Search Results

Search found 622 results on 25 pages for 'repeating'.

Page 13/25 | < Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >

  • Web map services displaying poorly

    - by user29261
    Web map services no longer display correctly in ArcGIS and Google Earth - no one else on network is experiencing these. Using windows 7 OS. These problem began abruptly (1 day they were working, the next they were not). Specific problems include not displaying at all; correct display on 10% of the monitor and repeating lines of coloured squiggles and text on the remaining 90%; and small, widely spaced, pixels in place of colour fill. Links where this occurs: arcgis http://wms.ess-ws.nrcan.gc.ca/wms/toporama_en Google earth http://openmaps.gov.bc.ca/kml/BCGov_Web_Map_Library.kml I can't pinpoint any changes to the computer setup which may have prompted this, however, adding arcgis 10.1 SP 1 occured around the same time. Probably just a coincidence. Anyone had similar problems? or solutions to these? Thanks for any thoughts. Jim

    Read the article

  • How you choose your first job as a programmer? [on hold]

    - by sliter
    For Brief I am a recently graduated CS student. I am looking for a job these days, but I have no idea what kind of software development jobs I like(embedded system,web development or else...). And I am looking for your advice. Here is a little more While I was a student, I had an one year internship experience as a system engineer in a semi-conductor company where I wrote Linux driver, tuned system performance, etc.. I was happy about this experience as it allowed me to deepen my understanding of the operating system and different low level things. And I thought "Em, I will continue in the embedded area after I graduate". At the end of my study, I am doing an another internship in web development, both front-end and back-end. And I also enjoys a lot the process of learning new things and making it work (Backbone, Node, socketio, etc..). Now, when I am looking for a software development position, I do not know what to apply! All I know is that I want a job which allows me to keep up with the trends instead of repeating. But besides this, I've no idea what specific type of job I want to do. Turn back to embedded system? Continue with web development? Change to other promising areas(data mining)? All these development positions makes no big difference to me. But I think this is not good and I need some criteria at choosing. So I am looking for advice and I would really appreciate if you can share your experience.

    Read the article

  • Launching multiple applications with a single command/script/shortcut

    - by Bill
    I realized a few days ago that every time I sit down at work, I do a few things after unlocking my computer. First, I open up Firefox, then I open up Chrome, then I log in to Digsby. I realized I could probably save repeating this daily by writing a small batch script to open up Firefox and Chrome , but I couldn't figure out how to make it work.. and since the whole effort is to save time I don't want to bash my head around in the windows command prompt to do it. I also tired this in powershell but ran in to a bunch of security nonsense. Is there a way to do this that I am missing? Bonus points if somebody has figured out how to manipulate Digsby via COM , scripting, or python =)

    Read the article

  • I have a very long and repetitive python path, where do I look to correct this?

    - by ninja123
    I know it is probably not necessary to paste the whole path, but just for the record I have done so below. Whenever I run a python command, it takes a long time to load this path I suppose. I have checked in .bash_profile and only have these two lines: export PATH=/Users/username/bin:/opt/local/Library/Frameworks/Python.framework/Versions/2.5/bin:/opt/local/bin:/opt/local/sbin:/opt/local/apache2/bin:$PATH export PYTHONPATH=/opt/local/lib/python2.5/site-packages/ And my python path as outputed by Django's debug is: Python path : ['/Users/username/Sites/videocluster/eggs/ipython-0.10-py2.5.egg', '/Users/username/Sites/videocluster/eggs/South-0.6.1-py2.5.egg', '/Users/username/Sites/videocluster/eggs/django_markitup-0.5.2-py2.5.egg', '/Users/username/Sites/videocluster/eggs/DateTime-2.12.0-py2.5.egg', '/Users/username/Sites/videocluster/eggs/Markdown-2.0.3-py2.5.egg', '/Users/username/Sites/videocluster/eggs/PIL-1.1.7-py2.5-macosx-10.5-i386.egg', '/Users/username/Sites/videocluster/eggs/djangorecipe-0.20-py2.5.egg', '/Users/username/Sites/videocluster/eggs/zc.recipe.egg-1.2.3b2-py2.5.egg', '/Users/username/Sites/videocluster/eggs/zc.buildout-1.5.0b2-py2.5.egg', '/Users/username/Sites/videocluster/eggs/pytz-2010h-py2.5.egg', '/Users/username/Sites/videocluster/eggs/zope.interface-3.6.1-py2.5-macosx-10.5-i386.egg', '/Users/username/Sites/videocluster/eggs/setuptools-0.6c11-py2.5.egg', '/Users/username/Sites/videocluster/parts/django', '/Users/username/Sites/videocluster', '/Users/username/Sites/videocluster/bin', '/opt/local/lib/python2.5/site-packages/setuptools_git-0.3.3-py2.5.egg', '/opt/local/lib/python2.5/site-packages/pysqlite-2.5.5-py2.5-macosx-10.5-i386.egg', '/opt/local/lib/python2.5/site-packages/CouchDB-0.5-py2.5.egg', '/opt/local/lib/python2.5/site-packages/httplib2-0.4.0-py2.5.egg', '/opt/local/lib/python2.5/site-packages/PyYAML-3.08-py2.5-macosx-10.5-i386.egg', '/opt/local/lib/python2.5/site-packages/simple_db_migrate-1.2.8-py2.5.egg', '/opt/local/lib/python2.5/site-packages/PyDispatcher-2.0.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/pyOpenSSL-0.9-py2.5-macosx-10.5-i386.egg', '/opt/local/lib/python2.5/site-packages/greenlet-0.2-py2.5-macosx-10.5-i386.egg', '/opt/local/lib/python2.5/site-packages/Supay-0.0.2-py2.5.egg', '/opt/local/lib/python2.5/site-packages/configobj-4.6.0-py2.5.egg', '/opt/local/lib/python2.5/site-packages/Fabric-0.9b1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/fudge-0.9.3-py2.5.egg', '/opt/local/lib/python2.5/site-packages/pydelicious-0.5.3-py2.5.egg', '/opt/local/lib/python2.5/site-packages/feedparser-4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/github_cli-0.2.5.2-py2.5.egg', '/opt/local/lib/python2.5/site-packages/simplejson-2.0.9-py2.5-macosx-10.5-i386.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', ......(repeating)....... '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/harobed.paster_template.advanced_package-0.2-py2.5.egg', '/opt/local/lib/python2.5/site-packages/squash-0.5.0dev-py2.5.egg', '/opt/local/lib/python2.5/site-packages/eventlet-0.8.13-py2.5.egg', '/opt/local/lib/python2.5/site-packages/FeinCMS-1.0.2-py2.5.egg', '/opt/local/lib/python2.5/site-packages/pyenchant-1.5.3-py2.5.egg', '/opt/local/lib/python2.5/site-packages/guppy-0.1.9-py2.5-macosx-10.5-i386.egg', '/opt/local/lib/python2.5/site-packages/django_scraper-0.1dev-py2.5.egg', '/opt/local/lib/python2.5/site-packages/Pympler-0.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/fabric.contrib.packagemanager-0.1dev-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/selenium-1.0.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/Scrapy-0.9_dev-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', ......(repeating)....... '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/site-packages/zc.buildout-1.4.1-py2.5.egg', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/site-packages/setuptools-0.6c11-py2.5.egg', '/opt/local/lib/python2.5/site-packages', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python25.zip', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/plat-darwin', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/plat-mac', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/plat-mac/lib-scriptpackages', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/lib-tk', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/lib-dynload', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/site-packages/Numeric', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/site-packages/PIL', '/opt/local/lib/python2.5/site-packages/PIL', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', ......(repeating)....... '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/lib/python2.5/site-packages/gtk-2.0', '/opt/local/Library/Frameworks/Python.framework/Versions/2.5/lib/python2.5/site-packages/gtk-2.0'] Someone, please tell me where I can go to correct this. Thanks

    Read the article

  • OpenVPN not connecting

    - by LandArch
    There have been a number of post similar to this, but none seem to satisfy my need. Plus I am a Ubuntu newbie. I followed this tutorial to completely set up OpenVPN on Ubuntu 12.04 server. Here is my server.conf file ################################################# # Sample OpenVPN 2.0 config file for # # multi-client server. # # # # This file is for the server side # # of a many-clients <-> one-server # # OpenVPN configuration. # # # # OpenVPN also supports # # single-machine <-> single-machine # # configurations (See the Examples page # # on the web site for more info). # # # # This config should work on Windows # # or Linux/BSD systems. Remember on # # Windows to quote pathnames and use # # double backslashes, e.g.: # # "C:\\Program Files\\OpenVPN\\config\\foo.key" # # # # Comments are preceded with '#' or ';' # ################################################# # Which local IP address should OpenVPN # listen on? (optional) local 192.168.13.8 # Which TCP/UDP port should OpenVPN listen on? # If you want to run multiple OpenVPN instances # on the same machine, use a different port # number for each one. You will need to # open up this port on your firewall. port 1194 # TCP or UDP server? proto tcp ;proto udp # "dev tun" will create a routed IP tunnel, # "dev tap" will create an ethernet tunnel. # Use "dev tap0" if you are ethernet bridging # and have precreated a tap0 virtual interface # and bridged it with your ethernet interface. # If you want to control access policies # over the VPN, you must create firewall # rules for the the TUN/TAP interface. # On non-Windows systems, you can give # an explicit unit number, such as tun0. # On Windows, use "dev-node" for this. # On most systems, the VPN will not function # unless you partially or fully disable # the firewall for the TUN/TAP interface. dev tap0 up "/etc/openvpn/up.sh br0" down "/etc/openvpn/down.sh br0" ;dev tun # Windows needs the TAP-Win32 adapter name # from the Network Connections panel if you # have more than one. On XP SP2 or higher, # you may need to selectively disable the # Windows firewall for the TAP adapter. # Non-Windows systems usually don't need this. ;dev-node MyTap # SSL/TLS root certificate (ca), certificate # (cert), and private key (key). Each client # and the server must have their own cert and # key file. The server and all clients will # use the same ca file. # # See the "easy-rsa" directory for a series # of scripts for generating RSA certificates # and private keys. Remember to use # a unique Common Name for the server # and each of the client certificates. # # Any X509 key management system can be used. # OpenVPN can also use a PKCS #12 formatted key file # (see "pkcs12" directive in man page). ca "/etc/openvpn/ca.crt" cert "/etc/openvpn/server.crt" key "/etc/openvpn/server.key" # This file should be kept secret # Diffie hellman parameters. # Generate your own with: # openssl dhparam -out dh1024.pem 1024 # Substitute 2048 for 1024 if you are using # 2048 bit keys. dh dh1024.pem # Configure server mode and supply a VPN subnet # for OpenVPN to draw client addresses from. # The server will take 10.8.0.1 for itself, # the rest will be made available to clients. # Each client will be able to reach the server # on 10.8.0.1. Comment this line out if you are # ethernet bridging. See the man page for more info. ;server 10.8.0.0 255.255.255.0 # Maintain a record of client <-> virtual IP address # associations in this file. If OpenVPN goes down or # is restarted, reconnecting clients can be assigned # the same virtual IP address from the pool that was # previously assigned. ifconfig-pool-persist ipp.txt # Configure server mode for ethernet bridging. # You must first use your OS's bridging capability # to bridge the TAP interface with the ethernet # NIC interface. Then you must manually set the # IP/netmask on the bridge interface, here we # assume 10.8.0.4/255.255.255.0. Finally we # must set aside an IP range in this subnet # (start=10.8.0.50 end=10.8.0.100) to allocate # to connecting clients. Leave this line commented # out unless you are ethernet bridging. server-bridge 192.168.13.101 255.255.255.0 192.168.13.105 192.168.13.200 # Configure server mode for ethernet bridging # using a DHCP-proxy, where clients talk # to the OpenVPN server-side DHCP server # to receive their IP address allocation # and DNS server addresses. You must first use # your OS's bridging capability to bridge the TAP # interface with the ethernet NIC interface. # Note: this mode only works on clients (such as # Windows), where the client-side TAP adapter is # bound to a DHCP client. ;server-bridge # Push routes to the client to allow it # to reach other private subnets behind # the server. Remember that these # private subnets will also need # to know to route the OpenVPN client # address pool (10.8.0.0/255.255.255.0) # back to the OpenVPN server. push "route 192.168.13.1 255.255.255.0" push "dhcp-option DNS 192.168.13.201" push "dhcp-option DOMAIN blahblah.dyndns-wiki.com" ;push "route 192.168.20.0 255.255.255.0" # To assign specific IP addresses to specific # clients or if a connecting client has a private # subnet behind it that should also have VPN access, # use the subdirectory "ccd" for client-specific # configuration files (see man page for more info). # EXAMPLE: Suppose the client # having the certificate common name "Thelonious" # also has a small subnet behind his connecting # machine, such as 192.168.40.128/255.255.255.248. # First, uncomment out these lines: ;client-config-dir ccd ;route 192.168.40.128 255.255.255.248 # Then create a file ccd/Thelonious with this line: # iroute 192.168.40.128 255.255.255.248 # This will allow Thelonious' private subnet to # access the VPN. This example will only work # if you are routing, not bridging, i.e. you are # using "dev tun" and "server" directives. # EXAMPLE: Suppose you want to give # Thelonious a fixed VPN IP address of 10.9.0.1. # First uncomment out these lines: ;client-config-dir ccd ;route 10.9.0.0 255.255.255.252 # Then add this line to ccd/Thelonious: # ifconfig-push 10.9.0.1 10.9.0.2 # Suppose that you want to enable different # firewall access policies for different groups # of clients. There are two methods: # (1) Run multiple OpenVPN daemons, one for each # group, and firewall the TUN/TAP interface # for each group/daemon appropriately. # (2) (Advanced) Create a script to dynamically # modify the firewall in response to access # from different clients. See man # page for more info on learn-address script. ;learn-address ./script # If enabled, this directive will configure # all clients to redirect their default # network gateway through the VPN, causing # all IP traffic such as web browsing and # and DNS lookups to go through the VPN # (The OpenVPN server machine may need to NAT # or bridge the TUN/TAP interface to the internet # in order for this to work properly). ;push "redirect-gateway def1 bypass-dhcp" # Certain Windows-specific network settings # can be pushed to clients, such as DNS # or WINS server addresses. CAVEAT: # http://openvpn.net/faq.html#dhcpcaveats # The addresses below refer to the public # DNS servers provided by opendns.com. ;push "dhcp-option DNS 208.67.222.222" ;push "dhcp-option DNS 208.67.220.220" # Uncomment this directive to allow different # clients to be able to "see" each other. # By default, clients will only see the server. # To force clients to only see the server, you # will also need to appropriately firewall the # server's TUN/TAP interface. ;client-to-client # Uncomment this directive if multiple clients # might connect with the same certificate/key # files or common names. This is recommended # only for testing purposes. For production use, # each client should have its own certificate/key # pair. # # IF YOU HAVE NOT GENERATED INDIVIDUAL # CERTIFICATE/KEY PAIRS FOR EACH CLIENT, # EACH HAVING ITS OWN UNIQUE "COMMON NAME", # UNCOMMENT THIS LINE OUT. ;duplicate-cn # The keepalive directive causes ping-like # messages to be sent back and forth over # the link so that each side knows when # the other side has gone down. # Ping every 10 seconds, assume that remote # peer is down if no ping received during # a 120 second time period. keepalive 10 120 # For extra security beyond that provided # by SSL/TLS, create an "HMAC firewall" # to help block DoS attacks and UDP port flooding. # # Generate with: # openvpn --genkey --secret ta.key # # The server and each client must have # a copy of this key. # The second parameter should be '0' # on the server and '1' on the clients. ;tls-auth ta.key 0 # This file is secret # Select a cryptographic cipher. # This config item must be copied to # the client config file as well. ;cipher BF-CBC # Blowfish (default) ;cipher AES-128-CBC # AES ;cipher DES-EDE3-CBC # Triple-DES # Enable compression on the VPN link. # If you enable it here, you must also # enable it in the client config file. comp-lzo # The maximum number of concurrently connected # clients we want to allow. ;max-clients 100 # It's a good idea to reduce the OpenVPN # daemon's privileges after initialization. # # You can uncomment this out on # non-Windows systems. user nobody group nogroup # The persist options will try to avoid # accessing certain resources on restart # that may no longer be accessible because # of the privilege downgrade. persist-key persist-tun # Output a short status file showing # current connections, truncated # and rewritten every minute. status openvpn-status.log # By default, log messages will go to the syslog (or # on Windows, if running as a service, they will go to # the "\Program Files\OpenVPN\log" directory). # Use log or log-append to override this default. # "log" will truncate the log file on OpenVPN startup, # while "log-append" will append to it. Use one # or the other (but not both). ;log openvpn.log ;log-append openvpn.log # Set the appropriate level of log # file verbosity. # # 0 is silent, except for fatal errors # 4 is reasonable for general usage # 5 and 6 can help to debug connection problems # 9 is extremely verbose verb 3 # Silence repeating messages. At most 20 # sequential messages of the same message # category will be output to the log. ;mute 20 I am using Windows 7 as the Client and set that up accordingly using the OpenVPN GUI. That conf file is as follows: ############################################## # Sample client-side OpenVPN 2.0 config file # # for connecting to multi-client server. # # # # This configuration can be used by multiple # # clients, however each client should have # # its own cert and key files. # # # # On Windows, you might want to rename this # # file so it has a .ovpn extension # ############################################## # Specify that we are a client and that we # will be pulling certain config file directives # from the server. client # Use the same setting as you are using on # the server. # On most systems, the VPN will not function # unless you partially or fully disable # the firewall for the TUN/TAP interface. dev tap0 up "/etc/openvpn/up.sh br0" down "/etc/openvpn/down.sh br0" ;dev tun # Windows needs the TAP-Win32 adapter name # from the Network Connections panel # if you have more than one. On XP SP2, # you may need to disable the firewall # for the TAP adapter. ;dev-node MyTap # Are we connecting to a TCP or # UDP server? Use the same setting as # on the server. proto tcp ;proto udp # The hostname/IP and port of the server. # You can have multiple remote entries # to load balance between the servers. blahblah.dyndns-wiki.com 1194 ;remote my-server-2 1194 # Choose a random host from the remote # list for load-balancing. Otherwise # try hosts in the order specified. ;remote-random # Keep trying indefinitely to resolve the # host name of the OpenVPN server. Very useful # on machines which are not permanently connected # to the internet such as laptops. resolv-retry infinite # Most clients don't need to bind to # a specific local port number. nobind # Downgrade privileges after initialization (non-Windows only) user nobody group nobody # Try to preserve some state across restarts. persist-key persist-tun # If you are connecting through an # HTTP proxy to reach the actual OpenVPN # server, put the proxy server/IP and # port number here. See the man page # if your proxy server requires # authentication. ;http-proxy-retry # retry on connection failures ;http-proxy [proxy server] [proxy port #] # Wireless networks often produce a lot # of duplicate packets. Set this flag # to silence duplicate packet warnings. ;mute-replay-warnings # SSL/TLS parms. # See the server config file for more # description. It's best to use # a separate .crt/.key file pair # for each client. A single ca # file can be used for all clients. ca "C:\\Program Files\OpenVPN\config\\ca.crt" cert "C:\\Program Files\OpenVPN\config\\ChadMWade-THINK.crt" key "C:\\Program Files\OpenVPN\config\\ChadMWade-THINK.key" # Verify server certificate by checking # that the certicate has the nsCertType # field set to "server". This is an # important precaution to protect against # a potential attack discussed here: # http://openvpn.net/howto.html#mitm # # To use this feature, you will need to generate # your server certificates with the nsCertType # field set to "server". The build-key-server # script in the easy-rsa folder will do this. ns-cert-type server # If a tls-auth key is used on the server # then every client must also have the key. ;tls-auth ta.key 1 # Select a cryptographic cipher. # If the cipher option is used on the server # then you must also specify it here. ;cipher x # Enable compression on the VPN link. # Don't enable this unless it is also # enabled in the server config file. comp-lzo # Set log file verbosity. verb 3 # Silence repeating messages ;mute 20 Not sure whats left to do.

    Read the article

  • iPhone SDK: Transparent tableviewcell isn't transparent?

    - by Harkonian
    I have a UITableViewController that has a background image. I am setting the image for the tableview like this: [self.view setBackgroundColor: [UIColor colorWithPatternImage: [UIImage imageWithContentsOfFile: [[[NSBundle mainBundle] resourcePath] stringByAppendingPathComponent: @"background1.jpg"]]]]; The problem is, each of my custom tableview cells get the same background image--it's repeated in each cell. As a test, I tried making everything in my cell transparent with an alpha of 0.0, but even then although I can't see any of the labels in each cell, I still see the background image repeated in each cell: cell.backgroundColor = [UIColor clearColor]; cell.contentView.backgroundColor = [UIColor clearColor]; cell.contentView.alpha = 0.0; cell.alpha = 0.0; Any suggestions on how to get my table's background image to stop repeating in each cell would be appreciated!

    Read the article

  • Recommendations for keeping a build server updated

    - by gareth_bowles
    As a guy who frequently switches between QA, build and operations, I keep running into the issue of what to do about operating system updates on the build server. The dichotomy is the same on Windows, Linux, MacOS or any other o/s that can update itself via the internet: The QA team wants to keep the build server exactly as it is from the beginning of the product release cycle to the end, since installing updates could destabilize the server and means that successive builds aren't made against the same baseline. The ops team wants the software to be deployed on a system with all the latest security patches; this can mean that the software isn't deployed on exactly the same version of the o/s that it was built on. I usually mitigate this by taking release candidate builds and installing them on a test server that has a completely up-to-date o/s, repeating the automated tests that are run on the build server and doing some additional system level testing to make sure everything looks good before deployment. However, this seems inefficient to me; does anyone have a better way ?

    Read the article

  • InfoPath Critical Error

    - by Val
    Hi guys, need your help regarding infopath error. i have atleast 130 fields in the form. and in that 130 fields i have 7 repeating tables. when i tried to save/submit the form this error pops out: Critical Error This session has exceeded the amount of allowable resource. Click Start Over to load a new copy of the form. if this error persist, contact the support team for the website. thanks guys in advance.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Iphone SDK, arc4random CGPointmake?

    - by Harry
    I have tried using integers to store the number like so: playPin = 35 + arc4random() % 118; playY = -50 - arc4random() %100; if (CGRectIntersectsRect(pin.frame, refreshpin.frame)){ pin.center = CGPointMake(playPin, playY); pinend.center = CGPointMake(pin.center.x, pin.center.y+58); } Then using them, when needed, but... its random the first time, then it just keeps repeating itself. then i tried this: if (CGRectIntersectsRect(pin.frame, refreshpin.frame)){ pin.center = CGPointMake(35 + arc4random() % 118, -50 - arc4random() %100); pinend.center = CGPointMake(pin.center.x, pin.center.y+58); } And this also doesn't work, you cant even see the items i want to display! Any ideas? Thanks. Harry.

    Read the article

  • Apache/passenger/ree doesn't interpret .rb files

    - by Sergey
    I'm trying to get apache + passenger + ree to work. I think I did everything (except for setting up rails env - for now I wanna run just pure ruby) described here: http://rvm.beginrescueend.com/integration/passenger/ But when I try to go to localhost/test.rb it doesn't interpret that file and just download it. I don't know where should I look for mistakes, so here are a few files I think could be relevant: /var/log/apache2/error.log (these 2 lines are repeating) [Mon May 31 23:12:47 2010] [notice] Graceful restart requested, doing restart [Mon May 31 23:12:48 2010] [notice] Apache/2.2.14 (Ubuntu) PHP/5.3.2-1ubuntu4.2 with Suhosin-Patch Phusion_Passenger/2.2.11 configured -- resuming normal operations /etc/apache2/httpd.conf LoadModule passenger_module /home/sergey/.rvm/gems/ree-1.8.7-2010.01/gems/passenger-2.2.11/ext/apache2/mod_passenger.so PassengerRoot /home/sergey/.rvm/gems/ree-1.8.7-2010.01/gems/passenger-2.2.11 PassengerRuby /home/sergey/.rvm/bin/passenger_ruby /var/www/test.rb puts "test"

    Read the article

  • jQuery selective hover

    - by Vitor
    Hello everyone, I'm trying to do a simple task with jQuery: I have a list of words which, when hovered, should fadeIn its corresponding image. For example: <a href="#" class="yellow">Yellow</a> <a href="#" class="blue">Blue</a> <a href="#" class="green">Green</a> <img src="yellow.jpg" class="yellow"> <img src="blue.jpg" class="blue"> <img src="green.jpg" class="green"> I'm currently doing it this way for each link/image: $('a.yellow').hover( function () { $('img.yellow').fadeIn('fast'); }, function () { $('img.yellow').fadeOut('fast'); }); The method above works fine, but as I'm still learning, I guess there's a better way to do that instead of repeating functions. Can anyone give me some light here? How can I improve this code?

    Read the article

  • CSS inheritance: applying selector for itself and every descendant

    - by Cawas
    Get a custom user CSS and type this .answered-accepted { color: white !important; background: #090 !important; } Now go to answers.unity3d and look for an accepted answer. The design looks bad, because the <strong> in there overrides the customization. The fix I've found is this: .answered-accepted, .answered-accepted * { color: white !important; background: #090 !important; } Now it looks fine on the website, but the code looks ugly!! How can I do this without repeating the class name?

    Read the article

  • Including two signatures, both with a 'type t' [Standard ML]

    - by Andy Morris
    A contrived example: signature A = sig type t val x: t end signature B = sig type t val y: t end signature C = sig include A B end Obviously, this will cause complaints that type t occurs twice in C. But is there any way to express that I want the two ts to be equated, ending up with: signature C = sig type t val x: t val y: t end I tried all sorts of silly syntax like include B where type t = A.t, which unsurprisingly didn't work. Is there something I've forgotten to try? Also, I know that this would be simply answered by checking the language's syntax for anything obvious (or a lack of), but I couldn't find a complete grammar anywhere on the internet. (FWIW, the actual reason I'm trying to do this is Haskell-style monads and such, where a MonadPlus is just a mix of a Monad and an Alternative; at the moment I'm just repeating the contents of ALTERNATIVE in MONAD_PLUS, which strikes me as less than ideal.)

    Read the article

  • How can I easily print multiple layers on multiple pages in Visio

    - by Mark Robinson
    We've created a flow chart using Visio that has multiple layers. (The background is that each layer represents variations on a basic process.) Now we want to be able to print each layer individually. Currently this involves lots of clicking to select the correct layer and and then press print - then repeating this for each of the 10 layers. Is there a simpler way? E.g. define each layer once and use a "print each layer" tool / macro?

    Read the article

  • Safari box shadow inset support

    - by codedude
    I have a box in one of my websites that has a these property: -moz-box-shadow:inset 0 0 50px #ecf4de; -webkit-box-shadow:inset 0 0 50px #ecf4de; box-shadow:inset 0 0 50px #ecf4de; This gives the box a nice gradient towards the center. However, Safari does not support the "inset" property and IE doesn't support box-shadow at all. I can't use an image for this because the height of this box changes for each situation. I don't want to use 3 images, (one for the top, a repeating one for the middle and one for the bottom), as this can get very messy code. So what I'm asking is if there is any way to produce the box shadow in all browsers.

    Read the article

  • Using sectioned tables from an sqlite file with an iPhone uitableview

    - by Chris
    I am currently trying to make a sectioned table like this: Section 1: Entry 1 Entry 2 Entry 3 Section 2: Entry 4 Entry 5 Entry 6 Section 3: Entry 7 Entry 8 ... However, using this code: Event *lists = (Event *)[eventList objectAtIndex:indexPath.row]; accessStatement = "select * from DatabaseName"; [self findEvents]; // Code that builds each object's strings from database cell.textLabel.text = lists.name; Section 1: Entry 1 Entry 2 Entry 3 Section 2: Entry 1 Entry 2 Entry 3 Section 3: Entry 1 Entry 2 ... It keeps on repeating itself. How do I make the index so that it continues in each section rather than restarts? Thanks in advance.

    Read the article

  • Onpaint events (invalidated) changing execution order after a period normal operation (runtime)

    - by Luke Mcneice
    I have 3 data graphs that are painted via the their paint events. When I have data that I need to insert into the graph I call the controls invalidate() command. The first control's paint event actually creates a bitmap buffer for the other 2 graphs to avoid repeating a long loop. So the invalidate commands are in a specific order (1,2,3). This works well, however when the graphed data reaches the end of the graph window (PictureBox) where the data would normally start scrolling, the paint events begin firing in the wrong order (2,3,1). has anyone came across this before? why might this be happening?

    Read the article

  • Recursion and Iteration

    - by Doug
    What is the difference? Are these the same? If not, can someone please give me an example? MW: Iteration - 1 : the action or a process of iterating or repeating: as a : a procedure in which repetition of a sequence of operations yields results successively closer to a desired result b : the repetition of a sequence of computer instructions a specified number of times or until a condition is met Recusion - 3 : a computer programming technique involving the use of a procedure, subroutine, function, or algorithm that calls itself one or more times until a specified condition is met at which time the rest of each repetition is processed from the last one called to the first

    Read the article

  • create a simple pdf report from html

    - by opensas
    I'm looking for a way to generate pdf files from html In order to make simple tabular reports I would need the following features table rendering variable page size repeating headers / footers on every page calculated page number / total page css support would be nice I know there have been many similar questions in stackoverflow, but I don't know if there's a product that supports the aforementioned features... Ideally, the source would be a plain and simple well built html with css, (I'm building the html files, so I can adapt to the products needs, that is, it won't have to render every piece of html crap you can throw at a browser) and with some custom tags to configure headings, footer, page size, etc... then I would run a command line to convert it from html to pdf. I think http://www.allcolor.org/YaHPConverter/ does something like that

    Read the article

  • Can I make clojure macro that will allow me to get a list of all functions created by the macro?

    - by Rob Lachlan
    I would like to have a macro which I'll call def-foo. Def-foo will create a function, and then will add this function to a set. So I could call (def-foo bar ...) (def-foo baz ...) And then there would be some set, e.g. all-foos, which I could call: all-foos => #{bar, baz} Essentially, I'm just trying to avoid repeating myself. I could of course define the functions in the normal way, (defn bar ...) and then write the set manually. A better alternative, and simpler than the macro idea, would be to do: (def foos #{(defn bar ...) (defn baz ...)} ) But I'm still curious as to whether there is a good way for the macro idea to work.

    Read the article

  • PHP 2D Array output all combinations

    - by stukerr
    Hi there, I've had this problem bending my mind for a while now (head cold doesn't help either!), basically I have a PHP array which looks like this example: $array[0][0] = 'apples'; $array[0][1] = 'pears'; $array[0][2] = 'oranges'; $array[1][0] = 'steve'; $array[1][1] = 'bob'; And I would like to be able to produce from this a table with every possible combination of these, but without repeating any combinations (regardless of their position), so for example this would output Array 0 Array 1 apples steve apples bob pears steve pears bob But I would like for this to be able to work with as many different arrays as possible. Many thanks!

    Read the article

  • Code Golf: Beehive

    - by LiraNuna
    The challenge The shortest code by character count that will generate a beehive from user input. A beehive is defined a a grid of hexagons in a size inputted by the user as two positive numbers greater than zero (no need to validate input). The first number (W) represents the width of the beehive - or - how many hexagons are on each row. The second number (H) represents the height of the beehive - or - how many hexagons are on each column. A Single hexagon is made from three ASCII characters: _, / and \, and three lines: __ / \ \__/ Hexagons complete each other: the first column of the beehive will be 'low', and the second will be high - alternating and repeating in the same pattern forming W hexagons. This will be repeated H times to form a total of WxH hexagons. Test cases: Input: 1 1 Output: __ / \ \__/ Input: 4 2 Output: __ __ __/ \__/ \ / \__/ \__/ \__/ \__/ \ / \__/ \__/ \__/ \__/ Input: 2 5 Output: __ __/ \ / \__/ \__/ \ / \__/ \__/ \ / \__/ \__/ \ / \__/ \__/ \ / \__/ \__/ Input: 11 3 Output: __ __ __ __ __ __/ \__/ \__/ \__/ \__/ \__ / \__/ \__/ \__/ \__/ \__/ \ \__/ \__/ \__/ \__/ \__/ \__/ / \__/ \__/ \__/ \__/ \__/ \ \__/ \__/ \__/ \__/ \__/ \__/ / \__/ \__/ \__/ \__/ \__/ \ \__/ \__/ \__/ \__/ \__/ \__/ Code count includes input/output (i.e full program).

    Read the article

  • Show blank UITableViewCells in custom UITableView

    - by Typeoneerror
    I am trying to customize a UITableView. So far, it looks good. But when I use a custom UITableViewCell sub-class, I do not get the blank table cells when there's only 3 cells: Using the default TableView style I can get the repeating blank rows to fill the view (for example, the mail application has this). I tried to set a backgroundColor pattern on the UITableView to the same tile background: UIColor *color = [UIColor colorWithPatternImage:[UIImage imageNamed:@"score-cell-bg.png"]]; moneyTableView.backgroundColor = color; ...but the tile starts a bit before the TableView's top, so the tile is off once the actual cell's are done displaying: How can I customize my tableview but still keep the blank rows if there's less rows than fill a page?

    Read the article

  • [C#] Onpaint events (invalidated) changing execution order after a period normal operation (runtime)

    - by Luke Mcneice
    Hi all, I have 3 data graphs that are painted via the their paint events. When I have data that I need to insert into the graph I call the controls invalidate() command. The first control's paint event actually creates a bitmap buffer for the other 2 graphs to avoid repeating a long loop. So the invalidate commands are in a specific order (1,2,3). This works well, however when the graphed data reaches the end of the graph window (PictureBox) where the data would normally start scrolling, the paint events begin firing in the wrong order (2,3,1). has anyone came across this before? why might this be happening?

    Read the article

< Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >