Search Results

Search found 9484 results on 380 pages for 'np complete'.

Page 128/380 | < Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • FlexUnit 4 Error

    - by OXMO456
    Hi, I am facing a strange FlexUnit Error: Whoa... been asked to send another complete and I already did that The error seem to occur when the number of test exceede 27...? test exemple: [Test] public function whenDoingThat_expectThatIsTrue():void{ //blabla assertTrue(...) } Any help welcome !

    Read the article

  • Twitter API - oauth gem - not getting callback

    - by haries
    I redirect the user of my application to Twitter for oauth style authentication using my app's request_token. The user is able to enter username and password on Twitter's page BUT then, instead of calling back my application, Twitter displays a page You've successfully granted access to MyAppName! Simply return to MyAppName and enter the following PIN to complete the process. 123456 Why is this happening? I have set the callback url in my app's settings. Thanks

    Read the article

  • Could not load file or assembly for c1webreport1 tool in compnentone studio

    - by Omprakash
    I'm using Licensed componentone product in my ASP.NET application and spcefically i use C1WebReport1 control from the product.while upgrading C1WebReport1 control from version 2.5.20072.239 to 2.6.20093.53207,i get the error message as "Could not load file or assembly 'C1.Web.C1WebReport.2, Version=2.6.20093.53207, Culture=neutral, PublicKeyToken=594a0605db190bb9' or one of its dependencies. The located assembly's manifest definition does not match the assembly reference. (Exception from HRESULT: 0x80131040)" can any one help me to bring complete solution? Thanks in advance. Regards Omprakash

    Read the article

  • how to detect whether strings are not captured for localization in .po files i.e no equivalent entry

    - by Manjushree
    Hi we have some queries regarding localization/.po files 1 We want to detect the missing strings or strings which are not being captured for L10N. how we can detect that? is that any method or command to update the strings 2 Locale files (.po) for "cn-zh" or another Locale are not complete (missing strings) 3 String has been captured for L10N but does not have a matching pair in .po files

    Read the article

  • Autocomplete functionality on a textarea

    - by sslepian
    Is there a way to implement auto-complete functionality in a region defined by textarea tags or something similar? I'm currently using a jquery autocomplete plugin to suggest input to the user inside input tags, but the issue is that the autocomplete phrases can often be fairly long and thus scroll off the edge of the input field.

    Read the article

  • How to poll the popular websites in PHP?

    - by Runner
    It's springed from this answer: http://superuser.com/questions/129741/how-does-search-engines-update-indexing-so-soon/129743#129743 BTW,for the servers that's polled,is it the same whether the request is just for polling(header information) or complete web page?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • LaTeX lstlisting underlined

    - by Gernot
    Hi, Is there an easy way to have the complete code in a lstlisting environment underlined? My current solution looks like this, but I'm not really happy with it. \begin{lstlisting}[mathescape] $\ul{if(gt(x1, 0)) then} $ ... \end{lstlisting} Thx for any tips.

    Read the article

  • download file exception handling

    - by klaus-vlad
    Hi, In my application I download several critical files from a server, and I want to write some code that handles the case where the a file download didn't complete for a reason or other ,to retry downloading it at next startup. The function that downloads a file at a time however throws only MalformedURLException and IOException , but if these exceptions are thrown that means that the download didn't even begin. How should I arrange things so I can treat the case where a download failed , even if it began ? download(String file) throws MalformedURLException ,IOException { }

    Read the article

  • How to pass arguments to Go program?

    - by oraz
    I can't see arguments for main() in package main. How to pass arguments from command line in Go? A complete program, possibly created by linking multiple packages, must have one package called main, with a function func main() { ... } defined. The function main.main() takes no arguments and returns no value.

    Read the article

  • jQuery scroll fails for iframe (firefox)

    - by knappy
    I cannot get scroll to work, here is the complete stuff: http://zed.mit.edu/scroll2/buc.php I'm trying to refresh the page while maintaining the scroll position of the iframe inside. I'd like to have an alert when I actively scroll the iframe, these two both fail: $(top).frames['#iframe_bucinid'].scroll(function() .... $('#iframe_bucinid').scroll(function() ... The page's iframe is defined as: <iframe class="inframe" src="bucin.php" name="bucin" id="iframe_bucinid"> Notice that getting the scrollTop works with top.frames['bucin'].document.body.scrollTop

    Read the article

  • List of Character Encodings

    - by helpme
    Is There A Book or Site That Teaches And Also Includes A Complete List of Character Encoding's That Includes Hexadecimal, Decimal and Name Versions? If you can name a couple of books and sites, that would be very helpful thank you.

    Read the article

  • android threads

    - by rantravee
    Hi, I'm searching for some good material on android threads but I couldn't find references for a complete description about this subject. So if you know any valuable reference please point them to me.

    Read the article

  • What is an efficient way to find a non-colliding rectangle nearest to a location

    - by hyn
    For a 2D game I am working on, I am using y axis sorting in a simple rectangle-based collision detection. This is working fine, and now I want to find the nearest empty rectangle at a given location with a given size, efficiently. How can I do this? Is there an algorithm? I could think of a simple brute force grid test (with each grid the size of the empty space we're looking for) but obviously this is slow and not even a complete test.

    Read the article

  • Include a version control tag in VSS

    - by Sjuul Janssen
    I was reading Code Complete 2 and it mentions this: Many version-control tools wil insert version information into a file. In CVS, for exmple the characters // $id$ Will Automaticly expand to // $id: ClassName.java, v 1.1 2004/02/05 00:36:42 ismene Exp $ So now I would like to do something similar with VSS for our SQL scripts I have been googling around for the answer but can't find it. Is this possible? can someone maybe point me in the right direction?

    Read the article

  • What is mod_php...?

    - by SpikETidE
    Hi everybody... First of all, Pardon this complete n00b question... While going through the zend tutorial here i came across the following statement... Note that the php_flag settings in .htaccess only work if you are using mod_php. Can someone explain what that means...??? Thanks and Regards....

    Read the article

  • Bipartite matching in Python

    - by vailen
    Does anybody know any module in Python that computes the best bipartite matching? I have tried the following two: munkres hungarian However, in my case, I have to deal with non-complete graph (i.e., there might not be an edge between two nodes), and therefore, there might not be a match if the node has no edge. The above two packages seem not to be able to deal with this. Any advice?

    Read the article

  • RichTextBox specific colors per few charicters / lines C#

    - by Xavier
    i have say, richTextBox1, and here is the contents: line one from my textbox is this, and i want this to be normal, arial, 8 point non-bold font line two, i want everything after the | to be bolded... | this is bold line three: everything in brackets i (want) to be the color (Red) line 4 is "this line is going to be /slanted/ or with italics and so on, basically if i know how to do what i mentioned above, ill know everything i need to know to complete my project. code examples would be very very much appricaited! :)

    Read the article

< Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >