Search Results

Search found 3533 results on 142 pages for 'jms topic'.

Page 120/142 | < Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >

  • What should be taught in a "Fundamentals of programming" course at university?

    - by Dervin Thunk
    I have started a new question (see here), because I think the topic is of importance in a more general form. The question is now: If you were a professor at a Computer Science Dept. in some university, what would make it into your course? This is a programming course, second term, first year computer science/computer engineering. Remember you have a limited amount of time, and students are of different levels of competence, and some may be scientists, but some will also go on to be programmers in companies of different kinds. You have to cater to all. Bonus: What language? (Although see this question for my current thoughts about this...) Maybe you want to attach a course outline from some university? See here for an even more general question about this. Answer: I can't really summarize this post... I guess it was too subjective. However, it looks like we have to cover the history of computing up to a certain extent, computer architecture (memory, registers, whatever), C, and finally some basic algos and data structures in a problem solving fashion. This will be the bare bones of the course. Thanks all. I will accept the most voted up answer to close the thread, as it should be done.

    Read the article

  • Which languages and techniques can I use to improve my coding practices?

    - by Danjah
    I've been offered the opportunity upskill through study, while at work which is great. My background I am mostly self-taught, but have worked with many excellent people over the years - both self-taught and fully educated, and on many decent projects. I have mild experience in Actionscript, I'm getting better every day with my Javascript, and my CSS is angled at best practice, but needs a bit of modernising. I'm a traditional interface developer, I'm not stupid and I like a challenge. My goal I need to start seeing ways of applying better logic, optimising code, refactoring, different styles of development (agile, others?), and.. well I need to try and start thinking like.. a more solid programmer. Its hard to describe, I have good solutions and I'm efficient - but I KNOW that there's a bunch I am missing. I am already employed with a solid career, but I feel the need to fill gaps. My question/s Are there a set of guiding principles you can recommend I focus on to improve the points above? Are there particular programming languages which I might focus on to get a broader overview? Do you think I should avoid particular styles of development, or even languages, while solidifying what might end up being part 'the basics' but hopefully 'advanced programming'? -- Sorry if this appears off topic or something but I figure you're probably some of the best people to ask.

    Read the article

  • Java object graph -> xml when direction of object association needs to be reversed.

    - by Sigmoidal
    An application I have been working on has objects with a relationship similar to below. In the real application both objects are JPA entities. class Underlying{} class Thing { private Underlying underlying; public Underlying getUnderlying() { return underlying; } public void setUnderlying(final Underlying underlying) { this.underlying = underlying; } } There is a requirement in the application to create xml of the form: <template> <underlying> <thing/> <thing/> <thing/> </underlying> </template> So we have a situation where the object graph expresses the relationship between Thing and Underlying in the opposite direction to how it's expressed in the xml. I expect to use JAXB to create the xml but ideally I don't want to have to create a new object hierarchy to reflect the associations in the xml. Is there any way to create xml of the form required from the entities in their current form (through the use of xml annotations or something)? I don't have any experience using JAXB but from the limited research I've done it doesn't seem like it's possible to reverse the direction of association in any straightforward way. Any help/advice would be greatly appreciated. One other option that has been suggested is to use XLST to transform the xml into the correct format. I have done no research on this topic as yet but I'll add to the question when I have some more info. Thanks, Matt.

    Read the article

  • How would you implement a hashtable in language x?

    - by mk
    The point of this question is to collect a list of examples of hashtable implementations using arrays in different languages. It would also be nice if someone could throw in a pretty detailed overview of how they work, and what is happening with each example. Edit: Why not just use the built in hash functions in your specific language? Because we should know how hash tables work and be able to implement them. This may not seem like a super important topic, but knowing how one of the most used data structures works seems pretty important to me. If this is to become the wikipedia of programming, then these are some of the types of questions that I will come here for. I'm not looking for a CS book to be written here. I could go pull Intro to Algorithms off the shelf and read up on the chapter on hash tables and get that type of info. More specifically what I am looking for are code examples. Not only for me in particular, but also for others who would maybe one day be searching for similar info and stumble across this page. To be more specific: If you had to implement them, and could not use built-in functions, how would you do it? You don't need to put the code here. Put it in pastebin and just link it.

    Read the article

  • How do I optimize this postfix expression tree for speed?

    - by Peter Stewart
    Thanks to the help I received in this post: I have a nice, concise recursive function to traverse a tree in postfix order: deque <char*> d; void Node::postfix() { if (left != __nullptr) { left->postfix(); } if (right != __nullptr) { right->postfix(); } d.push_front(cargo); return; }; This is an expression tree. The branch nodes are operators randomly selected from an array, and the leaf nodes are values or the variable 'x', also randomly selected from an array. char *values[10]={"1.0","2.0","3.0","4.0","5.0","6.0","7.0","8.0","9.0","x"}; char *ops[4]={"+","-","*","/"}; As this will be called billions of times during a run of the genetic algorithm of which it is a part, I'd like to optimize it for speed. I have a number of questions on this topic which I will ask in separate postings. The first is: how can I get access to each 'cargo' as it is found. That is: instead of pushing 'cargo' onto a deque, and then processing the deque to get the value, I'd like to start processing it right away. I don't yet know about parallel processing in c++, but this would ideally be done concurrently on two different processors. In python, I'd make the function a generator and access succeeding 'cargo's using .next(). But I'm using c++ to speed up the python implementation. I'm thinking that this kind of tree has been around for a long time, and somebody has probably optimized it already. Any Ideas? Thanks

    Read the article

  • Should a developer be a coauthor to a paper presented about the application they developed?

    - by ved
    In our organization, project teams come up with a need and funding and developers are given a basic scope and are allowed to develop the solution. There is a certain degree of implementation freedom given to the developers. They drive the solution to pilot and live deployment from its inception. If the solution is presented in a conference as a technical paper/white paper what is the protocol for the list of authors: because for the most part I see the project manager's and the dev team manager's names as authors but no mention of the actual developer. Is this correct? A lot of us developers feel pretty bummed to never see our names as the coauthors. Appreciate any pointers. Answers to the FOLLOW UP questions (1) in what field of study is the paper, and what are the standards of authorship for that field? The paper is for Flood Plain Management - there is nothing on the abstract guidelines, I have called the contact person listed for comment - waiting to hear. 2) was the paper literally about the software application as your question implies, or were the software issues incidental to the topic of the paper? The paper specifically deals with a GIS Application that is used in Coastal Engineering, yes the software is not incidental, but the meat of the paper and mentioned in the Title. 2

    Read the article

  • Using PHP to get the source code of a URL I must be logged in to reach

    - by Maxwell
    I am trying to write a PHP script that will get the source code of a page in my Amazon account. However, to reach that page, I must be logged in. From what I understand, I should be able to accomplish this by posting the correct request headers, and then capturing the HTML response. Is that correct? If so, I'd really appreciate it if someone could explain to me how exactly I would do this. If it's not right, I'd love to hear the correct way of doing it! I've used Firebug to get the request and response headers I need. It's just a matter of what to do with them now. I read elsewhere on this site that you can't send a request with the PHP post method, and that perhaps using cURL is the way to go. I really know nothing about cURL, so the more info the better. Also, feel free to point me to some useful tutorials on this topic. Thanks! Max

    Read the article

  • Reading bmp file for encrypting and decrypting txt file into it

    - by Shantanu Gupta
    I am trying to read a bmp file in C++(Turbo). But i m not able to print binary stream. I want to encode txt file into it and decrypt it. How can i do this. I read that bmp file header is of 54 byte. But how and where should i append txt file in bmp file. ? I know only Turbo C++, so it would be helpfull for me if u provide solution or suggestion related to topic for the same. int main() { ifstream fr; //reads ofstream fw; // wrrites to file char c; int random; clrscr(); char file[2][100]={"s.bmp","s.txt"}; fr.open(file[0],ios::binary);//file name, mode of open, here input mode i.e. read only if(!fr) cout<<"File can not be opened."; fw.open(file[1],ios::app);//file will be appended if(!fw) cout<<"File can not be opened"; while(!fr) cout<<fr.get(); // error should be here. but not able to find out what error is it fr.close(); fw.close(); getch(); } This code is running fine when i pass txt file in binary mode

    Read the article

  • Java-Eclipse-Spring 3.1 - the fastest way to get familiar with this set

    - by Leron
    I, know almost all of you at some point of your life as a programmer get to the point where you know (more or less) different technologies/languages/IDEs and a times come when you want to get things together and start using them once - more efficient and second - more closely to the real life situation where in fact just knowing Java, or some experience with Eclipse doesn't mean nothing, and what makes you a programmer worth something is the ability to work with the combination of 2 or more combinations. Having this in mind here is my question - what do you think is the optimal way of getting into Java+Eclipse+Spring3.1 world. I've read, and I've read a lot. I started writing real code but almost every step is discovering the wheel again and again, wondering how to do thing you know are some what trivial, but you've missed that one article where this topic was discussed and so on. I don't mind for paying for a good tutorial like for example, after a bit of research I decided that instead of losing a lot of time getting the different parts together I'd rather pay for the videos in http://knpuniversity.com/screencast/starting-in-symfony2-tutorial and save myself a lot of time (I hope) and get as fast as possible to writing a real code instead of wondering what do what and so on. But I find it much more difficult to find such sources of info especially when you want something more specific as me and that's the reason to ask this question. I know a lot of you go through the hard way, and I won't give up if I have to do the same, but to be honest I really hope to get post with good tutorials on the subject (paid or not) because in my situation time is literally money. Thanks Leron

    Read the article

  • How to detect a gamepad button press on OSX 10.5 and higher?

    - by Steph Thirion
    How do I detect a button press on a USB gamepad on OSX 10.5 and higher? I can't wrap my head around the ridiculously complex HID Manager (even though apparently it was simplified with 10.5), and the code samples at Apple have thousands of lines of code that would take days to understand and isolate what I need, so I'd appreciate if someone posts a simple, and fully coded solution for this isolated problem. EDIT: so far all answers are links to source code or semi obscure libraries for all kinds of HID devices, which will require more research time than what I'd like to invest on this. I am starting a bounty to get an actual snippet of code that solves this simple problem (using an external library or not). EDIT POS BOUNTY: thanks to all for you help; but unfortunately the answer that has been automatically selected by the system is not working for me, can't figure out why; and the author has not yet replied to my comments. Any insight would be appreciated, but until a fix is found, anyone looking for resources on this topic should take this answer with a pinch of salt.

    Read the article

  • How to write a flexible modular program with good interaction possibilities between modules?

    - by PeterK
    I went through answers on similar topics here on SO but could't find a satisfying answer. Since i know this is a rather large topic, i will try to be more specific. I want to write a program which processes files. The processing is nontrivial, so the best way is to split different phases into standalone modules which then would be used as necessary (since sometimes i will be only interested in the output of module A, sometimes i would need output of five other modules, etc). The thing is, that i need the modules to cooperate, because the output of one might be the input of another. And i need it to be FAST. Moreover i want to avoid doing certain processing more than once (if module A creates some data which then need to be processed by module B and C, i don't want to run module A twice to create the input for modules B,C ). The information the modules need to share would mostly be blocks of binary data and/or offsets into the processed files. The task of the main program would be quite simple - just parse arguments, run required modules (and perhaps give some output, or should this be the task of the modules?). I don't need the modules to be loaded at runtime. It's perfectly fine to have libs with a .h file and recompile the program every time there is a new module or some module is updated. The idea of modules is here mainly because of code readability, maintaining and to be able to have more people working on different modules without the need to have some predefined interface or whatever (on the other hand, some "guidelines" on how to write the modules would be probably required, i know that). We can assume that the file processing is a read-only operation, the original file is not changed. Could someone point me in a good direction on how to do this in C++ ? Any advice is wellcome (links, tutorials, pdf books...).

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • ASP.NET MVC Viewmodel trouble...

    - by ile
    I've already started similar topic, but still didn't find final solution... So here I am with new one :) ... I'm developing NerdDinner from scratch and now I came to point where I define DinnerViewModel. Following these instructions (starting from Listing 5) I came to this: namespace Nerd.Controllers { // View Model Classes public class DinnerViewModel { public DinnerViewModel(List<Dinner> dinners) { this.Dinners = dinners; } public List<Dinner> Dinners { get; private set; } } public class DinnerController : Controller { private DinnerRepository dinnerRepository = new DinnerRepository(); .... public ActionResult NewDinners() { // Create list of products var dinners = new List<Dinner>(); dinners.Add(new Dinner(/*Something to add*/)); // Return view return View(new DinnerViewModel(dinners)); } } } Also, the Dinner table in this new version of NerdDinner is a bit shortened (it contains of DinnerID, Title, EventDate and Description fields). No matter what I try to add here dinners.Add(new Dinner(/*Something to add*/)); I always get following error Error 1 'Nerd.Model.Dinner' does not contain a constructor that takes '1' arguments C:\Documents and Settings\ilija\My Documents\Visual Studio 2008\Projects\Nerd\Nerd\Controllers\DinnerController.cs 150 25 Nerd Because I'm total beginner in C# and generally OOP, I have no idea what to do here... I suppose I need to declare a constructor, but how and where exactly? Thanks, Ile

    Read the article

  • Understanding how software testing works and what to test.

    - by RHaguiuda
    Intro: I've seen lots of topics here on SO about software testing and other terms I don't understand. Problem: As a beginner developer I, unfortunately, have no idea how software testing works, not even how to test a simple function. This is a shame, but thats the truth. I also hope this question can help others beginners developers too. Question: Can you help me to understand this subject a little bit more? Maybe some questions to start would help: When I develop a function, how should I test it? For example: when working with a sum function, should I test every input value possible or just some limits? How about testing functions with strings as parameters? In a big program, do I have to test every single piece of code of it? When you guys program do you test every code written? How automated test works and how can I try one? How tools for automated testing works and what they do? I`ve heard about unit testing. Can I have a brief explanation on this? What is a testing framework? If possible please post some code with examples to clarify the ideas. Any help on this topic is very welcome! Thanks.

    Read the article

  • Processing more than one button click at Android Widget

    - by dive
    Hi, all. I saw this topic and implement IntentService as describes, but what if I want more that one button? How can I distinguish button from each other? I'm trying to setFlags, but cannot read it at onHandleIntent() method: public static class UpdateService extends IntentService { ... @Override public void onHandleIntent(Intent intent) { ComponentName me = new ComponentName(this, ExampleProvider.class); AppWidgetManager manager = AppWidgetManager.getInstance(this); manager.updateAppWidget(me, buildUpdate(this)); } private RemoteViews buildUpdate(Context context) { RemoteViews updateViews = new RemoteViews(context.getPackageName(), R.layout.main_layout); Intent i = new Intent(this, ExampleProvider.class); PendingIntent pi = PendingIntent.getBroadcast(context, 0, i, 0); updateViews.setOnClickPendingIntent(R.id.button_refresh, pi); i = new Intent(this, ExampleProvider.class); pi = PendingIntent.getBroadcast(context, 0, i, 0); updateViews.setOnClickPendingIntent(R.id.button_about, pi); return updateViews; } } At this little piece of code I have two PendingIntent linked with setOnClickPendingIntent, can I distinguish this intent for different actions and processing? Thanks for help

    Read the article

  • How do I detect proximity of the mouse pointer to a line in Flex?

    - by Hanno Fietz
    I'm working on a charting UI in Flex. One of the features I want to implement is "snapping" of the mousepointer to the data points in the diagram. I. e., if the user hovers the mouse pointer over a line diagram and gets close to the data point, I want the pointer to move to the exact coordinates and show a marker, like this: Currently, the lines are drawn on a Shape, using the Graphics API. The Shape is a child DisplayObject of a custom UIComponent subclass with the exact same dimensions. This means, I already get mouseOver events on the parent of the diagram's canvas. Now I need a way to detect if the pointer is close to one of the data points. I. e. I need an answer to the question "Which data points lie within a radius of x pixels from my current position and which of them is closest?" upon each move of the mouse. I can think of the following possibilities: draw the lines not as simple lines in the graphics API, but as more advanced objects that can have their own mouseOver events. However, I want the snapping to trigger before the mouse is actually over the line. check the original data for possible candidates upon each mouse movement. Using binary search, I might be able to reduce the number of items I have to compare sufficently. prepare some kind of new data structure from the raw data that makes the above search more efficient. I don't know how that would look like. I'm guessing this is a pretty standard problem for a number of applications, but probably the actual code usually is inside of some framework. Is there anything I can read about this topic?

    Read the article

  • Is XSLT worth investing time in and are there any actual alternatives?

    - by Keeno
    I realize this has been a few other questions on this topic, and people are saying use your language of choice to manipulate the XML etc etc however, not quite fit my question exactly. Firstly, the scope of the project: We want to develop platform independent e-learning, currently, its a bunch of HTML pages but as they grow and develop they become hard to maintain. The idea: Generate up an XML file + Schema, then produce some XSLT files that process the XML into the eLearning modiles. XML to HTML via XSLT. Why: We would like the flexibilty to be able to easy reformat the content (I realize CSS is a viable alternative here) If we decide to alter the pages layout or functionality in anyway, im guessing altering the "shared" XSLT files would be easier than updating the HTML files. So far, we have about 30 modules, with up to 10-30 pages each Depending on some "parameters" we could output drastically different page layouts/structures, above and beyond what CSS can do Now, all this has to be platform independent, and to be able to run "offline" i.e. without a server powering the HTML Negatives I've read so far for XSLT: Overhead? Not exactly sure why...is it the compute power need to convert to HTML? Difficult to learn Better alternatives Now, what I would like to know exactly is: are there actually any viable alternatives for this "offline"? Am I going about it in the correct manner, do you guys have any advice or alternatives. Thanks!

    Read the article

  • Static Vs Non-Static Method Performance C#

    - by dotnetguts
    Hello All, I have few global methods declared in public class in my asp.net web application. I have habbit of declaring all global methods in public class in following format public static string MethodName(parameters) { } I want to know how it would impact on performance point of view? 1) Which one is Better? Static Method or Non-Static Method? 2) Reason why it is better? Following link shows Non-Static methods are good because, static methods are using locks to be Thread-safe. The always do internally a Monitor.Enter() and Monitor.exit() to ensure Thread-safety. http://bytes.com/topic/c-sharp/answers/231701-static-vs-non-static-function-performance And Following link shows Static Methods are good static methods are normally faster to invoke on the call stack than instance methods. There are several reasons for this in the C# programming language. Instance methods actually use the 'this' instance pointer as the first parameter, so an instance method will always have that overhead. Instance methods are also implemented with the callvirt instruction in the intermediate language, which imposes a slight overhead. Please note that changing your methods to static methods is unlikely to help much on ambitious performance goals, but it can help a tiny bit and possibly lead to further reductions. http://dotnetperls.com/static-method I am little confuse which one to use? Thanks

    Read the article

  • No GPS Update retrieved? Problem in Code?

    - by poeschlorn
    Hello mates, I've got a serious problem with my GPS on my Nexus One: I wrote a kind of hello world with GPS, but the Toast that should be displayed isn't :( I don't know what I'm doing wrong...maybe you could help me getting this work. Here's my code: package gps.test; import android.app.Activity; import android.content.Context; import android.location.Location; import android.location.LocationListener; import android.location.LocationManager; import android.os.Bundle; import android.widget.Toast; public class GPS extends Activity { private LocationManager lm; private LocationListener locationListener; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); // ---use the LocationManager class to obtain GPS locations--- lm = (LocationManager) getSystemService(Context.LOCATION_SERVICE); locationListener = new MyLocationListener(); lm.requestLocationUpdates(LocationManager.GPS_PROVIDER, 100, 1, locationListener); } private class MyLocationListener implements LocationListener { @Override public void onLocationChanged(Location loc) { if (loc != null) { Toast.makeText( getBaseContext(), "Location changed : Lat: " + loc.getLatitude() + " Lng: " + loc.getLongitude(), Toast.LENGTH_SHORT).show(); } } @Override public void onProviderDisabled(String provider) { // TODO Auto-generated method stub } @Override public void onProviderEnabled(String provider) { // TODO Auto-generated method stub } @Override public void onStatusChanged(String provider, int status, Bundle extras) { // TODO Auto-generated method stub } } } Theoretically there should be a new toast every 100 milliseconds, shouldn't it? Or at least, when I change my position by one meter!? I've no idea why it doesn't. I must admit I'm new to the topic, maybe I've missed something? It would be great if you could give me a hint :) nice greetings, poeschlorn

    Read the article

  • How to link jQuery UI datepicker functionality with a select list

    - by take2
    I'm trying to connect jQuery UI's datepicker with a select list. I have found one explanation on jQuery's Forum ( forum.jquery.com/topic/jquery-ui-datepicker-with-select-lists), but I can't get it working. There are input and select list both declared: <select id="selectMonth"><option value="01">Jan</option><option value="02">Feb</option> <option value="03">Mar</option><option value="04">Apr</option>...</select> <select id="selectDay"><option value="01">1</option><option value="02">2</option> <option value="03">3</option><option value="04">4</option>...</select> <select id="selectYear"><option value="2012">2012</option><option value="2013">2013</option> <option value="2014">2014</option>...</select> <p>Date: <input type="text" id="selectedDatepicker" /></p> This is the script: $(function() { $('#selectedDatepicker').datepicker({ beforeShow: readSelected, onSelect: updateSelected, minDate: new Date(2012, 1 - 1, 1), maxDate: new Date(2014, 12 - 1, 31), showOn: 'both', buttonImageOnly: true, buttonImage: 'img/calendar.gif'}); // Prepare to show a date picker linked to three select controls function readSelected() { $('#selectedDatepicker').val($('#selectMonth').val() + '/' + $('#selectDay').val() + '/' + $('#selectYear').val()); return {}; } // Update three select controls to match a date picker selection function updateSelected(date) { $('#selectMonth').val(date.substring(0, 2)); $('#selectDay').val(date.substring(3, 5)); $('#selectYear').val(date.substring(6, 10)); } }); And here is the fiddle: http://jsfiddle.net/xKXZm/ They are not connected properly, the only "connected behaviour" is that when you click on the input button, it picks up the value of the select list. On the other hand, the select list never picks up the value of the input nor will the input pick up the value of the select list until you click on it.

    Read the article

  • Radio buttons being reset in FF on cache-refresh

    - by Andrew Song
    (This is technically an addendum to an earlier StackOverflow question I had posted, but my original post asked a different question which doesn't really cover this topic -- I don't want to edit my older question as I feel this is different enough to merit its own page) While browsing my website in Firefox 3.5 (and only FF3.5), I come across a page with two radio buttons that have the following HTML code: <input id="check1" type="radio" value="True" name="check" checked="checked"/> <input id="check2" type="radio" value="False" name="check"/> This page renders as expected, with 'check1' checked and 'check2' unchecked. When I then go to refresh the page by pressing Control + R, the two radio buttons render, but they are both unchecked even though the raw HTML code is the same (as above). If I do a cache-miss refresh (via Control + F5 or Control + Shift + R), the page returns back to the way you'd expect it. This is not a problem in any other browser I've tried except FF3.5. What is causing these radio buttons to be reset on a normal refresh? How can I avoid this?

    Read the article

  • [OT a bit] Flex+JEE what is it good for?

    - by Zenzen
    Ok so sorry for being, I guess, a bit off topic but still I think this is the best place to ask. My new semester just started (don't worry I won't ask you to do my homework) and this time we have a rather cool subject about www programming in general where we have to do a web service, web abb - whatever as long as it's "web". Here's the problem though, my team and I want to do it with Flex and JEE but we don't have much experience about what are they actually used for. I mean we know you can do virtually anything with it, but we don't really want to lose time on doing something useless. My first idea was to do a "brainstorming" 3D room/service - a place where people could log in have a video conference, a whiteboard, a place to upload pictures everyone could see, some toolbars for google, youtube etc. plus some other features which would make real-time brainstorming easy when you can't get everyone in one place. But is Flex+JEE really suitable? I mean I'm 99% sure it's doable but is it really worth doing it in Flex+JEE or was the whole purpose of JEE completely different? @EDIT: well this was only one of our ideas obviously. I do know the basics of JSP, Servlets, JPA etc. of course but yeah the main goal of this project is to get some actual experience. The problem is we don't really know is it worth doing something like let's say a social network (something like extended facebook) for gamers (doesn't really matter if it already exists) in JEE or would it only look ridiculous (because PHP or whatever would be a far better choice)? Bottom line is that we are wondering are only large scale applications (for banks etc.) written in JEE or is it good for anything (even the smaller projects)?

    Read the article

  • Why doesn't java.lang.Number implement Comparable?

    - by Julien Chastang
    Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

    Read the article

  • JQuery: how to store records id for data from ajax query in dynamicly created html elements

    - by grapkulec
    Probably question title is rather cryptic but I will try to explain myself here so please bare with me :) Let's assume this configuration: server-side is PHP application responding for requests with data (list of items, single item details, etc.) in json format client-side is JQuery application sending ajax request to that PHP app and creating html content corresponding with received data So, for example: client requests "list of all animals with names staring with 'A'", gets the json response from server, and for every "animal" creates some html gizmo like div with animal description or something like that. It doesn't really matter what html element it will be but it has to point exactly to specific record by "containing" id of that record. And here is my dilemma: is it good solution to use "id" property for that? So it would be like: <div id="10" class="animal"> <p> This is animal of very mysterious kind... </p> </div> <div id="11" class="animal"> <p> And this one is very common to our country... </p> </div> where id="10" is of course indication that this is representation of record with id = 10. Or maybe I should store this record id in some custom made tag like <record_id>10</record_id> and leave an "id" strictly for what it was meant to be (css selector)? I need that record id for further stuff like updating database with some user input or deleting some of "animals" or creating new ones or anything that will be needed. All manipulations will be done with JQuery and ajax requests and responses will be visualized also with dynamic creation of html interface. I'm sure that somebody had to deal with that kind of stuff before so I would be grateful for some tips on that topic.

    Read the article

  • Trigger JavaScript action after Datatable is loaded

    - by perissf
    In a JSF 2.1 + PrimeFaces 3.2 web application, I need to trigger a JavaScript function after a p:dataTable is loaded. I know that there is no such event in this component, so I have to find a workaround. In order to better understand the scenario, on page load the dataTable is not rendered. It is rendered after a successful login: <p:commandButton value="Login" update=":aComponentHoldingMyDataTable" action="#{loginBean.login}" oncomplete="handleLoginRequest(xhr, status, args)"/> As you can see from the above code, I have a JavaScript hook after the successful login, if it can be of any help. Immediately after the oncomplete action has finished, the update attribute renders the dataTable: <p:dataTable var="person" value="#{myBean.lazyModel}" rendered="#{p:userPrincipal() != null}" /> After the datatable is loaded, I need to run a JavaScript function on each row item, in order to subscribe to a cometD topic. In theory I could use the oncomplete attribute of the login Button for triggering a property from myBean in order to retrieve once again the values to be displayed in the dataTable, but it doesn't seem very elegant. The JavaScript function should do something with the rowKey of each row of the dataTable: function javaScriptFunctionToBeTriggered(rowKey) { // do something }

    Read the article

< Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >