverse(target.world), tlp); } //Matrix3D.multiplyVector(Matrix3D.inverse(target.transform), tlp); //p3d.setThreePoints(planeVertices[0].getPosition(), planeVertices[1].getPosition(), planeVertices[2].getPosition()); p3d.setNormalAndPoint(plane.geometry.faces[0].faceNormal, new Number3D()); if(_type == DIRECTIONAL){ var oPos:Number3D = new Number3D(target.x, target.y, target.z); Matrix3D.multiplyVector(target.world, oPos); Matrix3D.multiplyVector(inv, oPos); dir = new Number3D(oPos.x-lp.x, oPos.y-lp.y, oPos.z-lp.z); } var bounds:Object = planeBounds[plane]; if(!bounds){ bounds = plane.boundingBox(); planeBounds[plane] = bounds; } var castClip:Sprite = getCastClip(plane); castClip.blendMode = this.blend; castClip.filters = this.filters; castClip.alpha = this.alpha; var planeMovie:Sprite = Sprite(MovieMaterial(plane.material).movie); var movieSize:Point = new Point(planeMovie.width, planeMovie.height); if(clear) castClip.graphics.clear(); vertexRefs = new Dictionary(true); //numberRefs = new Dictionary(true); var pos:Number3D; var p2d:Point; var s2d:Point; var hitVert:Number3D = new Number3D(); for each(var t:Triangle3D in target.geometry.faces){ if( cull){ hitVert.x = t.v0.x; hitVert.y = t.v0.y; hitVert.z = t.v0.z; if(Number3D.dot(t.faceNormal, Number3D.sub(tlp, hitVert)) <= 0) continue; } castClip.graphics.beginFill(color); pos = projectVertex(t.v0, lp, inv, target.world); s2d = get2dPoint(pos, bounds.min, bounds.size, movieSize); castClip.graphics.moveTo(s2d.x, s2d.y); pos = projectVertex(t.v1, lp, inv, target.world); p2d = get2dPoint(pos, bounds.min, bounds.size, movieSize); castClip.graphics.lineTo(p2d.x, p2d.y); pos = projectVertex(t.v2, lp, inv, target.world); p2d = get2dPoint(pos, bounds.min, bounds.size, movieSize); castClip.graphics.lineTo(p2d.x, p2d.y); castClip.graphics.lineTo(s2d.x, s2d.y); castClip.graphics.endFill(); } } public function invalidate():void{ invalidateModels(); invalidatePlanes(); } public function invalidatePlanes():void{ planeBounds = new Dictionary(true); } public function invalidateTargets():void{ numberRefs = new Dictionary(true); targetBounds = new Dictionary(true); } public function invalidateModels():void{ models = new Dictionary(true); invalidateTargets(); } private function get2dPoint(pos3D:Number3D, min3D:Number3D, size3D:Number3D, movieSize:Point):Point{ return new Point((pos3D.x-min3D.x)/size3D.x*movieSize.x, ((-pos3D.y-min3D.y)/size3D.y*movieSize.y)); } private function projectVertex(v:Vertex3D, light:Number3D, invMat:Matrix3D, world:Matrix3D):Number3D{ var pos:Number3D = vertexRefs[v]; if(pos) return pos; var n:Number3D = numberRefs[v]; if(!n){ n = new Number3D(v.x, v.y, v.z); Matrix3D.multiplyVector(world, n); Matrix3D.multiplyVector(invMat, n); numberRefs[v] = n; } if(_type == SPOTLIGHT){ lightRay.x = light.x; lightRay.y = light.y; lightRay.z = light.z; }else{ lightRay.x = n.x-dir.x; lightRay.y = n.y-dir.y; lightRay.z = n.z-dir.z; } pos = p3d.getIntersectionLineNumbers(lightRay, n); vertexRefs[v] = pos; return pos; } } } package designLab.utils { public class LayerConstant { public const INTRO:String = "INTRO"; // Intro layer string constant } }*emphasized text*

    Read the article

  • App cannot start at all in Android 2.2 (Froyo)

    - by Roland Lim
    Dear fellow Android developers & Google Engineers, My app has been running okay until the recent Froyo update. After installing the Android 2.2 SDK, I can compile my code without any errors. However, when I run it, it just force closes: Here's the log: 05-23 10:15:13.463: DEBUG/AndroidRuntime(423): >>>>>>>>>>>>>> AndroidRuntime START <<<<<<<<<<<<<< 05-23 10:15:13.463: DEBUG/AndroidRuntime(423): CheckJNI is ON 05-23 10:15:14.193: DEBUG/AndroidRuntime(423): --- registering native functions --- 05-23 10:15:15.293: DEBUG/AndroidRuntime(423): Shutting down VM 05-23 10:15:15.303: DEBUG/dalvikvm(423): Debugger has detached; object registry had 1 entries 05-23 10:15:15.333: INFO/AndroidRuntime(423): NOTE: attach of thread 'Binder Thread #3' failed 05-23 10:15:16.003: DEBUG/AndroidRuntime(431): >>>>>>>>>>>>>> AndroidRuntime START <<<<<<<<<<<<<< 05-23 10:15:16.013: DEBUG/AndroidRuntime(431): CheckJNI is ON 05-23 10:15:16.273: DEBUG/AndroidRuntime(431): --- registering native functions --- 05-23 10:15:17.392: INFO/ActivityManager(59): Starting activity: Intent { act=android.intent.action.MAIN cat= [android.intent.category.LAUNCHER] flg=0x10000000 cmp=com.handyapps.easymoney/.EasyMoney } 05-23 10:15:17.602: DEBUG/AndroidRuntime(431): Shutting down VM 05-23 10:15:17.662: DEBUG/dalvikvm(431): Debugger has detached; object registry had 1 entries 05-23 10:15:17.742: INFO/AndroidRuntime(431): NOTE: attach of thread 'Binder Thread #3' failed 05-23 10:15:17.912: INFO/ActivityManager(59): Start proc com.handyapps.easymoney for activity com.handyapps.easymoney/.EasyMoney: pid=438 uid=10035 gids={1006, 1015} 05-23 10:15:19.032: DEBUG/AndroidRuntime(438): Shutting down VM 05-23 10:15:19.032: WARN/dalvikvm(438): threadid=1: thread exiting with uncaught exception (group=0x4001d800) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): FATAL EXCEPTION: main 05-23 10:15:19.062: ERROR/AndroidRuntime(438): java.lang.RuntimeException: Unable to instantiate application com.handyapps.easymoney.EasyMoney: java.lang.ClassCastException: com.handyapps.easymoney.EasyMoney 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.ActivityThread$PackageInfo.makeApplication (ActivityThread.java:649) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.ActivityThread.handleBindApplication (ActivityThread.java:4232) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.ActivityThread.access$3000(ActivityThread.java:125) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:2071) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.os.Handler.dispatchMessage(Handler.java:99) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.os.Looper.loop(Looper.java:123) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.ActivityThread.main(ActivityThread.java:4627) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at java.lang.reflect.Method.invokeNative(Native Method) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at java.lang.reflect.Method.invoke(Method.java:521) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run (ZygoteInit.java:868) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:626) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at dalvik.system.NativeStart.main(Native Method) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): Caused by: java.lang.ClassCastException: com.handyapps.easymoney.EasyMoney 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.Instrumentation.newApplication(Instrumentation.java:957) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.Instrumentation.newApplication(Instrumentation.java:942) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): at android.app.ActivityThread$PackageInfo.makeApplication (ActivityThread.java:644) 05-23 10:15:19.062: ERROR/AndroidRuntime(438): ... 11 more 05-23 10:15:19.082: WARN/ActivityManager(59): Force finishing activity com.handyapps.easymoney/.EasyMoney 05-23 10:15:19.592: WARN/ActivityManager(59): Activity pause timeout for HistoryRecord{450018f0 com.handyapps.easymoney/.EasyMoney} //////////////THE ANDROID MANIFEST FILE//// <uses-permission android:name="android.permission.READ_PHONE_STATE"/> <uses-permission android:name="android.permission.CAMERA"/> <uses-permission android:name="android.permission.WRITE_EXTERNAL_STORAGE" /> <uses-feature android:name="android.hardware.camera" /> <uses-sdk android:minSdkVersion="3" android:targetSdkVersion="4" /> <application android:icon="@drawable/icon" android:name="@string/app_name" android:label="@string/app_name" android:debuggable="false"> <activity android:name=".EasyMoney" android:label="@string/app_name" android:theme="@android:style/Theme.NoTitleBar" android:launchMode="singleTask" android:clearTaskOnLaunch="true"> <intent-filter> <action android:name="android.intent.action.MAIN" /> <category android:name="android.intent.category.LAUNCHER" /> </intent-filter> </activity> <activity android:name=".TranList" android:label="@string/app_name" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".TranEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".BillReminderEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".BillReminderList" android:launchMode="singleTop" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".BudgetList" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".BudgetEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".Search" android:theme="@style/CustomDialogTheme" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".PasscodeEntry" android:theme="@style/CustomDialogTheme" android:windowSoftInputMode="stateAlwaysHidden" android:screenOrientation="portrait"/> <activity android:name=".AccountList" android:theme="@android:style/Theme.Light.NoTitleBar"> </activity> <activity android:name=".AccountEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".UserSettingsEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".CurrencySettingsEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".DisplaySettingsEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".BackupSettingsEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".CategoryList" android:theme="@android:style/Theme.Light.NoTitleBar" /> <activity android:name=".CategoryEdit" android:theme="@android:style/Theme.Light.NoTitleBar" android:windowSoftInputMode="stateAlwaysHidden"/> <activity android:name=".ExpenseByCategory" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".BalanceReport" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".MonthlyExpenseReport" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".MonthlyIncomeReport" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".MonthlyCashflowReport" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".PhotoList" android:theme="@android:style/Theme.Light.NoTitleBar" /> <activity android:name=".ExpenseByPayee" android:theme="@android:style/Theme.Light.NoTitleBar"/> <activity android:name=".ExpenseBySubCategory" android:theme="@android:style/Theme.Light.NoTitleBar"/> <service android:name="StartAlarm_Service"> <intent-filter> <action android:name="com.handyapps.easymoney.StartAlarm_Service" /> </intent-filter> </service> <service android:name=".AlarmService_Service" android:process=":remote" /> <receiver android:name="StartupIntentReceiver"> <intent-filter> <action android:name="android.intent.action.BOOT_COMPLETED" /> <category android:name="android.intent.category.HOME" /> </intent-filter> </receiver> <receiver android:name=".WidgetProvider" android:label="@string/widget_name"> <intent-filter> <action android:name="android.appwidget.action.APPWIDGET_UPDATE" /> </intent-filter> <meta-data android:name="android.appwidget.provider" android:resource="@xml/widget" /> </receiver> <receiver android:name=".WidgetProvider" android:label="@string/widget_name"> <intent-filter> <action android:name="android.appwidget.action.APPWIDGET_UPDATE" /> <data android:scheme="easymoney_widget" /> </intent-filter> <meta-data android:name="android.appwidget.provider" android:resource="@xml/widget" /> </receiver> <receiver android:name=".WidgetProvider"> <intent-filter> <action android:name="com.handyapps.easymoney.WIDGET_CONTROL" /> <data android:scheme="easymoney_widget" /> </intent-filter> </receiver> </application> The main startup class is com.handyapps.easymoney.EasyMoney. I placed a breakpoint at the start of the onCreate() method but I discovered it didn't even reach there. Somehow, the application just couldn't be loaded in Android 2.2... but it works perfectly fine for all the previous Android versions. Been trying to find the cause for the past 2 days but am totally stumped!! Any help will be greatly appreciated!!!! Thanks!! Roland

    Read the article

  • Is minimum latency fixed by the speed of light?

    - by JavaRocky
    Suppose i had a fiber optic link from one side of the planet to the other side of the planet. Is it safe to say, that with current technology, the latency of communication can never be reduced? Understand that a fiber optic cable is not a perfect medium thus data only travels close to the speed of light. Also lets consider that i will not be drilling a hole thru the center of the earth and it is just running along the ocean.

    Read the article

  • forward rendering and multiple shadow maps

    - by Irbis
    I have two light sources on my scene. I created two fbo's which store depth textures for these lights. A render loop looks like this: bind fbo1 save depth values for first light unbind fbo1 bind fbo2 save depth values for second light unbind fbo2 enable additive blending bind first depth texture render scene bind second depth texture render scene disable additive blending For one light source the program works fine. For many light sources I use an additive blending to acumulate lighting results but then some objects become transparent (for example when an object which is further away from the camera is drawn before an object which is closer to the camera). How to resolve that problem ? How should I accumulate lighting effects for many light sources (many shadow maps) ? P.S. I use OpenGL/GLSL 3.3+

    Read the article

  • scheduled chkdsk on Windows 7 blinking the hard disk light every 5 seconds, what can I do?

    - by Jian Lin
    PG&E (the local electricity company) came and took out the old power meters and put in a new ones by brute force and with no advance notice in our neighborhood, so my computer went down in power. So I went to Windows 7's drive C and schedule a Disk Cleanup (chkdsk) on the next boot up. When it boots up, it says A disk check has been scheduled To skip disk checking, press any key within __ second(s). and then after it shows To skip disk checking, press any key within 1 second(s). it just sits there, with no further message. the hard disc light blinks every 5 seconds. So what is to be done now? I certainly don't want to brute force power off again.

    Read the article

  • Low end dedicated GPU vs. integrated Intel graphics (for light CAD work)

    - by PaulJ
    I have been asked to spec a PC for an interior design business. They are going to do some AutoCAD work (but they won't be using massive datasets or anything), and also use Kitchen Draw, a program that has 3D visualization features and says, in its requirements, that "a recent NVidia or ATI card might be enough". Since they are very limited budget-wise, I had originally picked a GeForce GT 610 card, but this card is so low end that I'm left wondering whether it will be an improvement at all over the dedicated Intel HD2500 graphics chip that comes with the CPU (I will be using an Ivy-Bridge Intel i5). Most of the information I see around is for gaming, which isn't really relevant in my case. Basically, for the use case I've described (light 3D work), can one get away with a current Intel HD graphics chipset? And will a low end GPU like the GT 610 provide a noticeable improvement?

    Read the article

  • Wix light.exe : error LGHT0001: The system cannot open the device or file specified.

    - by Angelo
    Today we build our product with MSBuild /m to build with multiprocess. Before we do a change to heat some files in pre-build event, build with MSBuild multiprocess can be success. Now build is failed with following exception: 124light.exe : error LGHT0001: The system cannot open the device or file specified. (Exception from HRESULT: 0x8007006E) [...MSI.wixproj] Exception Type: System.IO.FileLoadException Stack Trace: at Microsoft.Tools.WindowsInstallerXml.MergeMod.IMsmMerge2.OpenModule(String fileName, Int16 language) at Microsoft.Tools.WindowsInstallerXml.Binder.MergeModules(String tempDatabaseFile, Output output, FileRowCollection fileRows, StringCollection suppressedTableNames) at Microsoft.Tools.WindowsInstallerXml.Binder.BindDatabase(Output output, String databaseFile) at Microsoft.Tools.WindowsInstallerXml.Binder.Bind(Output output, String file) at Microsoft.Tools.WindowsInstallerXml.Tools.Light.Run(String[] args) (Link target) - light.exe : error LGHT0001: The system cannot open the device or file specified. (Exception from HRESULT: 0x8007006E) [...Msi.wixproj] using Wix 3.8

    Read the article

< Previous Page | 8 9 10 11 12 13 14 15 16 17 18 19  | Next Page >