Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 123/336 | < Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >

  • Javascript "Member not found" error in IE8

    - by Steven
    I'm trying to debug the following block of Javascript code to see what the issue is. I'm getting an error that says "Member not found" on the line constructor = function() { in the extend:function() method. I'm not very good with Javascript, and I didn't write this, so I'm kind of lost on what the issue is. The error only occurs in IE8, it works fine in IE7 and Firefox. var Class = { create: function() { return function() { if(this.destroy) Class.registerForDestruction(this); if(this.initialize) this.initialize.apply(this, arguments); } }, extend: function(baseClassName) { constructor = function() { var i; this[baseClassName] = {} for(i in window[baseClassName].prototype) { if(!this[i]) this[i] = window[baseClassName].prototype[i]; if(typeof window[baseClassName].prototype[i] == 'function') { this[baseClassName][i] = window[baseClassName].prototype[i].bind(this); } } if(window[baseClassName].getInheritedStuff) { window[baseClassName].getInheritedStuff.apply(this); } if(this.destroy) Class.registerForDestruction(this); if(this.initialize) this.initialize.apply(this, arguments); } constructor.getInheritedStuff = function() { this[baseClassName] = {} for(i in window[baseClassName].prototype) { if(!this[i]) this[i] = window[baseClassName].prototype[i]; if(typeof window[baseClassName].prototype[i] == 'function') { this[baseClassName][i] = window[baseClassName].prototype[i].bind(this); } } if(window[baseClassName].getInheritedStuff) { window[baseClassName].getInheritedStuff.apply(this); } } return constructor; }, objectsToDestroy : [], registerForDestruction: function(obj) { if(!Class.addedDestructionLoader) { Event.observe(window, 'unload', Class.destroyAllObjects); Class.addedDestructionLoader = true; } Class.objectsToDestroy.push(obj); }, destroyAllObjects: function() { var i,item; for(i=0;item=Class.objectsToDestroy[i];i++) { if(item.destroy) item.destroy(); } Class.objectsToDestroy = null; } }

    Read the article

  • How do I pass a cookie to a Sinatra app using curl?

    - by Brandon Toone
    I'm using the code from the example titled "A Slightly Bigger Example" from this tutorial http://rubylearning.com/blog/2009/09/30/cookie-based-sessions-in-sinatra/ to figure out how to send a cookie to a Sinatra application but I can't figure out how to set the values correctly When I set the name to be "brandon" in the application it creates a cookie with a value of BAh7BiIJdXNlciIMYnJhbmRvbg%3D%3D%0A which is a url encoding (http://ostermiller.org/calc/encode.html) of the value BAh7BiIJdXNlciIMYnJhbmRvbg== Using that value I can send a cookie to the app correctly curl -b "rack.session=BAh7BiIJdXNlciIMYnJhbmRvbg==" localhost:9393 I'm pretty sure that value is a base64 encoding of the ruby hash for the session since the docs (http://rack.rubyforge.org/doc/classes/Rack/Session/Cookie.html) say The session is a Ruby Hash stored as base64 encoded marshalled data set to :key (default: rack.session). I thought that meant all I had to do was base64 encode {"user"=>"brandon"} and use it in the curl command. Unfortunately that creates a different value than BAh7BiIJdXNlciIMYnJhbmRvbg==. Next I tried taking the base64 encoded value and decoding it at various base64 decoders online but that results in strange characters (a box symbol and others) so I don't know how to recreate the value to even encode it. So my question is do you know what characters/format I need to get the proper base64 encoding and/or do you know of another way to pass a value using curl such that it will register as a proper cookie for a Sinatra app?

    Read the article

  • 'Must Override a Superclass Method' Errors after importing a project into Eclipse

    - by Tim H
    Anytime I have to re-import my projects into Eclipse (if I reinstalled Eclipse, or changed the location of the projects), almost all of my overridden methods are not formatted correctly, causing the error 'The method ?????????? must override a superclass method'. It may be noteworthy to mention this is with Android projects - for whatever reason, the method argument values are not always populated, so I have to manually populate them myself. For instance: list.setOnCreateContextMenuListener(new OnCreateContextMenuListener() { public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo) { //These arguments have their correct names } }); will be initially populated like this: list.setOnCreateContextMenuListener(new OnCreateContextMenuListener() { public void onCreateContextMenu(ContextMenu arg1, View arg2, ContextMenuInfo arg3) { //This methods arguments were not automatically provided } }); The odd thing is, if I remove my code, and have Eclipse automatically recreate the method, it uses the same argument names I already had, so I don't really know where the problem is, other then it auto-formatting the method for me. This becomes quite a pain having to manually recreate ALL my overridden methods by hand. If anyone can explain why this happens or how to fix it .. I would be very happy. Maybe it is due to the way I am formatting the methods, which are inside an argument of another method?

    Read the article

  • Server Error in '/' Application

    - by sweetsecret
    Server Error in '/' Application. Object must implement IConvertible. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.InvalidCastException: Object must implement IConvertible. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [InvalidCastException: Object must implement IConvertible.] System.Convert.ChangeType(Object value, TypeCode typeCode, IFormatProvider provider) +2514354 System.Web.UI.WebControls.Parameter.GetValue(Object value, String defaultValue, TypeCode type, Boolean convertEmptyStringToNull, Boolean ignoreNullableTypeChanges) +264 System.Web.UI.WebControls.Parameter.get_ParameterValue() +66 System.Web.UI.WebControls.ParameterCollection.GetValues(HttpContext context, Control control) +254 System.Web.UI.WebControls.SqlDataSourceView.InitializeParameters(DbCommand command, ParameterCollection parameters, IDictionary exclusionList) +276 System.Web.UI.WebControls.SqlDataSourceView.ExecuteSelect(DataSourceSelectArguments arguments) +754 System.Web.UI.DataSourceView.Select(DataSourceSelectArguments arguments, DataSourceViewSelectCallback callback) +17 System.Web.UI.WebControls.DataBoundControl.PerformSelect() +149 System.Web.UI.WebControls.BaseDataBoundControl.DataBind() +70 System.Web.UI.WebControls.GridView.DataBind() +4 System.Web.UI.WebControls.BaseDataBoundControl.EnsureDataBound() +82 System.Web.UI.WebControls.CompositeDataBoundControl.CreateChildControls() +69 System.Web.UI.Control.EnsureChildControls() +87 System.Web.UI.Control.PreRenderRecursiveInternal() +41 System.Web.UI.Control.PreRenderRecursiveInternal() +161 System.Web.UI.Control.PreRenderRecursiveInternal() +161 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1360

    Read the article

  • ASP.NET Content Web Form - content from placeholder disappears

    - by Naeem Sarfraz
    I'm attempting to set a class on the body tag in my asp.net site which uses a master page and content web forms. I simply want to be able to do this by adding a bodycssclass property (see below) to the content web form page directive. It works through the solution below but when i attempt to view Default.aspx the Content1 control loses its content. Any ideas why? Here is how I'm doing it. I have a master page with the following content: <%@ Master Language="C#" ... %> <html><head>...</head> <body id=ctlBody runat=server> <asp:ContentPlaceHolder ID="cphMain" runat="server" /> </body> </html> it's code behind looks like: public partial class Site : MasterPageBase { public override string BodyCssClass { get { return ctlBody.Attributes["class"]; } set { ctlBody.Attributes["class"] = value; } } } it inherits from: public abstract class MasterPageBase : MasterPage { public abstract string BodyCssClass { get; set; } } my default.aspx is defined as: <%@ Page Title="..." [master page definition etc..] bodycssclass="home" %> <asp:Content ID="Content1" ContentPlaceHolderID="cphMain" runat="server"> Some content </asp:Content> the code behind for this file looks like: public partial class Default : PageBase { ... } and it inherits from : public class PageBase : Page { public string BodyCssClass { get { MasterPageBase mpbCurrent = this.Master as MasterPageBase; return mpbCurrent.BodyCssClass; } set { MasterPageBase mpbCurrent = this.Master as MasterPageBase; mpbCurrent.BodyCssClass = value; } } }

    Read the article

  • Java RMI InitialContext: Equivalent of LocateRegistry.createRegistry(int) ?

    - by bguiz
    I am trying to some pretty basic RMI: // Context namingContext = new InitialContext(); Registry reg = LocateRegistry.createRegistry(9999); for ( int i = 0; i < objs.length; i++ ) { int id = objs[i].getID(); // namingContext.bind( "rmi:CustomObj" + id , objs[i] ); reg.bind( "CustomObj" + id , objs[i] ); } That works without a hitch, but for future purposes, I need to use InitialContext. Context namingContext = new InitialContext(); for ( int i = 0; i < objs.length; i++ ) { int id = objs[i].getID(); namingContext.bind( "rmi:CustomObj" + id , objs[i] ); } But I cannot get this to work. I have started rmiregistry from the command line. Is there an equivalent of LocateRegistry.createRegistry(int)? Or some other way to start the RMI registry / registry used by InitialContext from inside my class? (Instead of the command line) Stack trace: javax.naming.CommunicationException [Root exception is java.rmi.ServerException: RemoteException occurred in server thread; nested exception is: java.rmi.UnmarshalException: error unmarshalling arguments; nested exception is: java.lang.ClassNotFoundException: bguiz.scratch.network.eg.Student] at com.sun.jndi.rmi.registry.RegistryContext.bind(RegistryContext.java:126) at com.sun.jndi.toolkit.url.GenericURLContext.bind(GenericURLContext.java:208) at javax.naming.InitialContext.bind(InitialContext.java:400) at bguiz.scratch.RMITest.main(RMITest.java:29) Caused by: java.rmi.ServerException: RemoteException occurred in server thread; nested exception is: java.rmi.UnmarshalException: error unmarshalling arguments; nested exception is: java.lang.ClassNotFoundException: bguiz.scratch.CustomObj at sun.rmi.server.UnicastServerRef.oldDispatch(UnicastServerRef.java:396) at sun.rmi.server.UnicastServerRef.dispatch(UnicastServerRef.java:250) ....(truncated) EDIT: I will delete my own question in a couple of days, as there seems to be no answer to this (I haven't been able to figure it out myself). Last call for any biters!

    Read the article

  • Using Lambda Expressions trees with IEnumerable

    - by Loathian
    I've been trying to learn more about using Lamba expression trees and so I created a simple example. Here is the code, this works in LINQPad if pasted in as a C# program. void Main() { IEnumerable<User> list = GetUsers().Where(NameContains("a")); list.Dump("Users"); } // Methods public IEnumerable<User> GetUsers() { yield return new User{Name = "andrew"}; yield return new User{Name = "rob"}; yield return new User{Name = "chris"}; yield return new User{Name = "ryan"}; } public Expression<Func<User, bool>> NameContains(string namePart) { return u => u.Name.Contains(namePart); } // Classes public class User { public string Name { get; set; } } This results in the following error: The type arguments for method 'System.Linq.Enumerable.Where(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. However if I just substitute the first line in main with this: IEnumerable<User> list = GetUsers().Where(u => u.Name.Contains("a")); It works fine. Can tell me what I'm doing wrong, please?

    Read the article

  • SQL SERVER 2008 JOIN hints

    - by Nai
    Hi all, Recently, I was trying to optimise this query UPDATE Analytics SET UserID = x.UserID FROM Analytics z INNER JOIN UserDetail x ON x.UserGUID = z.UserGUID Estimated execution plan show 57% on the Table Update and 40% on a Hash Match (Aggregate). I did some snooping around and came across the topic of JOIN hints. So I added a LOOP hint to my inner join and WA-ZHAM! The new execution plan shows 38% on the Table Update and 58% on an Index Seek. So I was about to start applying LOOP hints to all my queries until prudence got the better of me. After some googling, I realised that JOIN hints are not very well covered in BOL. Therefore... Can someone please tell me why applying LOOP hints to all my queries is a bad idea. I read somewhere that a LOOP JOIN is default JOIN method for query optimiser but couldn't verify the validity of the statement? When are JOIN hints used? When the sh*t hits the fan and ghost busters ain't in town? What's the difference between LOOP, HASH and MERGE hints? BOL states that MERGE seems to be the slowest but what is the application of each hint? Thanks for your time and help people! I'm running SQL Server 2008 BTW. The statistics mentioned above are ESTIMATED execution plans.

    Read the article

  • Objective-C NSMutableDictionary Disappearing

    - by blackmage
    I am having this problem with the NSMutableDictionary where the values are not coming up. Snippets from my code look like this: //Data into the Hash and then into an array yellowPages = [[NSMutableArray alloc] init]; NSMutableDictionary *address1=[[NSMutableDictionary alloc] init]; [address1 setObject:@"213 Pheasant CT" forKey: @"Street"]; [address1 setObject:@"NC" forKey: @"State"]; [address1 setObject:@"Wilmington" forKey: @"City"]; [address1 setObject:@"28403" forKey: @"Zip"]; [address1 setObject:@"Residential" forKey: @"Type"]; [yellowPages addObject:address1]; NSMutableDictionary *address2=[[NSMutableDictionary alloc] init]; [address1 setObject:@"812 Pheasant CT" forKey: @"Street"]; [address1 setObject:@"NC" forKey: @"State"]; [address1 setObject:@"Wilmington" forKey: @"City"]; [address1 setObject:@"28403" forKey: @"Zip"]; [address1 setObject:@"Residential" forKey: @"Type"]; [yellowPages addObject:address2]; //Iterate through array pulling the hash and insert into Location Object for(int i=0; i<locationCount; i++){ NSMutableDictionary *anAddress=[theAddresses getYellowPageAddressByIndex:i]; //Set Data Members Location *addressLocation=[[Location alloc] init]; addressLocation.Street=[anAddress objectForKey:@"Street"]; locations[i]=addressLocation; NSLog(addressLocation.Street); } So the problem is only the second address is printed, the 813 and I can't figure out why. Can anyone offer any help?

    Read the article

  • c++ OpenCV CVCalibrateCamera2 is causing multiple errors

    - by tlayton
    I am making a simple calibration program in C++ using OpenCV. Everything goes fine until I actually try to call CVCalibrateCamera2. At this point, I get one of several errors: If the number of images which I am using is equal to 4 (which is the number of points being drawn from each image: OpenCV Error: Sizes of input arguments do not match (Both matrices must have the same number of points) in unknown function, file ......\src\cv\cvfundam.cpp, line 870 If the number of images is below 20: OpenCV Error: Bad argument (The total number of matrix elements is not divisible by the new number of rows) in unknown function, file ......\src\cxcore\cxarray.cpp, line 2749 Otherwise, if the number of image is 20 or above: OpenCV Error: Unsupported format or combination of formats (Invalid matrix type) in unknown function, file ......\src\cxcore\cxarray.cpp, line 117 I have checked the arguments for CVCalibrateCamera2 many times, and I am certain that they are of the correct dimensions relative to one another. It seems like somewhere the program is trying to reshape a matrix based on the number of images, but I can't figure out where or why. Any ideas? I am using Eclipse Galileo, MINGW 5.1.6, and OpenCV 2.1.

    Read the article

  • Boost Python : How to only expose the constructor of a class with virtual (pure & impure) methods

    - by fallino
    Hello, I'm a newbie with Boost::Python but I tried to search on the web to do so I want to expose a 3rd party library to Python. One of the class of the library (.hpp) is composed of a public constructor with arguments a protected constructor and functions various regular functions various pure virtual functions various non pure virtual functions First, I did not succeed in building it without having errors about this protected constructor. I finally commented it. A first question would be : Is there a way to exclude these protected functions since I don't want to expose them ? (I know it's possible and easy with Py++, but I started without using it) Then I tried to expose all of my functions, beginning with the pure virtual ones (commenting them all except one), which wasn't a success too So I finally decided not to expose these virtual functions (which in fact seems logical...), but, here again, I didn't manage building it with a simple constructor with arguments (without no_init). So my second question is : Is there a way to exclude these virtual functions since I don't want to expose them ? Sorry if it seems trivial but I didn't find anything explicit on the web and I need something rather explicit :). Thanks in advance

    Read the article

  • How to exclude R*.class files from a proguard build

    - by Jeremy Bell
    I am one step away from making the method described here: http://stackoverflow.com/questions/2761443/targeting-android-with-scala-2-8-trunk-builds work with a single project (vs one project for scala and one for android). I've come across a problem. Using this input file (arguments to) proguard: -injars bin;lib/scala-library.jar(!META-INF/MANIFEST.MF,!library.properties) -outjar lib/scandroid.jar -libraryjars lib/android.jar -dontwarn -dontoptimize -dontobfuscate -dontskipnonpubliclibraryclasses -dontskipnonpubliclibraryclassmembers -keepattributes Exceptions,InnerClasses,Signature,Deprecated, SourceFile,LineNumberTable,*Annotation*,EnclosingMethod -keep public class org.scala.jeb.** { public protected *; } -keep public class org.xml.sax.EntityResolver { public protected *; } Proguard successfully builds scandroid.jar, however it appears to have included the generated R classes that the android resource builder generates and compiles. In this case, they are located in bin/org/jeb/R*.class. This is not what I want. The android dalvik converter cannot build because it thinks there is a duplicate of the R class (it's in scandroid and also the R*.class files). How can I modify the above proguard arguments to exclude the R*.class files from the scandroid.jar so the dalvik converter is happy? Edit: I should note that I tried adding ;bin/org/jeb/R.class;etc... to the -libraryjars argument, and that only seemed to cause it to complain about duplicate classes, and in addition proguard decided to exclude my scala class files too.

    Read the article

  • Ajax.BeginForm driving me crazy

    - by Fabio Milheiro
    ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

    Read the article

  • How can I render a list of objects using DisplayFor but from the controller in ASP.NET MVC?

    - by Darragh
    Here's the scenaio, I have an Employee object and a Company object which has a list of employees. I have Company.aspx which inherits from ViewPage<Company>. In Company.aspx I call Html.DisplayFor(m => m.Employees). I have an Employee.ascx partial view which inherits from ViewUserControl<Employee in my DisplayTemplates folder. Everything works fine and Company.aspx renders the Employee.ascx partial for each employee. Now I have two additional methods on my controller called GetEmployees and GetEmployee(Id). In the GetEmployee(Id) action I want to return the markup to display this one employee, and in GetEmployees() I want to render the markup to display all the employees (these two action methods will be called via AJAX). In the GetEmployee action I call return PartialView("DisplayTemplates\Employee", employee) This works, although I'd prefer something like return PartialViewFor(employee) which would determine the view name by convention. Anwyay, my question is how should I implement the GetEmployees() action? I don't want to create any more views, because frankly, I don't see why I should have to. I've tried the following which fails miserably :) return Content(New HtmlHelper<IList<Of DebtDto>>(null, null).DisplayFor(m => debts)); However if I could create an instance of an HtmlHelper object in my controller, I suppose I could get it to work, but it feels wrong. Any ideas? Have i missed something obvious?

    Read the article

  • How do you Access an Authenticated Google App Engine Service with Ruby?

    - by viatropos
    I am trying to do this same thing here but with Ruby: Access Authenticated GAE Client with Python. Any ideas how to retrieve authenticated content from GAE with Ruby? I am using the Ruby GData Gem to access everything in Google Docs and such and it's making life very easy, but now I'd like to access things on GAE that require admin access, programmatically, and it doesn't support that. Here's what I'm getting (using DocList, not sure what to use yet): c = GData::Client::DocList.new c.clientlogin(username, password, nil, nil, nil, "HOSTED") c => #<GData::Client::DocList:0x201bad8 @clientlogin_service="writely", @version="2", @auth_handler=#<GData::Auth::ClientLogin:0x200803c @account_type="HOSTED", @token="long-hash", @auth_url="https://www.google.com/accounts/ClientLogin", @service="writely">, @source="AnonymousApp", @headers={"Authorization"=>"GoogleLogin auth=long-hash", "User-Agent"=>"GoogleDataRubyUtil-AnonymousApp", "GData-Version"=>"2", "Content-Type"=>"application/atom+xml"}, @authsub_scope="http://docs.google.com/feeds/", @http_service=GData::HTTP::DefaultService> url = "http://my-cdn.appspot.com/files/restricted-file.html" c.get(url) => #<GData::HTTP::Response:0x20004b8 @status_code=302, @body="", @headers={"connection"=>"close", "date"=>"Sun, 11 Apr 2010 00:30:20 GMT", "content-type"=>"text/html", "server"=>"Google Frontend", "content-length"=>"0", "location"=>"https://www.google.com/accounts/ServiceLogin service=ah&continue=http://my-cdn.appspot.com/_ah/login%3Fcontinue%3D http://my-cdn.appspot.com/files/restricted-file.html& ltmpl=gm&ahname=My+CDN&sig=a-signature"}> Any tips? That other SO question pointed to doing something with the redirect... Not sure how to handle that. Just looking for a point in the right direction from the ruby experts. Thanks.

    Read the article

  • How to copy the shipping address to billing address

    - by Jerry
    Hi all I like to know if I can copy the shipping address to billing address. I got most of the parts done but I am not sure how to copy select menu (states) value to billing address. I really appreciate any helps. My code $(document).ready(function(){ Jquery $('#same').click(function(){ if($('#same').attr('checked')){ $('#bfName').val($('#fName').val()); $('#blName').val($('#lName').val()); $('#baddress1').val($('#address1').val()); $('#baddress2').val($('#address2').val()); $('#bcity').val($('#city').val()); alert(($('#state option:selected').val())); //not sure what to do here $('#bzip').val($('#zip').val()); }; }); Html <td><select name="state"> //shipping states......only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> <td><select name="bstate"> //billing state................only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> Thanks a lot!

    Read the article

  • WPF binding fails with custom add and remove accessors for INotifyPropertyChanged.PropertyChanged

    - by emddudley
    I have a scenario which is causing strange behavior with WPF data binding and INotifyPropertyChanged. I want a private member of the data binding source to handle the INotifyPropertyChanged.PropertyChanged event. I get some exceptions which haven't helped me debug, even when I have "Enable .NET Framework source stepping" checked in Visual Studio's options: A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.InvalidOperationException' occurred in PresentationCore.dll Here's the source code: XAML <Window xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="TestApplication.MainWindow" DataContext="{Binding RelativeSource={RelativeSource Self}}" Height="100" Width="100"> <StackPanel> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="A" /> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="B" /> </StackPanel> </Window> Normal implementation works public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; public MainWindow() { InitializeComponent(); } } Desired implementation doesn't work public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged { add { lock (this.mHandler) { this.mHandler.PropertyChanged += value; } } remove { lock (this.mHandler) { this.mHandler.PropertyChanged -= value; } } } public bool CheckboxIsChecked { get { return this.mHandler.CheckboxIsChecked; } set { this.mHandler.CheckboxIsChecked = value; } } private HandlesPropertyChangeEvents mHandler = new HandlesPropertyChangeEvents(); public MainWindow() { InitializeComponent(); } public class HandlesPropertyChangeEvents : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; } }

    Read the article

  • Rails 3.2 Ajax Update Div when Text Field Populated

    - by ctilley79
    In the end I would like a text field that passes a client_id to the partial. I would like to do this asynchronously so the shipment_products partial would dynamically change when the textfield value was updated. What is the best way to do this? In index.html.erb <!-- Text Field Here--> <div id="available_products"> <%= render "shipment_products" %> </div> In _shipment_products.html.erb <div id="shipment_products_container"> <h3>Assign Products to Ship<\h3> <ul class="shipment_products" id="shipment_products"> <% Product.by_client(client_id).each do |product|%> <!-- TextField value passed here --> <%= content_tag_for :li, product, :value => product.id do %> <%= hidden_field_tag("shipment[product_ids][]", product.id) %> <%= product.product_name %> <% end %> <% end %> <\ul> </div> This is similar to what I want in the end.

    Read the article

  • Problem with MessageContract, Generic return types and clientside naming

    - by Soeteman
    I'm building a web service which uses MessageContracts, because I want to add custom fields to my SOAP header. In a previous topic, I learned that a composite response has to be wrapped. For this purpose, I devised a generic ResponseWrapper class. [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName="WrapperOf{0}")] public class ResponseWrapper<T> { [MessageBodyMember(Namespace = "http://mynamespace.com")] public T Response { get; set; } } I made a ServiceResult base class, defined as follows: [MessageContract(WrapperNamespace = "http://mynamespace.com")] public class ServiceResult { [MessageBodyMember] public bool Status { get; set; } [MessageBodyMember] public string Message { get; set; } [MessageBodyMember] public string Description { get; set; } } To be able to include the request context in the response, I use a derived class of ServiceResult, which uses generics: [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName = "ServiceResultOf{0}")] public class ServiceResult<TRequest> : ServiceResult { [MessageBodyMember] public TRequest Request { get; set; } } This is used in the following way [OperationContract()] ResponseWrapper<ServiceResult<HCCertificateRequest>> OrderHealthCertificate(RequestContext<HCCertificateRequest> context); I expected my client code to be generated as ServiceResultOfHCCertificateRequest OrderHealthCertificate(RequestContextOfHCCertificateRequest context); Instead, I get the following: ServiceResultOfHCCertificateRequestzSOTD_SSj OrderHealthCertificate(CompType1 c1, CompType2 c2, HCCertificateRequest context); CompType1 and CompType2 are properties of the RequestContext class. The problem is that a hash is added to the end of ServiceResultOfHCCertificateRequestzSOTD_SSj. How do I need define my generic return types in order for the client type to be generated as expected (without the hash)?

    Read the article

  • How to avoid using this in a contructor

    - by Paralife
    I have this situation: interface MessageListener { void onMessageReceipt(Message message); } class MessageReceiver { MessageListener listener; public MessageReceiver(MessageListener listener, other arguments...) { this.listener = listener; } loop() { Message message = nextMessage(); listener.onMessageReceipt(message); } } and I want to avoid the following pattern: (Using the this in the Client constructor) class Client implements MessageListener { MessageReceiver receiver; MessageSender sender; public Client(...) { receiver = new MessageReceiver(this, other arguments...); sender = new Sender(...); } . . . @Override public void onMessageReceipt(Message message) { if(Message.isGood()) sender.send("Congrtulations"); else sender.send("Boooooooo"); } } The reason why i need the above functionality is because i want to call the sender inside the onMessageReceipt() function, for example to send a reply. But I dont want to pass the sender into a listener, so the only way I can think of is containing the sender in a class that implements the listener, hence the above resulting Client implementation. Is there a way to achive this without the use of 'this' in the constructor? It feels bizare and i dont like it, since i am passing myself to an object(MessageReceiver) before I am fully constructed. On the other hand, the MessageReceiver is not passed from outside, it is constructed inside, but does this 'purifies' the bizarre pattern? I am seeking for an alternative or an assurance of some kind that this is safe, or situations on which it might backfire on me.

    Read the article

  • forkpty - socket

    - by Alexxx
    Hi, I'm trying to develop a simple "telnet/server" daemon which have to run a program on a new socket connection. This part working fine. But I have to associate my new process to a pty, because this process have some terminal capabilities (like a readline). The code I've developped is (where socketfd is the new socket file descriptor for the new input connection) : int masterfd, pid; const char *prgName = "..."; char *arguments[10] = ....; if ((pid = forkpty(&masterfd, NULL, NULL, NULL)) < 0) perror("FORK"); else if (pid) return pid; else { close(STDOUT_FILENO); dup2(socketfd, STDOUT_FILENO); close(STDIN_FILENO); dup2(socketfd, STDIN_FILENO); close(STDERR_FILENO); dup2(socketfd, STDERR_FILENO); if (execvp(prgName, arguments) < 0) { perror("execvp"); exit(2); } } With that code, the stdin / stdout / stderr file descriptor of my "prgName" are associated to the socket (when looking with ls -la /proc/PID/fd), and so, the terminal capabilities of this process doesn't work. A test with a connection via ssh/sshd on the remote device, and executing "localy" (under the ssh connection) prgName, show that the stdin/stdout/stderr fd of this process "prgName" are associated to a pty (and so the terminal capabilities of this process are working fine). What I am doing wrong? How to associate my socketfd with the pty (created by forkpty) ? Thank Alex

    Read the article

  • How to detect hidden field tampering?

    - by Myron
    On a form of my web app, I've got a hidden field that I need to protect from tampering for security reasons. I'm trying to come up with a solution whereby I can detect if the value of the hidden field has been changed, and react appropriately (i.e. with a generic "Something went wrong, please try again" error message). The solution should be secure enough that brute force attacks are infeasible. I've got a basic solution that I think will work, but I'm not security expert and I may be totally missing something here. My idea is to render two hidden inputs: one named "important_value", containing the value I need to protect, and one named "important_value_hash" containing the SHA hash of the important value concatenated with a constant long random string (i.e. the same string will be used every time). When the form is submitted, the server will re-compute the SHA hash, and compare against the submitted value of important_value_hash. If they are not the same, the important_value has been tampered with. I could also concatenate additional values with the SHA's input string (maybe the user's IP address?), but I don't know if that really gains me anything. Will this be secure? Anyone have any insight into how it might be broken, and what could/should be done to improve it? Thanks!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to Verify Signature, Loading PUBLIC KEY From PEM file?

    - by bbirtle
    I'm posting this in the hope it saves somebody else the hours I lost on this really stupid problem involving converting formats of public keys. If anybody sees a simpler solution or a problem, please let me know! The eCommerce system I'm using sends me some data along with a signature. They also give me their public key in .pem format. The .pem file looks like this: -----BEGIN PUBLIC KEY----- MIGfMA0GCSqGSIb3DQEBAQUAA4GNADCBiQKBgQDe+hkicNP7ROHUssGNtHwiT2Ew HFrSk/qwrcq8v5metRtTTFPE/nmzSkRnTs3GMpi57rBdxBBJW5W9cpNyGUh0jNXc VrOSClpD5Ri2hER/GcNrxVRP7RlWOqB1C03q4QYmwjHZ+zlM4OUhCCAtSWflB4wC Ka1g88CjFwRw/PB9kwIDAQAB -----END PUBLIC KEY----- Here's the magic code to turn the above into an "RSACryptoServiceProvider" which is capable of verifying the signature. Uses the BouncyCastle library, since .NET apparently (and appallingly cannot do it without some major headaches involving certificate files): RSACryptoServiceProvider thingee; using (var reader = File.OpenText(@"c:\pemfile.pem")) { var x = new PemReader(reader); var y = (RsaKeyParameters)x.ReadObject(); thingee = (RSACryptoServiceProvider)RSACryptoServiceProvider.Create(); var pa = new RSAParameters(); pa.Modulus = y.Modulus.ToByteArray(); pa.Exponent = y.Exponent.ToByteArray(); thingee.ImportParameters(pa); } And then the code to actually verify the signature: var signature = ... //reads from the packet sent by the eCommerce system var data = ... //reads from the packet sent by the eCommerce system var sha = new SHA1CryptoServiceProvider(); byte[] hash = sha.ComputeHash(Encoding.ASCII.GetBytes(data)); byte[] bSignature = Convert.FromBase64String(signature); ///Verify signature, FINALLY: var hasValidSig = thingee.VerifyHash(hash, CryptoConfig.MapNameToOID("SHA1"), bSignature);

    Read the article

  • Problem with custom Equality and GetHashCode in a mutable object

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. The problem is that when I hit save, the ID changes from 0 to its db value. So the question is how can I have an equatable object, being properly hashed. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

< Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >