Search Results

Search found 5433 results on 218 pages for 'escaped characters'.

Page 122/218 | < Previous Page | 118 119 120 121 122 123 124 125 126 127 128 129  | Next Page >

  • Why use spaces instead of tabs for indentation? [closed]

    - by erenon
    Possible Duplicate: Are spaces preferred over tabs for indentation? Why do most coding standards recommend the use of spaces instead of tabs? Tabs can be configured to be as many characters wide as needed, but spaces can't. Example: Zend cs Pear cs Pear manual: This helps to avoid problems with diffs, patches, SVN history and annotations. How could tabs cause problems?

    Read the article

  • Special chars in Amazon S3 keys?

    - by Martin
    Is it possible to have special characters like åäö in the key? If i urlencode the key before storing it works, but i cant really find a way to access the object. If i write åäö in the url i get access denied (like i get if the object is not found). If i urlencode the url i paste in the browser i get "InvalidURICouldn't parse the specified URI". Is there some way to do this?

    Read the article

  • how could I store data within a GUID

    - by Mark
    I have an application that I want to represent a users session (just small pieces of data here and there) within a GUID. Its a 16 HEX characters (so 16^16 possible values) string and I want to 'encode' some data within that GUID. How can I achieve this? I am really after any ideas and implementations here, Ive not yet decided on the best mechanism for it yet. I would also like encryption to be involved if possible... Thanks a lot Mark

    Read the article

  • Sql server messed up degree symbol

    - by user228058
    Some of the degree sysmbols in my sql server database are displaying like this: 173-¦F. When I do a search for that - SELECT * FROM PRoduct WHERE description LIKE '%-¦%', it does not bring them up. How can I find (and replace) such characters?

    Read the article

  • [PHP] Read and write to a file while keeping lock

    - by Znarkus
    Hi! I am making a simple page load counter by storing the current count in a file. This is how I want to do this: Lock the file Read the current count Increment it Write new count Unlock file/close it Can this be done? As I understand it, the file can't be written to without losing the lock. The only way I have come up with to tackle this, is to write a character using "r+" mode, and then counting characters.

    Read the article

  • Add text to every line in text file using PowerShell

    - by Joshua
    I'd like to add characters to the end of every line of text in a .txt document. #Define Variables $a = c:\foobar.txt $b = get-content $a #Define Functions function append-text { foreach-Object { add "*" } } #Process Code $b | append-text Something like that. Essentially, load a given text file, add a "*" the the end of every single line of text in that text file, save and close.

    Read the article

  • Displaying paragraphs in HTML

    - by Roy
    Hi all, I'm writing a web application which needs to bring the stored paragraphs into the front web. The text come from excel work sheet and contains control characters like indent. I want to show the text in the exactly manner as it was in excel. How can I do that then? Thanks in advance.

    Read the article

  • Drill down rss reader iphone

    - by bing
    Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

    Read the article

  • MS Access ADODB.recordset character limit is 2036!? Can this be increased?

    - by souper-dragon
    In the following AccessVBA code, I am trying to write a record to a memo field called "Recipient_Display": oRec1.Fields("RECIPIENT_DISPLAY") = Left(sRecipientDisplayNames, Len(sRecipientDisplayNames) - 2) When the string contains 2036 characters, the write completes. Above this number I get the following error: Run-time error'-2147217887(80040e21)': Could not update; currently locked by another session on this machine. What is the significance of this number 2036 and is there a property I can adjust that will allow the above update to take place?

    Read the article

  • Create, sort, and print a list of 100 random ints in the fewest chars of code

    - by TheSoftwareJedi
    What is the least amount of code you can write to create, sort (ascending), and print a list of 100 random positive integers? By least amount of code I mean characters contained in the entire source file, so get to minifying. I'm interested in seeing the answers using any and all programming languages. Let's try to keep one answer per language, edit the previous to correct or simplify. If you can't edit, comment?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do I write a Oracle SQl query for this tricky question...

    - by atrueguy
    Here is the table data with the column name as Ships. +--------------+ Ships | +--------------+ Duke of north | ---------------+ Prince of Wales| ---------------+ Baltic | ---------------+ In the Outcomes table, transform names of the ships containing more than one space, as follows: Replace all characters between the first and the last spaces (excluding these spaces) by symbols of an asterisk (*). The number of asterisks must be equal to number

    Read the article

  • preg_match in php

    - by Satish
    I want to use preg_match() such that there should not be special characters such as `@#$%^&/ ' in a given string. For example : Coding : Outputs valid : Outputs Invalid(String beginning with space) 12Designing : outputs invalid Project management :Outputs valid (space between two words are valid) 123 :Outputs invalid

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • Problem with regular expression for some special parttern.

    - by SpawnCxy
    Hi all, I got a problem when I tried to find some characters with following code: preg_match_all('/[\w\uFF10-\uFF19\uFF21-\uFF3A\uFF41-\uFF5A]/',$str,$match); //line 5 print_r($match); And I got error as below: Warning: preg_match_all() [function.preg-match-all]: Compilation failed: PCRE does not support \L, \l, \N, \U, or \u at offset 4 in E:\mycake\app\webroot\re.php on line 5 I'm not so familiar with reg expression and have no idea about this error.How can I fix this?Thanks.

    Read the article

< Previous Page | 118 119 120 121 122 123 124 125 126 127 128 129  | Next Page >