Search Results

Search found 38457 results on 1539 pages for 'string parse'.

Page 13/1539 | < Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >

  • Avoiding resource (localizable string) duplication with String.Format

    - by Hrvoje Prgeša
    I'm working on a application (.NET, but not relevant) where there is large potential for resource/string duplication - most of these strings are simple like: Volume: 33 Volume: 33 (dB) Volume 33 dB Volume (dB) Command - Volume: 33 (dB) where X, Y and unit are the same. Should I define a new resource for each of the string or is it preferable to use String.Format to simplify some of these, eg.: String.Format("{0}: {1}", Resource.Volume, 33) String.Format("{0}: {1} {2}", Resource.Volume, 33, Resource.dB) Resource.Volume String.Format("{0} ({1})", 33, Resource.dB) String.Format("{0} ({1})", Resource.Volume, Resource.dB) String.Format("Command - {0}: {1} {2}", Resource.Volume, 33, Resource.dB) I would also define string formats like "{0}: {1}" in the resources so there would be a possibility of reordering words... I would not use this approach selectivly and not throughout the whole application.. And how about: String.Format("{0}: {1}", Volume, Resource.Muted_Volume) // = Volume: Muted Resource.Muted_Volume String.Format("{0}: {1} (by user {2})", Volume, Resource.Muted_Volume, "xy") // = Volume: Muted (by user xy) The advantage is cutting the number of resource by the factor of 4-5. Are there any hidden dangers of using this approach? Could someone give me an example (language) where this would not work correctly?

    Read the article

  • Optimizing a lot of Scanner.findWithinHorizon(pattern, 0) calls

    - by darvids0n
    I'm building a process which extracts data from 6 csv-style files and two poorly laid out .txt reports and builds output CSVs, and I'm fully aware that there's going to be some overhead searching through all that whitespace thousands of times, but I never anticipated converting about about 50,000 records would take 12 hours. Excerpt of my manual matching code (I know it's horrible that I use lists of tokens like that, but it was the best thing I could think of): public static String lookup(List<String> tokensBefore, List<String> tokensAfter) { String result = null; while(_match(tokensBefore)) { // block until all input is read if(id.hasNext()) { result = id.next(); // capture the next token that matches if(_matchImmediate(tokensAfter)) // try to match tokensAfter to this result return result; } else return null; // end of file; no match } return null; // no matches } private static boolean _match(List<String> tokens) { return _match(tokens, true); } private static boolean _match(List<String> tokens, boolean block) { if(tokens != null && !tokens.isEmpty()) { if(id.findWithinHorizon(tokens.get(0), 0) == null) return false; for(int i = 1; i <= tokens.size(); i++) { if (i == tokens.size()) { // matches all tokens return true; } else if(id.hasNext() && !id.next().matches(tokens.get(i))) { break; // break to blocking behaviour } } } else { return true; // empty list always matches } if(block) return _match(tokens); // loop until we find something or nothing else return false; // return after just one attempted match } private static boolean _matchImmediate(List<String> tokens) { if(tokens != null) { for(int i = 0; i <= tokens.size(); i++) { if (i == tokens.size()) { // matches all tokens return true; } else if(!id.hasNext() || !id.next().matches(tokens.get(i))) { return false; // doesn't match, or end of file } } return false; // we have some serious problems if this ever gets called } else { return true; // empty list always matches } } Basically wondering how I would work in an efficient string search (Boyer-Moore or similar). My Scanner id is scanning a java.util.String, figured buffering it to memory would reduce I/O since the search here is being performed thousands of times on a relatively small file. The performance increase compared to scanning a BufferedReader(FileReader(File)) was probably less than 1%, the process still looks to be taking a LONG time. I've also traced execution and the slowness of my overall conversion process is definitely between the first and last like of the lookup method. In fact, so much so that I ran a shortcut process to count the number of occurrences of various identifiers in the .csv-style files (I use 2 lookup methods, this is just one of them) and the process completed indexing approx 4 different identifiers for 50,000 records in less than a minute. Compared to 12 hours, that's instant. Some notes (updated): I don't necessarily need the pattern-matching behaviour, I only get the first field of a line of text so I need to match line breaks or use Scanner.nextLine(). All ID numbers I need start at position 0 of a line and run through til the first block of whitespace, after which is the name of the corresponding object. I would ideally want to return a String, not an int locating the line number or start position of the result, but if it's faster then it will still work just fine. If an int is being returned, however, then I would now have to seek to that line again just to get the ID; storing the ID of every line that is searched sounds like a way around that. Anything to help me out, even if it saves 1ms per search, will help, so all input is appreciated. Thankyou! Usage scenario 1: I have a list of objects in file A, who in the old-style system have an id number which is not in file A. It is, however, POSSIBLY in another csv-style file (file B) or possibly still in a .txt report (file C) which each also contain a bunch of other information which is not useful here, and so file B needs to be searched through for the object's full name (1 token since it would reside within the second column of any given line), and then the first column should be the ID number. If that doesn't work, we then have to split the search token by whitespace into separate tokens before doing a search of file C for those tokens as well. Generalised code: String field; for (/* each record in file A */) { /* construct the rest of this object from file A info */ // now to find the ID, if we can List<String> objectName = new ArrayList<String>(1); objectName.add(Pattern.quote(thisObject.fullName)); field = lookup(objectSearchToken, objectName); // search file B if(field == null) // not found in file B { lookupReset(false); // initialise scanner to check file C objectName.clear(); // not using the full name String[] tokens = thisObject.fullName.split(id.delimiter().pattern()); for(String s : tokens) objectName.add(Pattern.quote(s)); field = lookup(objectSearchToken, objectName); // search file C lookupReset(true); // back to file B } else { /* found it, file B specific processing here */ } if(field != null) // found it in B or C thisObject.ID = field; } The objectName tokens are all uppercase words with possible hyphens or apostrophes in them, separated by spaces. Much like a person's name. As per a comment, I will pre-compile the regex for my objectSearchToken, which is just [\r\n]+. What's ending up happening in file C is, every single line is being checked, even the 95% of lines which don't contain an ID number and object name at the start. Would it be quicker to use ^[\r\n]+.*(objectname) instead of two separate regexes? It may reduce the number of _match executions. The more general case of that would be, concatenate all tokensBefore with all tokensAfter, and put a .* in the middle. It would need to be matching backwards through the file though, otherwise it would match the correct line but with a huge .* block in the middle with lots of lines. The above situation could be resolved if I could get java.util.Scanner to return the token previous to the current one after a call to findWithinHorizon. I have another usage scenario. Will put it up asap.

    Read the article

  • BlackBerry/J2ME - SAX parse collection of objects with attributes

    - by Changqi Guo
    I have a problem with using the SAX parser to parse a XML file. It is a complex XML file, it is like the following. <Objects> <Object no="1"> <field name="PID">ilives:87877</field> <field name="dc.coverage">Charlottetown</field> <field name="fgs.ownerId">fedoraAdmin</field> </Object> <Object no="2">...... I am confused how to get the names in each field, and how to store the information of each object. import java.util.Enumeration; import java.util.Hashtable; public class XMLObject { private Hashtable mFields = new Hashtable(); private int mN = -1; public int getN() { return mN; } public void setN(int n) { mN = n; } public String getStringField(String key) { return (String) mFields.get(key); } public void setStringField(String key, String value) { mFields.put(key, value); } public String getPID() { return getStringField("PID"); } public void setPID(String pid) { setStringField("PID", pid); } public String getDcCoverage() { return getStringField("dc.coverage"); } public void setDcCoverage(String dcCoverage) { setStringField("dc.coverage", dcCoverage); } public String getFgsOwnerId() { return getStringField("fgs.ownerId"); } public void setFgsOwnerId(String fgsOwnerId) { setStringField("fgs.ownerId", fgsOwnerId); } public String dccreator() { return getStringField("dc.creator"); } public void dccreator(String dccreator) { setStringField("dc.creator", dccreator); } public String getdcformat() { return getStringField("dc.format"); } public void setdcformat(String dcformat) { setStringField("dc.format", dcformat); } public String getdcidentifier() { return getStringField("dc.identifier"); } public void setdcidentifier(String dcidentifier) { setStringField("dc.identifier", dcidentifier); } public String getdclanguage() { return getStringField("dc.language"); } public void setdclanguage(String dclanguage) { setStringField("dc.language", dclanguage); } public String getdcpublisher() { return getStringField("dc.publisher"); } public void setdcpublisher(String dcpublisher) { setStringField("dc.publisher",dcpublisher); } public String getdcsubject() { return getStringField("dc.subject"); } public void setdcsubject(String dcsubject) { setStringField("dc.subject",dcsubject); } public String getdctitle() { return getStringField("dc.title"); } public void setdctitle(String dctitle) { setStringField("dc.title",dctitle); } public String getdctype() { return getStringField("dc.type"); } public void setdctype(String dctype) { setStringField("dc.type",dctype); } public String toString() { StringBuffer sb = new StringBuffer(); sb.append("N:"+mN+";"); Enumeration keys = mFields.keys(); while (keys.hasMoreElements()) { String key = (String) keys.nextElement(); sb.append(key+":"+mFields.get(key)+";"); } return sb.toString(); } } i used the same handler class you provided import java.io.*; import net.rim.device.api.system.Bitmap; import javax.xml.parsers.ParserConfigurationException; import javax.xml.parsers.SAXParser; import javax.xml.parsers.SAXParserFactory; import java.io.InputStream; import net.rim.device.api.ui.component.*; import net.rim.device.api.ui.container.MainScreen; import net.rim.device.api.xml.parsers.*; import org.w3c.dom.*; import org.xml.sax.*; import org.xml.sax.helpers.DefaultHandler; public class xmlparsermainscreen extends MainScreen{ private static String xmlres = "/xml/xml1.xml"; private RichTextField textOutputField; public xmlparsermainscreen() throws ParserConfigurationException, net.rim.device.api.xml.parsers.ParserConfigurationException, IOException { InputStream inputStream = getClass().getResourceAsStream(xmlres); ByteArrayOutputStream baos = new ByteArrayOutputStream(); byte[] buffer = new byte[10000]; int bytesRead = inputStream.read(buffer); while (bytesRead > 0) { baos.write(buffer, 0, bytesRead); bytesRead = inputStream.read(buffer); } baos.close(); String result=baos.toString(); ByteArrayInputStream bais = new ByteArrayInputStream(result.getBytes()); XMLObject[] xmlObjects = getXMLObjects(bais); for (int i = 0; i < xmlObjects.length; i++) { XMLObject o = xmlObjects[i]; textOutputField = new RichTextField(); add(textOutputField); textOutputField.setText(o.toString()); // add(new LabelField(o.toString())); } LabelField resultdis=new LabelField("resultdisplay"); add(resultdis); //textOutputField = new RichTextField(); //add(textOutputField); //textOutputField.setText(result); } static XMLObject[] getXMLObjects(InputStream is) throws ParserConfigurationException { XMLObjectHandler xmlObjectHandler = new XMLObjectHandler(); try { SAXParser parser = SAXParserFactory.newInstance() .newSAXParser(); parser.parse(is, xmlObjectHandler); } catch (ParserConfigurationException e) { e.printStackTrace(); } catch (SAXException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } return xmlObjectHandler.getXMLObjects(); } } import java.io.IOException; import javax.xml.parsers.ParserConfigurationException; import net.rim.device.api.ui.UiApplication; public class xmlparser extends UiApplication { private xmlparser() throws ParserConfigurationException, net.rim.device.api.xml.parsers.ParserConfigurationException, IOException { pushScreen( new xmlparsermainscreen() ); } public static void main( String[] args ) throws ParserConfigurationException, net.rim.device.api.xml.parsers.ParserConfigurationException, IOException { new xmlparser().enterEventDispatcher(); } }

    Read the article

  • how to read character from console in c++?

    - by tsubasa
    I'm struggling with reading characters from console in c++. Here is what I tried to do: char x; char y; char z; cout<<"Please enter your string: "; string s; getline(cin,s); istringstream is(s); is>> x >> y >> z; The problem is if the user enter something like this "1 20 100": x will get 1 y will get 2 z will get 0 What I want to get is x = 1; y = 20; z = 100; Anybody has suggestions?

    Read the article

  • How to parse time stamps with Unicode characters in Java or Perl?

    - by ram
    I'm trying to make my code as generic as possible. I'm trying to parse install time of a product installation. I will have two files in the product, one that has time stamp I need to parse and other file tells the language of the installation. This is how I'm parsing the timestamp public class ts { public static void main (String[] args){ String installTime = "2009/11/26 \u4e0b\u5348 04:40:54"; //This timestamp I got from the first file. Those unicode charecters are some Chinese charecters...AM/PM I guess //Locale = new Locale();//don't set the language yet SimpleDateFormat df = (SimpleDateFormat)DateFormat.getDateTimeInstance(DateFormat.DEFAULT,DateFormat.DEFAULT); Date instTime = null; try { instTime = df.parse(installTime); } catch (ParseException e) { // TODO Auto-generated catch block e.printStackTrace(); } System.out.println(instTime.toString()); } } The output I get is Parsing Failed java.text.ParseException: Unparseable date: "2009/11/26 \u4e0b\u5348 04:40:54" at java.text.DateFormat.parse(Unknown Source) at ts.main(ts.java:39) Exception in thread "main" java.lang.NullPointerException at ts.main(ts.java:45) It throws exception and at the end when I print it, it shows some proper date... wrong though. I would really appreciate if you could clarify me on these doubts How to parse timestamps that have unicode characters if this is not the proper way? If parsing is failed, how could instTime able to hold some date, wrong though? I know its some chinese,Korean time stamps so I set the locale to zh and ko as follows.. even then same error comes again Locale = new Locale("ko"); Locale = new Locale("ja"); Locale = new Locale("zh"); How can I do the same thing in Perl? I can't use Date::Manip package; Is there any other way?

    Read the article

  • AdvancedFormatProvider: Making string.format do more

    - by plblum
    When I have an integer that I want to format within the String.Format() and ToString(format) methods, I’m always forgetting the format symbol to use with it. That’s probably because its not very intuitive. Use {0:N0} if you want it with group (thousands) separators. text = String.Format("{0:N0}", 1000); // returns "1,000"   int value1 = 1000; text = value1.ToString("N0"); Use {0:D} or {0:G} if you want it without group separators. text = String.Format("{0:D}", 1000); // returns "1000"   int value2 = 1000; text2 = value2.ToString("D"); The {0:D} is especially confusing because Microsoft gives the token the name “Decimal”. I thought it reasonable to have a new format symbol for String.Format, "I" for integer, and the ability to tell it whether it shows the group separators. Along the same lines, why not expand the format symbols for currency ({0:C}) and percent ({0:P}) to let you omit the currency or percent symbol, omit the group separator, and even to drop the decimal part when the value is equal to the whole number? My solution is an open source project called AdvancedFormatProvider, a group of classes that provide the new format symbols, continue to support the rest of the native symbols and makes it easy to plug in additional format symbols. Please visit https://github.com/plblum/AdvancedFormatProvider to learn about it in detail and explore how its implemented. The rest of this post will explore some of the concepts it takes to expand String.Format() and ToString(format). AdvancedFormatProvider benefits: Supports {0:I} token for integers. It offers the {0:I-,} option to omit the group separator. Supports {0:C} token with several options. {0:C-$} omits the currency symbol. {0:C-,} omits group separators, and {0:C-0} hides the decimal part when the value would show “.00”. For example, 1000.0 becomes “$1000” while 1000.12 becomes “$1000.12”. Supports {0:P} token with several options. {0:P-%} omits the percent symbol. {0:P-,} omits group separators, and {0:P-0} hides the decimal part when the value would show “.00”. For example, 1 becomes “100 %” while 1.1223 becomes “112.23 %”. Provides a plug in framework that lets you create new formatters to handle specific format symbols. You register them globally so you can just pass the AdvancedFormatProvider object into String.Format and ToString(format) without having to figure out which plug ins to add. text = String.Format(AdvancedFormatProvider.Current, "{0:I}", 1000); // returns "1,000" text2 = String.Format(AdvancedFormatProvider.Current, "{0:I-,}", 1000); // returns "1000" text3 = String.Format(AdvancedFormatProvider.Current, "{0:C-$-,}", 1000.0); // returns "1000.00" The IFormatProvider parameter Microsoft has made String.Format() and ToString(format) format expandable. They each take an additional parameter that takes an object that implements System.IFormatProvider. This interface has a single member, the GetFormat() method, which returns an object that knows how to convert the format symbol and value into the desired string. There are already a number of web-based resources to teach you about IFormatProvider and the companion interface ICustomFormatter. I’ll defer to them if you want to dig more into the topic. The only thing I want to point out is what I think are implementation considerations. Why GetFormat() always tests for ICustomFormatter When you see examples of implementing IFormatProviders, the GetFormat() method always tests the parameter against the ICustomFormatter type. Why is that? public object GetFormat(Type formatType) { if (formatType == typeof(ICustomFormatter)) return this; else return null; } The value of formatType is already predetermined by the .net framework. String.Format() uses the StringBuilder.AppendFormat() method to parse the string, extracting the tokens and calling GetFormat() with the ICustomFormatter type. (The .net framework also calls GetFormat() with the types of System.Globalization.NumberFormatInfo and System.Globalization.DateTimeFormatInfo but these are exclusive to how the System.Globalization.CultureInfo class handles its implementation of IFormatProvider.) Your code replaces instead of expands I would have expected the caller to pass in the format string to GetFormat() to allow your code to determine if it handles the request. My vision would be to return null when the format string is not supported. The caller would iterate through IFormatProviders until it finds one that handles the format string. Unfortunatley that is not the case. The reason you write GetFormat() as above is because the caller is expecting an object that handles all formatting cases. You are effectively supposed to write enough code in your formatter to handle your new cases and call .net functions (like String.Format() and ToString(format)) to handle the original cases. Its not hard to support the native functions from within your ICustomFormatter.Format function. Just test the format string to see if it applies to you. If not, call String.Format() with a token using the format passed in. public string Format(string format, object arg, IFormatProvider formatProvider) { if (format.StartsWith("I")) { // handle "I" formatter } else return String.Format(formatProvider, "{0:" + format + "}", arg); } Formatters are only used by explicit request Each time you write a custom formatter (implementer of ICustomFormatter), it is not used unless you explicitly passed an IFormatProvider object that supports your formatter into String.Format() or ToString(). This has several disadvantages: Suppose you have several ICustomFormatters. In order to have all available to String.Format() and ToString(format), you have to merge their code and create an IFormatProvider to return an instance of your new class. You have to remember to utilize the IFormatProvider parameter. Its easy to overlook, especially when you have existing code that calls String.Format() without using it. Some APIs may call String.Format() themselves. If those APIs do not offer an IFormatProvider parameter, your ICustomFormatter will not be available to them. The AdvancedFormatProvider solves the first two of these problems by providing a plug-in architecture.

    Read the article

  • Parse usable Street Address, City, State, Zip from a string

    - by Rob Allen
    Problem: I have an address field from an Access database which has been converted to Sql Server 2005. This field has everything all in one field. I need to parse out the individual sections of the address into their appropriate fields in a normalized table. I need to do this for approximately 4,000 records and it needs to be repeatable. Here are the rules for this exercise: 1 - no whining about how this should have been separate fields in the first place, we are often confronted with less than ideal situations and have to make the best of them 2- for this post, use any language you want 3- feel free to play code golf 4 - Assume an address in the US (for now) 5 - assume that the input string will sometimes contain an addressee (the person being addressed) and/or a second street address (i.e. Suite B) 6 - states may be abbreviated 7 - zip code could be standard 5 digit or zip+4 8 - there are typos in some instances UPDATE: In response to the questions posed, standards were not universally followed, I need need to store the individual values, not just geocode and errors means typo (corrected above) Sample Data: A. P. Croll & Son 2299 Lewes-Georgetown Hwy, Georgetown, DE 19947 11522 Shawnee Road, Greenwood DE 19950 144 Kings Highway, S.W. Dover, DE 19901 Intergrated Const. Services 2 Penns Way Suite 405 New Castle, DE 19720 Humes Realty 33 Bridle Ridge Court, Lewes, DE 19958 Nichols Excavation 2742 Pulaski Hwy Newark, DE 19711 2284 Bryn Zion Road, Smyrna, DE 19904 VEI Dover Crossroads, LLC 1500 Serpentine Road, Suite 100 Baltimore MD 21 580 North Dupont Highway Dover, DE 19901 P.O. Box 778 Dover, DE 19903

    Read the article

  • Parse error: syntax error, unexpected T_STRING in...

    - by rabidmachine9
    I' making this class to catch twitter posts but I get the error : Parse error: syntax error, unexpected T_STRING in /Applications/XAMPP/xamppfiles/htdocs/classTest/Twitter.php on line 29 I cant find what's wrong...any ideas? class TwitterGrub{ function twitterCapture($user = 'myUsername',$password = 'myPass') { $ch = curl_init("https://twitter.com/statuses/user_timeline.xml"); curl_setopt($ch, CURLOPT_HEADER, 1); curl_setopt($ch,CURLOPT_TIMEOUT, 30); curl_setopt($ch,CURLOPT_USERPWD,$user . ":" . $password); curl_setopt($ch,CURLOPT_RETURNTRANSFER,1); curl_setopt ($ch, CURLOPT_SSL_VERIFYPEER, 0); curl_setopt ($ch, CURLOPT_SSL_VERIFYHOST, 0); $result=curl_exec ($ch); $data = strstr($result, '<?'); $xml = new SimpleXMLElement($data); return $xml; } function twitterDisplay($twitNum){ $xml = this->twitterCapture(); for($i= 0; $i<$twitNum; $i++){ echo "<div class='curvebox'>".$xml->status[$i]->text."</div>"; } } }

    Read the article

  • parse my proprietary string format

    - by microsumol
    How can we get the numbers 7 and 4 and 5 from the following string: MODULE potmtpMAIN main <info: "Enterprise Optimizer 7.4 for COR Technology 5.5 -- Advanced Solver Edition", url:"http://EO.riverlogic.com", url_menu:"EO Online...", app_id:"EOAS",app_name:"Enterprise Optimizer AS", app_major:7, app_minor:4,app_micro:5,app_copyright:"\251 1996-2010 River Logic Inc.\r\nAll Rights Reserved."> The search must be based on app_major: app_minor: and app_micro Thank You in advance

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • How to restrict a content of string to less than 4MB and save that string in DB using C#

    - by Pranay B
    I'm working on a project where I need to get the Text data from pdf files and dump the whole text in a DB column. With the help of iTextsharp, I got the data and referred it String. But now I need to check whether the string exceeds the 4MB limit or not and if it is exceeding then accept the string data which is less than 4MB in size. This is my code: internal string ReadPdfFiles() { // variable to store file path string filePath = null; // open dialog box to select file OpenFileDialog file = new OpenFileDialog(); // dilog box title name file.Title = "Select Pdf File"; //files to be accepted by the user. file.Filter = "Pdf file (*.pdf)|*.pdf|All files (*.*)|*.*"; // set initial directory of computer system file.InitialDirectory = Environment.GetFolderPath(Environment.SpecialFolder.Desktop); // set restore directory file.RestoreDirectory = true; // execute if block when dialog result box click ok button if (file.ShowDialog() == DialogResult.OK) { // store selected file path filePath = file.FileName.ToString(); } //file path /// use a string array and pass all the pdf for searching //String filePath = @"D:\Pranay\Documentation\Working on SSAS.pdf"; try { //creating an instance of PdfReader class using (PdfReader reader = new PdfReader(filePath)) { //creating an instance of StringBuilder class StringBuilder text = new StringBuilder(); //use loop to specify how many pages to read. //I started from 5th page as Piyush told for (int i = 5; i <= reader.NumberOfPages; i++) { //Read the pdf text.Append(PdfTextExtractor.GetTextFromPage(reader, i)); }//end of for(i) int k = 4096000; //Test whether the string exceeds the 4MB if (text.Length < k) { //return the string text1 = text.ToString(); } //end of if } //end of using } //end try catch (Exception ex) { MessageBox.Show(ex.Message, "Please Do select a pdf file!!", MessageBoxButtons.OK, MessageBoxIcon.Warning); } //end of catch return text1; } //end of ReadPdfFiles() method Do help me!

    Read the article

  • C++ Check Substring of a String

    - by user69514
    I'm trying to check whether or not the second argument in my program is a substring of the first argument. The problem is that it only work if the substring starts with the same letter of the string. .i.e Michigan - Mich (this works) Michigan - Mi (this works) Michigan - igan (this doesn't work) #include <stdio.h> #include <string.h> #include <string> using namespace std; bool my_strstr( string str, string sub ) { bool flag = true; int startPosition = -1; char subStart = str.at(0); char strStart; //find starting position for(int i=0; i<str.length(); i++){ if(str.at(i) == subStart){ startPosition = i; break; } } for(int i=0; i<sub.size(); i++){ if(sub.at(i) != str.at(startPosition)){ flag = false; break; } startPosition++; } return flag; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } string str1 = argv[1]; string str2 = argv[2]; bool result = my_strstr(str1, str2); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get context for search string in text in C#

    - by soundslike
    Given a string text which contains newline there is a search keyword which matches an item within the text. How do I implement the following in C#: searchIdx = search index (starting with 0, then 1, etc. for each successive call to GetSearchContext. Initially start with 0. contextsTxt = string data to search in searchTxt = keyword to search for in contextsTxt numLines = number of lines to return surrounding the searchTxt found (ie. 1 = the line the searchTxt is found on, 2 = the line the searchTxt is found on, 3 = the line above the searchTxt is found on, the line the searchTxt is found on, and the line below the searchTxt is found on) returns the "context" based on the parameters string GetSearchContext(int searchIdx, string contentsTxt, string searchTxt, int numLines); If there's a better function interface to accomplish this feel free to suggest that as well. I tried the following but doesn't seem to work properly all the time: private string GetSearchContext(string contentValue, string search, int numLines) { int searchIdx = contentValue.IndexOf(search); int startIdx = 0; int lastIdx = 0; while (startIdx != -1 && (startIdx = contentValue.IndexOf('\n', startIdx+1)) < searchIdx) { lastIdx = startIdx; } startIdx = lastIdx; if (startIdx < 0) startIdx = 0; int endIdx = searchIdx; int lineCnt = 0; while (endIdx != -1 && lineCnt++ < numLines) { endIdx = contentValue.IndexOf('\n', endIdx + 1); } if (endIdx == -1 || endIdx > contentValue.Length - 1) endIdx = contentValue.Length - 1; string lines = contentValue.Substring(startIdx, endIdx - startIdx + 1); if (lines[0] == '\n') lines = lines.Substring(1); if (lines[lines.Length - 1] == '\n') { lines = lines.Substring(0, lines.Length - 1); } if (lines[lines.Length - 1] == '\r') { lines = lines.Substring(0, lines.Length - 1); } return lines; }

    Read the article

  • receive string with chars

    - by Meloun
    Hi all, i am quite new in python. I am receiving (through pyserial) string with data values. How can I parse these data to particular data structure? I know that 0-1 byte : id 2-5 byte : time1 =>but little endian (lsb first) 6-9 byte : time2 =>but little endian (lsb first) and I looking for a function: def parse_data(string): data={} data['id'] = ?? data['time1'] = ?? data['time2'] = ?? return data thanks

    Read the article

  • Create Device Reccieve SMS Parse To Text ( SMS Gateway )

    - by Chris Okyen
    I want to use a server as a device to run a script to parse a SMS text in the following way. I. The person types in a specific and special cell phone number (Similar to Facebook’s 32556 number used to post on your wall) II. The user types a text message. III. The user sends the text message. IV. The message is sent to some kind of Device (the server) or SMS Gateway and receives it. V. The thing described above that the message is sent to then parse the test message. I understand that these three question will mix Programming and Server Stuff and could reside here or at DBA.SE How would I make such a cell phone number (described in step I) that would be sent to the Device? How do I create the device that then would receive it? Finally, how do I Parse the text message?

    Read the article

  • java: decoding URI query string

    - by Jason S
    I need to decode a URI that contains a query string; expected input/output behavior is something like the following: abstract class URIParser { /** example input: * something?alias=pos&FirstName=Foo+A%26B%3DC&LastName=Bar */ URIParser(String input) { ... } /** should return "something" for the example input */ public String getPath(); /** should return a map * {alias: "pos", FirstName: "Foo+A&B=C", LastName: "Bar"} */ public Map<String,String> getQuery(); } I've tried using java.net.URI, but it seems to decode the query string so in the above example I'm left with "alias=pos&FirstName=Foo+A&B=C&LastName=Bar" so there is ambiguity whether a "&" is a query separator or is a character in a query component. edit: just tried URI.getRawQuery() and it doesn't do the encoding, so I can split the query string with a "&", but then what do I do? Any suggestions?

    Read the article

  • Java: Print and access List <String[]>

    - by battousai622
    Im reading in a file and storing it in t1. How do i access the elements in t1? When i try to print it i get addresses instead of values. Also whats the dif between string and string[]? CSVReader reader = new CSVReader(new FileReader("src/new_acquisitions.csv")); List <String[]> t1 = reader.readAll(); int i = 0 while(i < t1.size()) { System.out.println(t1.get(i)); i++; } output: [Ljava.lang.String;@9304b1 [Ljava.lang.String;@190d11 [Ljava.lang.String;@a90653 [Ljava.lang.String;@de6ced

    Read the article

  • return new string vs .ToString()

    - by Leroy Jenkins
    Take the following code: public static string ReverseIt(string myString) { char[] foo = myString.ToCharArray(); Array.Reverse(foo); return new string(foo); } I understand that strings are immutable, but what I dont understand is why a new string needs to be called return new string(foo); instead of return foo.ToString(); I have to assume it has something to do with reassembling the CharArray (but thats just a guess). Whats the difference between the two and how do you know when to return a new string as opposed to returning a System.String that represents the current object?

    Read the article

  • Formatting a string in Java using class attributes

    - by Jason R. Coombs
    I have a class with an attribute and getter method: public Class MyClass { private String myValue = "foo"; public String getMyValue(); } I would like to be able to use the value of foo in a formatted string as such: String someString = "Your value is {myValue}." String result = Formatter.format(someString, new MyClass()); // result is now "Your value is foo." That is, I would like to have some function like .format above which takes a format string specifying properties on some object, and an instance with those properties, and formats the string accordingly. Is it possible to do accomplish this feat in Java?

    Read the article

  • Only show items owned by the currently logged in user in category list view

    - by jalbasri
    I'd like to be able to provide a "Category List" view that only shows Articles that the currently logged in user owns. Is there somewhere I can edit the query used to populate the Category List view or an extension that provides this functionality. Thank you for any help you can provide. -J. Thank you for your answer. I've written the plugin. Instead of passing in an array of Articles the onContentBeforeDisplay function is called for every article and an ArrayObject of the single article gets passed in. I've been able to identify the articles I want not to be displayed but still cannot get them not to display. The $params variable has values such as "list_show_xxx" but I can't seem to change or access them. here is a var_dump($params): object(Joomla\Registry\Registry)#190 (1) { ["data":protected]=> object(stdClass)#250 (83) { ["article_layout"]=> string(9) "_:default" ["show_title"]=> string(1) "1" ["link_titles"]=> string(1) "1" ["show_intro"]=> string(1) "1" ["info_block_position"]=> string(1) "1" ["show_category"]=> string(1) "1" ["link_category"]=> string(1) "1" ["show_parent_category"]=> string(1) "0" ["link_parent_category"]=> string(1) "0" ["show_author"]=> string(1) "1" ["link_author"]=> string(1) "0" ["show_create_date"]=> string(1) "0" ["show_modify_date"]=> string(1) "0" ["show_publish_date"]=> string(1) "1" ["show_item_navigation"]=> string(1) "1" ["show_vote"]=> string(1) "0" ["show_readmore"]=> string(1) "1" ["show_readmore_title"]=> string(1) "1" ["readmore_limit"]=> string(3) "100" ["show_tags"]=> string(1) "1" ["show_icons"]=> string(1) "1" ["show_print_icon"]=> string(1) "1" ["show_email_icon"]=> string(1) "1" ["show_hits"]=> string(1) "1" ["show_noauth"]=> string(1) "0" ["urls_position"]=> string(1) "0" ["show_publishing_options"]=> string(1) "0" ["show_article_options"]=> string(1) "0" ["save_history"]=> string(1) "1" ["history_limit"]=> int(10) ["show_urls_images_frontend"]=> string(1) "0" ["show_urls_images_backend"]=> string(1) "1" ["targeta"]=> int(0) ["targetb"]=> int(0) ["targetc"]=> int(0) ["float_intro"]=> string(4) "left" ["float_fulltext"]=> string(4) "left" ["category_layout"]=> string(9) "_:default" ["show_category_heading_title_text"]=> string(1) "1" ["show_category_title"]=> string(1) "0" ["show_description"]=> string(1) "0" ["show_description_image"]=> string(1) "0" ["maxLevel"]=> string(1) "1" ["show_empty_categories"]=> string(1) "0" ["show_no_articles"]=> string(1) "1" ["show_subcat_desc"]=> string(1) "1" ["show_cat_num_articles"]=> string(1) "0" ["show_base_description"]=> string(1) "1" ["maxLevelcat"]=> string(2) "-1" ["show_empty_categories_cat"]=> string(1) "0" ["show_subcat_desc_cat"]=> string(1) "1" ["show_cat_num_articles_cat"]=> string(1) "1" ["num_leading_articles"]=> string(1) "1" ["num_intro_articles"]=> string(1) "4" ["num_columns"]=> string(1) "1" ["num_links"]=> string(1) "4" ["multi_column_order"]=> string(1) "0" ["show_subcategory_content"]=> string(1) "0" ["show_pagination_limit"]=> string(1) "1" ["filter_field"]=> string(5) "title" ["show_headings"]=> string(1) "1" ["list_show_date"]=> string(1) "0" ["date_format"]=> string(0) "" ["list_show_hits"]=> string(1) "1" ["list_show_author"]=> string(1) "1" ["orderby_pri"]=> string(5) "order" ["orderby_sec"]=> string(5) "rdate" ["order_date"]=> string(9) "published" ["show_pagination"]=> string(1) "2" ["show_pagination_results"]=> string(1) "1" ["show_feed_link"]=> string(1) "1" ["feed_summary"]=> string(1) "0" ["feed_show_readmore"]=> string(1) "0" ["display_num"]=> string(2) "10" ["menu_text"]=> int(1) ["show_page_heading"]=> int(0) ["secure"]=> int(0) ["page_title"]=> string(16) "Non-K2 News List" ["page_description"]=> string(33) "Bahrain Business Incubator Centre" ["page_rights"]=> NULL ["robots"]=> NULL ["access-edit"]=> bool(true) ["access-view"]=> bool(true) } } I've tried $params-data-list_show_author = "0" but then the page doesn't load, problem is accessing and changing the variables in $param. So the last step is to figure out how not to show the article. Any ideas?

    Read the article

  • Parsing String to TreeNode

    - by Krusu70
    Anyone have a good algorithm how to parse a String to TreeNode in Java? Let's say we have a string s which says how to build a TreeNode. A(B,C) means that A is the name (String) of TreeNode, B is child of A (Treenode), C is sibling of A (TreeNode). So if I call function with string A(B(D,E(F,G)),C) (just a example), then I get a TreeNode equals to: level A (String: name), B - Child (TreeNode), C - Sibling (TreeNode) level B (String: name), D - Child of B (TreeNode), E - Sibling of B (TreeNode) level E (String: name), F - Child of E (TreeNode), G - Sibling of E (TreeNode) The name may not be 1 letter, it could be like real name (many letters).

    Read the article

  • PHP strip_tags only at the end of the string

    - by Solomon Closson
    Ok, well, I just want to use strip_tags function on the very end of a string to get rid of any <br /> tags. Here's what I have now, but this is no good because it strips these tags from everywhere in the string, which is not what I want. I only need them stripped out if it's at the end of the string... $string = strip_tags($string, strtr($string, array('<br />' => '&#10;'))); How can I do this same thing, except only at the very end of a string?? Thanks guys!!

    Read the article

< Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >