Search Results

Search found 20336 results on 814 pages for 'connection strings'.

Page 120/814 | < Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Match HTML tags in two strings using regex in Python

    - by jack
    I want to verify that the HTML tags present in a source string are also present in a target string. For example: >> source = '<em>Hello</em><label>What's your name</label>' >> verify_target(’<em>Hi</em><label>My name is Jim</label>') True >> verify_target('<label>My name is Jim</label><em>Hi</em>') True >> verify_target('<em>Hi<label>My name is Jim</label></em>') False

    Read the article

  • Where can I learn about JNDI strings?

    - by ferrari fan
    How do you know how to form a JNDI string? I know there must be a format and that the divisions must mean something but I haven't been able to find a good resource that explains them. For example: java:comp/env/wm/default. This is supposed to connect to a WorkManager in Websphere with the name of default. But what does the "java", "comp", "env" mean? I know what the wm/default mean because that's the JNDI name put in the WorkManager, but what does the rest mean? Thanks

    Read the article

  • PHP: Condense array of similar strings into one merged array

    - by Matt Andrews
    Hi everyone. Working with an array of dates (opening times for a business). I want to condense them to their briefest possible form. So far, I started out with this structure Array ( [Mon] => 12noon-2:45pm, 5:30pm-10:30pm [Tue] => 12noon-2:45pm, 5:30pm-10:30pm [Wed] => 12noon-2:45pm, 5:30pm-10:30pm [Thu] => 12noon-2:45pm, 5:30pm-10:30pm [Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) What I want to achieve is this: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) I've tried writing a recursive function and have managed to output this so far: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Tue-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Wed-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Thu-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) Can anybody see a simple way of comparing the values and combining the keys where they're similar? My recursive function is basically two nested foreach() loops - not very elegant. Thanks, Matt EDIT: Here's my code so far, which produces the 3rd array above (from the first one as input): $last_time = array('t' => '', 'd' => ''); // blank array for looping $i = 0; foreach($final_times as $day=>$time) { if($last_time['t'] != $time ) { // it's a new time if($i != 0) { $print_times[] = $day . ' ' . $time; } // only print if it's not the first, otherwise we get two mondays } else { // this day has the same time as last time $end_day = $day; foreach($final_times as $day2=>$time2) { if($time == $time2) { $end_day = $day2; } } $print_times[] = $last_time['d'] . '-' . $end_day . ' ' . $time; } $last_time = array('t' => $time, 'd' => $day); $i++; }

    Read the article

  • List available languages for PyGTK UI strings

    - by detly
    I'm cleaning up some localisation and translation settings in our PyGTK application. The app is only intended to be used under GNU/Linux systems. One of the features we want is for users to select the language used for the applications (some prefer their native language, some prefer English for consistency, some like French because it sounds romantic, etc). For this to work, I need to actually show a combo box with the various languages available. How can I get this list? In fact, I need a list of pairs of the language code ("en", "ru", etc) and the language name in the native language ("English (US)", "???????"). If I had to implement a brute force method, I'd do something like: look in the system locale dir (eg. "/usr/share/locale") for all language code dirs (eg. "en/") containing the relative path "LC_MESSAGES/OurAppName.mo". Is there a more programmatic way?

    Read the article

  • How do i change this method to get strings instead of ints

    - by David
    here is the original code: public static int getInt () { Scanner in = new Scanner (System.in) ; if (in.hasNextInt()) { int a = in.nextInt() ; return a ; } else { System.out.println ("try again:") ; return getInt () ; } } This checks and sees if the input it receives is an int. If it is then it returns the int, if not it tells you to try again and re-runs. This is what i tried to do to change it: public static String getIns () { Scanner in = new Scanner (System.in) ; if (in.hasNextString()) { String a = in.nextString() ; return a ; } else { System.out.println ("try again:") ; return getIns () ; } } This doesn't work though. I looked through the documentation for the scanner class and i think the problem is that there is no such method as in.hasNextString or in.nextString What methods from the scanner class can i use to do what i intend these to do?

    Read the article

  • Mixing c++ standard strings and windows API

    - by JB
    Many windows APIs take a pointer to a buffer and a size element but the result needs to go into a c++ string. (I'm using windows unicode here so they are wstrings) Here is an example :- #include <iostream> #include <string> #include <vector> #include <windows.h> using namespace std; // This is the method I'm interested in improving ... wstring getComputerName() { vector<wchar_t> buffer; buffer.resize(MAX_COMPUTERNAME_LENGTH+1); DWORD size = MAX_COMPUTERNAME_LENGTH; GetComputerNameW(&buffer[0], &size); return wstring(&buffer[0], size); } int main() { wcout << getComputerName() << "\n"; } My question really is, is this the best way to write the getComputerName function so that it fits into C++ better, or is there a better way? I don't see any way to use a string directly without going via a vector unless I missed something? It works fine, but somehow seems a little ugly. The question isn't about that particular API, it's just a convenient example.

    Read the article

  • How to replace strings with javascript?

    - by Damiano
    Hello everybody, I have this function: function emoticons(text){ var url = "http://www.domain.it/images/smilies/"; var emt = { ":D" : 'icon_e_biggrin.gif', ":-D" : 'icon_e_biggrin.gif', ":)" : 'icon_e_smile.gif', ":-)" : 'icon_e_smile.gif', ";)" : 'icon_e_wink.gif', "';-)" : 'icon_e_wink.gif', ":(" : 'icon_e_sad.gif', ":-(" : 'icon_e_sad.gif', ":o" : 'icon_e_surprised.gif', ":?" : 'icon_e_confused.gif', "8-)" : 'icon_cool.gif', ":x" : 'icon_mad.gif', ":P" : 'icon_razz.gif' }; for (smile in emt){ text = text.replace(smile, '<img src="' + url + emt[smile] + '" class="emoticons" />'); } return (text); } As you know .replace() convert the first occurence, how to replace more then one emoticon inside the text? How to change this function? Thank you very much!

    Read the article

  • PHP RegEx: How to Stripe Whitespace Between Two Strings

    - by roydukkey
    I have been trying to write a regex that will remove whitespace following a semicolon (';') when it is between both an open and close curly brace ('{','}'). I've gotten somewhere but haven't been able to pull it off. Here what I've got: <?php $output = '@import url("/home/style/nav.css"); body{color:#777; background:#222 url("/home/style/nav.css") top center no-repeat; line-height:23px; font-family:Arial,Times,serif; font-size:13px}' $output = preg_replace("#({.*;) \s* (.*[^;]})#x", "$1$2", $output); ?> The the $output should be as follows. Also, notice that the first semicolon in the string still is followed by whitespace, as it should be. <?php $output = '@import url("/home/style/nav.css"); body{color:#777;background:#222 url("/home/style/nav.css") top center no-repeat;line-height:23px;font-family:Arial,Times,serif;font-size:13px}'; ?> Thanks! In advance to anyone willing to give it a shot.

    Read the article

  • ADODB.Connection undefined

    - by Wes Groleau
    Reference http://stackoverflow.com/questions/1690622/excel-vba-to-sql-server-without-ssis After I got the above working, I copied all the global variables/constants from the routine, which included Const CS As String = "Driver={SQL Server};" _ & "Server=**;" _ & "Database=**;" _ & "UID=**;" _ & "PWD=**" Dim DB_Conn As ADODB.Connection Dim Command As ADODB.Command Dim DB_Status As Stringinto a similar module in another spreadsheet. I also copied Sub Connect_To_Lockbox() If DB_Status < "Open" Then Set DB_Conn = New Connection DB_Conn.ConnectionString = CS DB_Conn.Open ' problem! DB_Status = "Open" End If End SubI added the same reference (ADO 2.8) The first spreadsheet still works; the seccond at DB_Conn.Open pops up "Run-time error '-214767259 (80004005)': [Microsoft][ODBC Driver Manager] Data source name not found and no default driver specified" Removing the references on both, saving files, re-opening, re-adding the references doesn't help. The one still works and the other gets the error. ?!?

    Read the article

  • DB4o Linq query - How to check for null strings

    - by Dave
    Hey there - simple query: var q = (from SomeObject o in container where o.SomeInt > 8 && o.SomeString != null //Null Ref here select o; I always get a null reference exception. If I use String.IsNullOrEmpty(o.SomeString) the query takes about 100 times as long, as if I use && o.SomeString != "" (which is way faster, but obviously not correct). I'm guessing because DB4o needs to activate the objects, in order to pass them in to the IsNullOrEmpty call, and can't use the indexes. My question is, what's a better way to check for nulls in this situation? Is there something like: mystring != Db4o.DBNull.Value, or something? Cheers, Dave

    Read the article

  • SQL Server T-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except <B> and </B>. Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fetch every row, process it and update the database but I'm guessing this is possible to do in T-SQL directly. My server is an MSSQL 2008 and is located in a hosted environment but I can fetch a local copy if needed. Thanks, Stefan

    Read the article

  • Scrubyt: Using big5 strings in query_field for fill_textfield

    - by kuribo
    Does anyone know of a way to get fill_textfield to accept a big5-encoded string in the query_field? I keep getting an "unterminated string meets end of file" error with this: require 'rubygems' require 'scrubyt' search_data = Scrubyt::Extractor.define do fetch 'http://www.google.com/ncr' fill_textfield 'q', '????' submit end

    Read the article

  • Perl's use encoding pragma breaking UTF strings

    - by Karel Bílek
    I have a problem with Perl and Encoding pragma. (I use utf-8 everywhere, in input, output, the perl scripts themselves. I don't want to use other encoding, never ever.) However. When I write binmode(STDOUT, ':utf8'); use utf8; $r = "\x{ed}"; print $r; I see the string "í" (which is what I want - and what is 00+ED unicode char). But when I add the "use encoding" pragma like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; print $r; all I see is a box character. Why? Moreover, when I add Data::Dumper and let the Dumper print the new string like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; use Data::Dumper; print Dumper($r); I see that perl changed the string to "\x{fffd}". Why?

    Read the article

  • Problems manipulating strings through a stdcall to a dll

    - by ibiza
    I need to create a C++ dll that will be called from another program through stdcall. What is needed : the caller program will pass an array of string to the dll and the dll should change the string values in the array. The caller program will then continue to work with these string values that came from the dll. I made a simple test project and I am obviously missing something... Here is my test C++ dll : #ifndef _DLL_H_ #define _DLL_H_ #include <string> #include <iostream> struct strStruct { int len; char* string; }; __declspec (dllexport) int __stdcall TestFunction(strStruct* s) { std::cout << "Just got in dll" << std::endl; std::cout << s[0].string << std::endl; //////std::cout << s[1].string << std::endl; /* char str1[] = "foo"; strcpy(s[0].string, str1); s[0].len = 3; char str2[] = "foobar"; strcpy(s[1].string, str2); s[1].len = 6; */ //std::cout << s[0].string << std::endl; //std::cout << s[1].string << std::endl; std::cout << "Getting out of dll" << std::endl; return 1; } #endif and here is a simple C# program that I am using to test my test dll : using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Runtime.InteropServices; namespace TestStr { class Program { [DllImport("TestStrLib.dll", CharSet = CharSet.Ansi, CallingConvention = CallingConvention.StdCall)] public static extern int TestFunction(string[] s); static void Main(string[] args) { string[] test = new string[2] { "a1a1a1a1a1", "b2b2b2b2b2" }; Console.WriteLine(test[0]); Console.WriteLine(test[1]); TestFunction(test); Console.WriteLine(test[0]); Console.WriteLine(test[1]); Console.ReadLine(); } } } And here is the output produced : a1a1a1a1a1 b2b2b2b2b2 Just got in dll b2b2b2b2b2 Getting out of dll a1a1a1a1a1 b2b2b2b2b2 I have some questions : 1) Why is it outputting the element in the second position of the array rather than in the first position?? 2) If I uncomment the line commented with ////// in the dll file, the program crashes. Why? 3) Obviously I wanted to do more things in the dll (the parts in /* */) than what it does right now, but I am blocked by the first 2 questions... Thanks for all your help

    Read the article

  • Strings exported from a module have extra line breaks

    - by Jesse Millikan
    In a DrScheme project, I'm using a MrEd editor-canvas% with text% and inserting a string from a literal in a Scheme file. This results in an extra blank line in the editor for each line of text I'm trying to insert. I've tracked this down to the apparent fact that string literals from outside modules are getting extra line breaks. Here's a full example. The editor is irrelevant at this point, but it displays the result. ; test-literals.ss (module test-literals scheme (provide (all-defined-out)) (define exported-string "From another module with some more line breaks. ")) ; editor-test.ss (module editor-test scheme (require mred "test-literals.ss") (define w (instantiate frame% ("Editor Test" #f) )) (define c (instantiate editor-canvas% (w) (line-count 12) (min-width 400))) (define editor (instantiate text% ())) (send c set-editor editor) (send w show #t) (send editor erase) (send editor insert "Some text with some line breaks. ") (send editor insert exported-string)) And the result in the editor is Some text with some line breaks. From another module with some more line breaks.

    Read the article

  • problem parsing JSON Strings

    - by blacktooth
    var records = JSON.parse(JsonString); for(var x=0;x<records.result.length;x++) { var record = records.result[x]; ht_text+="<b><p>"+(x+1)+" " +record.EMPID+" " +record.LOCNAME+" " +record.DEPTNAME+" " +record.CUSTNAME +"<br/><br/><div class='slide'>" +record.REPORT +"</div></p></b><br/>"; } The above code works fine when the JsonString contains an array of entities but fails for single entity. result is not identified as an array! Whats wrong with it? http://pastebin.com/hgyWw5hd

    Read the article

  • MS-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except and . Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fecth every row, process it and update the database but I'm guessing this is possible to do in SQL directly. Thanks, Stefan

    Read the article

  • Stale connection with Pheanstalk

    - by token47
    I'm using beanstalkd to offload some work to other machines. The setup is a bit unusual, the server is on the internet (public ip) but the consumers are behind adsl lines on some peoples homes. So there is a linux server as client going out through a dynamic ip and connecting to the server to get a job. It's all PHP and I'm using pheanstalk library. Everything runs smoothly for some time, but then the adsl changes the IP (every 24h hours the provider forces a disconnect-reconnect) the client just hangs, never to go out of "reserve". I thought that putting a timeout on the reserve would help it, but it didn't. As it seems, the client issues a command and blocks, it never checks the timeout. It just issues a reserve-with-timeout (instead of a simple reserve) and it is the servers responsibility to return a TIME_OUT as the timeout occurs. The problem is, the connection is broken (but the TCP/IP doesn't know about that yet until any of the sides try to talk to the other side) and if the client blocked reading, it will never return. The library seems to have support for some kind of timeouts locally (for example when trying to connect to server), but it does not seem to contemplate this scenario. How could I detect the stale connection and force a reconnect? Is there some kind of keepalive on the protocol (and on the pheanstalk itself)? Thanks!

    Read the article

  • NSStrings, C strings, pathnames and encodings in iPhone

    - by iter
    I am using libxml2 in my iPhone app. I have an NSString that holds the pathname to an XML file. The pathname may include non-ASCII characters. I want to get a C string representation of the NSString for to pass to xmlReadFile(). It appears that cStringUsingEncoding gives me the representation I seek. I am not clear on which encoding to use. I wonder if there is a "default" encoding in iPhone OS that I can use here and ensure that I can roundtrip non-ASCII pathnames.

    Read the article

< Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >