Search Results

Search found 22839 results on 914 pages for 'decimal point'.

Page 123/914 | < Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >

  • Symfony2 Entity to array

    - by Adriano Pedro
    I'm trying to migrate my flat php project to Symfony2, but its coming to be very hard. For instance, I have a table of Products specification that have several specifications and are distinguishables by its "cat" attribute in that Extraspecs DB table. Therefore I've created a Entity for that table and want to make an array of just the specifications with "cat" = 0... I supose the code is this one.. right? $typeavailable = $this->getDoctrine() ->getRepository('LabsCatalogBundle:ProductExtraspecsSpecs') ->findBy(array('cat' => '0')); Now how can i put this in an array to work with a form like this?: form = $this ->createFormBuilder($product) ->add('specs', 'choice', array('choices' => $typeavailableArray), 'multiple' => true) Thank you in advance :) # Thank you all.. But now I've came across with another problem.. In fact i'm building a form from an existing object: $form = $this ->createFormBuilder($product) ->add('name', 'text') ->add('genspec', 'choice', array('choices' => array('0' => 'None', '1' => 'General', '2' => 'Specific'))) ->add('isReg', 'choice', array('choices' => array('0' => 'Material', '1' => 'Reagent', '2' => 'Antibody', '3' => 'Growth Factors', '4' => 'Rodents', '5' => 'Lagomorphs'))) So.. in that case my current value is named "extraspecs", so i've added this like: ->add('extraspecs', 'entity', array( 'label' => 'desc', 'empty_value' => ' --- ', 'class' => 'LabsCatalogBundle:ProductExtraspecsSpecs', 'property' => 'specsid', 'query_builder' => function(EntityRepository $er) { return $er ->createQueryBuilder('e'); But "extraspecs" come from a relationship of oneToMany where every product has several extraspecs... Here is the ORM: Labs\CatalogBundle\Entity\Product: type: entity table: orders__regmat id: id: type: integer generator: { strategy: AUTO } fields: name: type: string length: 100 catnumber: type: string scale: 100 brand: type: integer scale: 10 company: type: integer scale: 10 size: type: decimal scale: 10 units: type: integer scale: 10 price: type: decimal scale: 10 reqcert: type: integer scale: 1 isReg: type: integer scale: 1 genspec: type: integer scale: 1 oneToMany: extraspecs: targetEntity: ProductExtraspecs mappedBy: product Labs\CatalogBundle\Entity\ProductExtraspecs: type: entity table: orders__regmat__extraspecs fields: extraspecid: id: true type: integer unsigned: false nullable: false generator: strategy: IDENTITY regmatid: type: integer scale: 11 spec: type: integer scale: 11 attrib: type: string length: 20 value: type: string length: 200 lifecycleCallbacks: { } manyToOne: product: targetEntity: Product inversedBy: extraspecs joinColumn: name: regmatid referencedColumnName: id HOw should I do this? Thank you!!!

    Read the article

  • How to determine if a .NET Type is a custom struct?

    - by SztupY
    Hi! How to write a simple method, that checks whether a concrete type is a custom struct (created with public struct { };) or not. Checking Type.IsValueType is not enough, because it is also true to int, long, etc, and adding a check to !IsPrimitiveType won't exclude decimal, DateTime and maybe some other value types. I know that most of the built in value types are actually "structs", but I only want to check for "custom structs" These questions are mostly the same but without the answer I need: #1 #2 #3

    Read the article

  • A weird crash...

    - by Nima
    Hi, I have a piece of code that runs in debug mode in VS2008, C++. The problem is that when I am debugging the code line by line, at a very weird point of the code, it crashes and says: debug assertion faild. Expression: _BLOCK_TYPE_IS_VALID(pHead-nBlockUse) The crash point is on the first closed curly bracket (after mesh-edges[e].needsUpdate=false;) I don't understand why on a curly bracket? does that make sense to you guys? Can anybody help me understanding what is going on..? for(int e=0; e<mesh->edges.size(); e++) { if(mesh->edges[e].valid && mesh->edges[e].v[0]>=0 && mesh->edges[e].v[1]>=0 && mesh->points[mesh->edges[e].v[0]].writable && mesh->points[mesh->edges[e].v[1]].writable) { //update v_hat and its corresponding error DecEdge Current = DecEdge(e); pair<Point, float> ppf = computeVhat(e); Current.v_hat = ppf.first; Current.error = ppf.second; edgeSoup.push(Current); mesh->edges[e].needsUpdate=false; } }

    Read the article

  • Signable, streamable, "readable" archive format?

    - by alexvoda
    Is there any archive format that offers the following: be digitally sign-able with a digital certificate from a trusted source like Verisign - for preventing changes to the file (I am not referring to read only, but in case the file was changed it should no longer be signed telling the user this is not the original file) be stream-able - be able to be opened even if not all of the content has been transfered (also not strictly linearly) be "readable" - be able to read the data without extracting to a temporary folder (AFAIK if you open a file in a zip archive it is extracted first, and this stays true even for zip based formats like OOXML. This is not what I want) be portable - support on at least Windows, Linux and Mac OS X is a must, or at least future support be free of patents - Be open source - also preferably a license that allows commercial use(as far as i know GPL a share-alike licence so it doesn't allow comercial use, BSD on the other hand alows it) Note: Though it may come in handy eventually I can not think right now of a scenario that would require both point 1 and point 2 simultaneously. Or lets leave it a be able to check the signature only when the whole file was downloaded. I am not interested in: being able to be compressed being supported on legacy systems Does any existing archive format fit this description (tar evolutions like DAR and pax come to mind) ? If there is, are there programing libraries available for the above mentioned OSs? If not, would it be hard to create such a thing? EDIT: clarrified piont 5 EDIT 2: added a note to clarify point 1 and 2 P.S.: This is my first question on StackOverflow

    Read the article

  • When is ¦ not equal to ¦?

    - by Trey Jackson
    Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • Can't get Sum() working in Northwind example

    - by Vince
    Hi, The following code is generating a runtime error and I have no idea why. from o in Orders group o by o.Employee into employeeOrders select new { employeeOrders.Key.EmployeeID, employeeOrders.Key.FirstName, Orders = from eord in employeeOrders orderby eord.OrderID select new { eord.OrderID, eord.OrderDate, OrderTotal=eord.OrderDetails.Sum (od => od.UnitPrice) } } The error is Member access 'System.Decimal UnitPrice' of 'LINQPad.User.OrderDetails' not legal on type 'LINQPad.User.Orders I've also tried this in VS2010 with a standard drag and drop data context and same thing. Thanks in advance

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Castle Dynamic Proxy is it possible to intercept value types?

    - by JS Future Software
    Hi, I have a problem and can not find answer and any tip if it is possible to intercept value types in C# by Castle dynamic proxy? I want to intercept IDictionary with INotifyChanged interface. I need this to update view when presenter is changing model. Boxing decimal in object only for making interface is not good idea... maybe somebody have idea how to intrcept value types? Thanks to all answers

    Read the article

  • Shell loops using non-integers?

    - by mary
    I wrote a .sh file to compile and run a few programs for a homework assignment. I have a "for" loop in the script, but it won't work unless I use only integers: #!/bin/bash for (( i=10; i<=100000; i+=100)) do ./hw3_2_2 $i done The variable $i is an input for the program hw3_2_2, and I have non-integer values I'd like to use. How could I loop through running the code with a list of decimal numbers?

    Read the article

  • Is anyone familiar with SDPT.clsSDPT?

    - by David Stratton
    Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Values of generated column not appearing in table

    - by msh210
    I'm using mysql version 5.1.41-3ubuntu12.10 (Ubuntu). mysql> show create table tt\G *************************** 1. row *************************** Table: tt Create Table: CREATE TABLE `tt` ( `pz` int(8) DEFAULT NULL, `os` varchar(8) DEFAULT NULL, `uz` int(11) NOT NULL, `p` bigint(21) NOT NULL DEFAULT '0', `c` decimal(23,0) DEFAULT NULL, KEY `pz` (`pz`), KEY `uz` (`uz`), KEY `os` (`os`), KEY `pz_2` (`pz`,`uz`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 1 row in set (0.00 sec) mysql> select pz,uz,pz*uz, -> if(pz*uz,1,.5), -> left(pz,2) pl,left(lpad(uz,5,0),2) ul, -> p from tt limit 10; +-------+----+-------+----------------+--------+----+--------+ | pz | uz | pz*uz | if(pz*uz,1,.5) | pl | ul | p | +-------+----+-------+----------------+--------+----+--------+ | NULL | 0 | NULL | 0.5 | NULL | 00 | 4080 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 323754 | | 89101 | 0 | 0 | 0.5 | 89 | 00 | 6880 | | 0 | 0 | 0 | 0.5 | 0 | 00 | 11591 | | 89110 | 0 | 0 | 0.5 | 89 | 00 | 72 | | 78247 | 0 | 0 | 0.5 | 78 | 00 | 27 | | 90062 | 0 | 0 | 0.5 | 90 | 00 | 5 | | 63107 | 0 | 0 | 0.5 | 63 | 00 | 4 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 54561 | | 94102 | 0 | 0 | 0.5 | 94 | 00 | 12499 | +-------+----+-------+----------------+--------+----+--------+ So far so good. As you see, 0.5 appears as a value of if(pz*uz,1,.5). The problem is: mysql> select os, -> if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5) uptwo, -> if(pz*uz,left(pz,3)<=>left(lpad(uz,5,0),3),.5) upthree, -> sum(p) p,sum(c) c -> from tt t -> group by os,uptwo,upthree order by null; +----+-------+---------+---------+-------+ | os | uptwo | upthree | p | c | +----+-------+---------+---------+-------+ | u | 1 | 1 | 52852 | 318 | | i | 1 | 1 | 7046563 | 21716 | | m | 1 | 1 | 1252166 | 7337 | | i | 0 | 0 | 1830284 | 4033 | | m | 0 | 0 | 294612 | 1714 | | i | 1 | 0 | 911486 | 3560 | | m | 1 | 0 | 145182 | 1136 | | u | 0 | 0 | 12144 | 23 | | u | 1 | 0 | 1571 | 8 | +----+-------+---------+---------+-------+ Although I group by uptwo, 0.5 doesn't appear in that column. What happened to the 0.5 values? Edit: As noted in the comments to Todd Gibson's answer, I also tried it with if(pz*uz,cast(left(pz,2)<=>left(lpad(uz,5,0),2) as decimal),.5) instead of if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5), but it, too, didn't work.

    Read the article

  • Formatting numbers with significant figures in C#

    - by Chris Farmer
    I have some decimal data that I am pushing into a SharePoint list where it is to be viewed. I'd like to restrict the number of significant figures displayed in the result data based on my knowledge of the specific calculation. Sometimes it'll be 3, so 12345 will become 12300 and 0.012345 will become 0.0123. Occasionally it will be 4 or 5. Is there any convenient way to handle this?

    Read the article

  • MSSQL 2005 FOR XML

    - by Lima
    Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

    Read the article

  • base-n series generator for a given number in java,,

    - by Senthil
    I want to create a program for generating the series for the given base-n. , for example if my input is 2,then series shuould be, 00,01,10,11,etc.,(binary) if my input is 10,then series shuould be,1,2,3,4,5,etc.,(decimal) is there any general mechanism to find these numbers so that I can program for base-n.,

    Read the article

  • Rounding values up or down in C#

    - by c11ada
    Hey all, I've created a game which gives a score at the end of the game, but the problem is that this score is sometimes a number with a lot of digits after the decimal point (like 87.124563563566). How would I go about rounding up or down the value so that I could have something like 87.12? Thanks!

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Filter list as a parameter in a compiled query

    - by JK
    I have the following compiled query that I want to return a list of "groups" that don't have a "GroupID" that's contained in a filtered list: CompiledQuery.Compile(ConfigEntities contexty, List list) = from c in context.Groups where (!csList.Contains(c.GroupID)) select c).ToList() However I'm getting the following run-time error: The specified parameter 'categories' of type 'System.Collections.Generic.List`1[[System.Int32, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c261364e126]]' is not valid. Only scalar parameters (such as Int32, Decimal, and Guid) are supported. Any ideas?

    Read the article

  • Unable to Export contents of Data table (with French formatted Numbers ) to XML

    - by Ananth
    I have a data Table with numbers formatted according to the current regional settings. ie ( in French decimal separators are ',' instead of '.' in English). I need to export it to XML. Numbers in XML needs to be formatted according to the current regional settings.But now numbers in XML are formatted in English.Is there any way to make the number formatting in XML according to current regional settings ( or based on the locale of the Data Table) during the exporting process ?

    Read the article

< Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >